help button home button
AJRCCM
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Published ahead of print on December 20, 2007, doi:10.1164/rccm.200704-641OC
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Online Supplement
Right arrow All Versions of this Article:
200704-641OCv1
177/7/763    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Ho, C.-C.
Right arrow Articles by Yang, P.-C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Ho, C.-C.
Right arrow Articles by Yang, P.-C.
American Journal of Respiratory and Critical Care Medicine Vol 177. pp. 763-770, (2008)
© 2008 American Thoracic Society
doi: 10.1164/rccm.200704-641OC

Original Article

TREM-1 Expression in Tumor-associated Macrophages and Clinical Outcome in Lung Cancer

Chao-Chi Ho1,2, Wei-Yu Liao1,2, Cheng-Yi Wang3, Yin-Hsiu Lu4, Hsin-Yi Huang5, Hsuan-Yu Chen4,6, Wing-Kai Chan7, Huei-Wen Chen8 and Pan-Chyr Yang1

1 Department of Internal Medicine and 2 Department of Emergency Medicine, National Taiwan University Hospital and National Taiwan University College of Medicine, Taipei, Taiwan; 3 Department of Internal Medicine, Catholic Cardinal Hsien Tien Hospital, Fu-Jen Catholic University, Taipei, Taiwan; 4 Center for Genomic Medicine, National Taiwan University College of Medicine, Taipei, Taiwan; 5 Department of Pathology, National Taiwan University Hospital and National Taiwan University College of Medicine, Taipei, Taiwan; 6 Institute of Statistical Sciences, Academia Sinica, Taipei, Taiwan; 7 Department of Medical Research, National Taiwan University Hospital, Taipei, Taiwan; and 8 Department and Institute of Pharmacology, National Yang Ming University, Taipei, Taiwan

Correspondence and requests for reprints should be addressed to Dr. Pan-Chyr Yang, M.D., Ph.D., Department of Internal Medicine, National Taiwan University Hospital, No. 7, Chung-Shan South Road, Taipei, Taiwan 100, Republic of China. E-mail: pcyang{at}ntu.edu.tw


   ABSTRACT
TOP
 ABSTRACT
AT A GLANCE COMMENTARY
 METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Rationale: Triggering receptor expressed on myeloid cells (TREM)-1 is a molecule crucial for the triggering and amplification of inflammatory response and a new biomarker for sepsis. Tumor-associated macrophages and inflammation in the tumor microenvironment are also involved in cancer progression.

Objectives: To determine the role of TREM-1 in tumor-associated macrophage and cancer progression.

Methods: Using ELISA and Western blot, we measured soluble TREM-1 levels in 65 pleural effusions of various etiologies. We evaluated TREM-1–positive cells by immunocytochemistry in malignant pleural effusion and in lung tumor versus adjacent normal tissue in surgical specimens from 68 patients with non–small cell lung cancer (NSCLC). TREM-1 expression was correlated with patient survival. TREM-1 expression in primary isolated peripheral blood macrophages cocultured with lung cancer cell lines was determined by quantitative real-time reverse transcriptase–polymerase chain reaction.

Measurements and Main Results: Soluble TREM-1 and tumor-associated macrophage TREM-1 expression was increased in malignant pleural effusions in patients with NSCLC. Lung cancer cells could directly up-regulate TREM-1 and proinflammatory cytokine (tumor necrosis factor-{alpha}, IL-1β) expression in primary isolated peripheral blood macrophages in coculture experiments. Increased TREM-1–positive tumor-associated macrophages in tumor tissue of patients with NSCLC were associated with reduced disease-free (P = 0.011) and overall survival (P = 0.004). Multivariate Cox regression analysis indicated that TREM-1 was an independent predictor of patient survival (hazard ratio, 2.72; 95% confidence interval, 1.33–5.57; P = 0.006).

Conclusions: Cancer cells can directly up-regulate TREM-1 expression in patients' macrophages. TREM-1 expression in tumor-associated macrophages is associated with cancer recurrence and poor survival of patients with NSCLC. TREM-1 and the inflammatory response may play an important role in cancer progression.

Key Words: TREM-1 • non-small cell lung cancer • macrophage • inflammation



   AT A GLANCE COMMENTARY
TOP
 ABSTRACT
 AT A GLANCE COMMENTARY
METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Scientific Knowledge on the Subject
TREM-1 is a novel molecule for the triggering and amplification of inflammatory response and a new biomarker for sepsis. The role of TREM-1 in cancer progression is unknown.

What This Study Adds to the Field
TREM-1 is expressed in tumor-associated macrophages (TAM) in malignant effusion and tumor tissue of non–small cell lung cancer. Lung cancer cells directly up-regulate TREM-1 expression in macrophages of patients with lung cancer. TREM-1 expression in TAM is associated with cancer recurrence and poor survival of patients.

 
Metastasis is the major cause of deaths in cancer (1). The metastatic process may involve cell proliferation, invasion, migration, and angiogenesis, etc. (2). Inflammatory response in the tumor microenvironment may facilitate the metastatic process (3). Tumor cells can use the innate immune system signal pathways, such as selectins, chemokines, and their receptors, for invasion, migration, and metastasis (3). Macrophages are pivotal members of the inflammatory cells and the innate immune system within the tumor stroma. Tumor-associated macrophages can release growth factors, cytokines, and inflammatory mediators that may facilitate cancer cell invasion, migration, angiogenesis, tumor progression, or metastasis (3–7).

Triggering receptor expressed on myeloid cells (TREM)-1 is a receptor expressed on neutrophils and macrophages/monocytes. TREM-1 can trigger and amplify the inflammatory response (8). TREM-1 is greatly up-regulated by bacterial infections, fungal infections, or sepsis (8–13). TREM-1 also amplifies the inflammatory response and is a crucial mediator of septic shock (9, 14). TREM-1 may be up-regulated in some inflammatory conditions, such as acute pancreatitis, peptic ulcer, or after major surgery (15–17). TREM-1 was hardly detectable in other inflammatory conditions, such as psoriasis, ulcerative colitis, and vasculitis caused by immune complexes (9).

TREM-1 is a transmembrane glycoprotein consisting of a single extracellular immunoglobulin-like domain, a transmembrane region, and a short cytoplasmic tail (8, 9). TREM-1 is expressed as a transmembrane receptor complex with adaptor protein DNA X-activating protein of 12 kD (DAP12) in myeloid cells (8, 18). After TREM-1 cross-linking, phosphorylated DAP12 recruits and phosphorylates growth receptor binding protein 2 and phosphatidylinositol-3 kinase, and amplifies Toll-like receptors (19). TREM-1 can enhance the release of IL-8, myeloperoxidase, monocyte chemoattractant protein-1, monocyte chemoattractant protein-3, macrophage inflammatory protein-1{alpha}, tumor necrosis factor (TNF)-{alpha}, granulocyte-monocyte colony–stimulating factor (GM-CSF), and IL-1{alpha} from neutrophils or monocytes after LPS stimulation (8, 20). TREM-1 expression is associated with mature myeloid cell development (19).

TREM-1 is shed from the membrane of activated phagocytes without the transmembrane and intracellular domains, and can be found as soluble TREM (sTREM)-1 in body fluids (10–13, 21). sTREM-1 is a diagnostic marker for sepsis or pneumonia (10–12, 21). The role of TREM-1 in cancer progression is unknown.

In this study, we investigated whether cancer cells can directly stimulate TREM-1 expression in primary isolated peripheral blood monocytes/macrophages. We also investigated the expression of TREM-1 in tumor-associated macrophages in tumor tissue of patients with lung cancer and their association with clinical outcome.


   METHODS
TOP
 ABSTRACT
 AT A GLANCE COMMENTARY
 METHODS
RESULTS
 DISCUSSION
 REFERENCES
 
Pleural Effusion Collection
Sixty-five patients with pleural effusion from different etiologies were prospectively collected at our institute from February 2005 to August 2005. This investigation was approved by the institutional review board of National Taiwan University Hospital. Written, informed consent was obtained from all patients.

Measurement of sTREM-1 and Cytokines
The levels of sTREM-1 expressed in pleural effusion or culture mediums were measured using the ELISA technique (R&D Systems, Minneapolis, MN). All measurements were performed in duplicate. TNF-{alpha} and IL-1β in culture medium were determined using cytokine-specific ELISAs as per the manufacturer's protocol (R&D Systems). Additional detail is provided in the online supplement.

Prepared and then Primary Isolate of Peripheral Blood Monocytes and Cocultured with Cancer Cells
Thirty milliliters of peripheral blood samples were collected from seven healthy volunteer originating from the laboratory staff. Monocyte purification involved centrifugation and selection by magnetic cell sorter using antibody to CD14 linked to magnetic microbeads (Miltenyi Biotech, Auburn, CA). Cells were plated in 24-well plates at a concentration of 2 x 106. After 24 hours of adhesion, each well were stimulated with 1 µg/ml Escherichia coli LPS (Sigma-Aldrich, St. Louis, MO) or cocultured with 5 x 105 cells (invasive lung cancer cells [CL1-5 and A549], and nonmalignant human bronchial epithelial cells [BEAS-2B] and endothelial cells [HUVACs]) for 24 hours (22, 23). We spun down the culture medium and collected the supernatant for detection of sTREM-1, IL-1β, and TNF-{alpha}. Additional detail is provided in the online supplement for quantitative reverse transcriptase–polymerase chain reaction (RT-PCR) of TREM-1 expression in monocytes.

Indirect Immunofluorescent Staining of TREM-1 Expression
Monocytes and cancer cells cocultured on glass coverslips, cells for sediment smear spread on the slide, and paraffin-embedded 5-µm-thick sections were all incubated with anti-human TREM-1 antibody (AF1278, 1:50; R&D Systems) (24). For double staining, specimens were incubated with anti-human CD68 antibody (clone KP1, 1:100; Dako, Glostrup, Denmark). Additional detail is provided in the online supplement.

In Vitro Cell Invasion Assay
In vitro invasion assays were performed as previously described using trans-well chambers (8-µm pore size; Costar, Cambridge, MA) and trans-well filters coated with Matrigel (Becton Dickinson, Franklin Lakes, NJ) (25). Cells (5 x 103 CL1-5) were seeded onto the Matrigel and incubated for 16 hours. Membranes were swabbed with cotton, fixed with methanol and stained with 20% Giemza solution (Sigma Chemical Co., St. Louis, MO). The cells that were attached to the lower surface of membranes were counted under a light microscope. The experiments were performed three times in triplicate. To activate monocytes by TREM-1, a different concentration of anti–TREM-1 agonist monoclonal antibody (MAB1278, produced from extracellular domain; R&D Systems) was added in the lower chamber with monocytes (1 x 106) in invasion assays.

Virus Preparation and Transfection
Luciferase short hairpin (sh)RNA and TREM-1 shRNA containing lentiviral vectors were obtained from the National RNAi Core Facility, Academia Sinica, Taiwan. A target sequence from 301–321 bp (GTCAACCTTCAAGTGGAAGAT) was used for TREM-1 shRNA (see the online supplement). Lentiviruses were prepared according to the standard protocol. THP-1 macrophages (1 x 106) were prepared (26), seeded in the lower chamber, and infected with lentivirus (multiplicity of infection [MOI] = 10) in media containing polybrene (8 µg/ml). After 24 hours postinfection, the culture medium was changed. Another 24 hours later, in vitro invasion assays were performed.

Immunohistochemistry of TREM-1 in Patients' Lung Tumor Specimens
Tumor specimens from 68 patients who underwent surgical resection of their primary non–small cell lung cancer (NSCLC) at our institute between September 1996 and September 1998 were examined for TREM-1 expression. Immunohistochemical staining was performed using a modified avidin–biotin peroxidase complex method (9, 27, 28). Primary antibody anti–TREM-1 antibody (AF1278, 1:80; R&D Systems) and isotype-matched control antibody (anti–caveolin-3 antibody, sc-7665, 1:100; Santa Cruz Biotechnology, Inc., Santa Cruz, CA) were used. Sections were screened at x100 magnification to identify the regions of greatest numbers of TREM-1–positive cells. Two pathologists counted cell density at x400 magnification in three regions with the greatest numbers of TREM-1–positive cells. We used the mean value of TREM-1–positive cells per high-power field (mean = 15) as the cutoff point to divide tumors into high or low TREM-1 expression. Additional detail is provided in the online supplement.

Statistical Analysis
The difference in characteristics between two groups was analyzed using the Student t test for continuous variables or Fisher's exact test for categorical variables. The Kaplan-Meier method was used to estimate overall survival. Differences in survival between two groups were analyzed using the log-rank test. Univariate and multivariate Cox proportional hazard regression analyses were used to evaluate independent prognostic factors associated with patient survival. TREM-1 expression, age, sex, stage and histology were used as covariates. All analyses were done with SAS version 9.1 software (SAS Institute, Inc., Cary, NC). P values less than 0.05 were considered significant, and two-tailed tests were used in this study.


   RESULTS
TOP
 ABSTRACT
 AT A GLANCE COMMENTARY
 METHODS
 RESULTS
DISCUSSION
 REFERENCES
 
Increased sTREM-1 in Malignant Pleural Effusion from Patients with NSCLC without Infection
We measured sTREM-1 by ELISA in four groups of pleural effusions from 65 patients, as follows: group 1, transudate pleural effusions due to congestive heart failure or reactive effusion postoperation; group 2, parapneumonic pleural effusions; group 3, malignant pleural effusions with positive cytology and no infection; and group 4, exudate pleural effusions caused by malignancy but with negative cytology and no infection. sTREM-1 levels in pleural effusions of the four groups are shown in Figure 1A. sTREM-1 levels were elevated in malignant pleural effusions compared with transudate pleural effusions (P = 0.017), but this was not significantly different compared with parapneumonic pleural effusions (P = 0.309). sTREM-1 expression in malignant pleural effusions was confirmed by Western blot analysis (Figure 1B).


Figure 1
View larger version (20K):
[in this window]
[in a new window]

  		Figure 1. Soluble triggering receptor expressed on myeloid cells (sTREM)-1 (in 65 pleural effusions). (A) sTREM-1 in pleural effusions measured by ELISA. The horizontal bars represent the mean values. (B) sTREM-1 in pleural effusions confirmed by Western blot. sTREM-1 control came from culture medium of monocytes stimulated by LPS. *P < 0.05 compared with transudate pleural effusions.

 
TREM-1 Was Expressed in Macrophages but Not in Cancer Cells
To identify the source of sTREM-1 in malignant pleural effusion, we examined TREM-1 expression in various tissue specimens obtained from the patients. Immunostaining of malignant effusion sediment smears, sections of malignant effusion cell block, and lung cancer tissues all showed that the cells with TREM-1 expression were macrophages with positive staining of CD68 (Figures 2A–2C).


Figure 2
View larger version (39K):
[in this window]
[in a new window]

  		Figure 2. Triggering receptor expressed on myeloid cells (TREM)-1 expression in pleural effusions, tumor tissues, and peripheral blood monocytes cocultured with cancer cells. All specimens were double-stained by TREM-1 and CD68 antibodies. TREM-1 expression was found only in macrophages (CD68+ cells). (A) Smear of malignant pleural effusion sediment; (B) section of cell block from malignant pleural effusions, (C) in patients' tumor tissue sections, and (D) in peripheral blood monocytes after coculture with A549 lung cancer cells (arrowheads indicate macrophages; arrows indicate cancer cells).

 
TREM-1 in Blood Monocytes Was Up-regulated by Lung Cancer Cells but Not by Nonmalignant Cells
TREM-1 expression was up-regulated in peripheral blood macrophages after coculture with lung cancer cells (Figure 2D).

To confirm that cancer cells can directly stimulate monocyte TREM-1 expression, we cocultured primary isolated peripheral blood monocytes with lung cancer cells and then analyzed the sTREM-1 levels in the culture medium. The level of sTREM-1 was increased in the culture medium supernatants of human monocytes after coculture with lung cancer cells, including CL1-5 and A549 compared with nonmalignant bronchial epithelial cells (BEAS-2B) or nonmalignant endothelial cells (HUVACs) (Figure 3A). Quantitative RT-PCR results confirmed increased expression of the TREM-1 transcript in human monocytes after coculture with cancer cells (Figure 3B).


Figure 3
View larger version (16K):
[in this window]
[in a new window]

  		Figure 3. Soluble triggering receptor expressed on myeloid cells (sTREM)-1 and TREM-1 RNA up-regulation in peripheral blood monocytes after coculture with cancer cells. (A) Primary isolated peripheral blood monocytes were cocultured with invasive lung cancer cells (CL1-5 and A549) and nonmalignant human bronchial epithelial (BEAS-2B) and endothelial cells (HUVAC). Monocytes activated by LPS (1 µg/ml) were used as a positive control. Tumor necrosis factor (TNF)-{alpha}, IL-1β, and sTREM-1 levels in culture medium supernatants were analyzed by ELISA. (B) TREM-1 RNA from macrophages after coculture with cancer cells were measured by quantitative reverse transcriptase–polymerase chain reaction (RT-PCR). Monocytes activated by LPS were used as a positive control.

 
Proinflammatory cytokines TNF-{alpha} and IL-1β were significantly increased in the culture supernatant of human monocytes cocultured with lung cancer cells compared with monocytes cocultured with nonmalignant BEAS-2B cells or HUVACs (Figure 3A).

Activation of Blood Monocytes by TREM-1 Increased Invasive Ability of Cancer Cells
To demonstrate direct involvement of macrophage-associated TREM-1 in cancer invasion, we cocultured primary isolated peripheral blood monocytes with lung cancer cells by trans-well coculture systems. To activate monocytes by TREM-1, we added an agonist anti–TREM-1 monoclonal antibody (MAB1278, extracellular domain; R&D Systems) with monocytes in the lower chamber, co-culture for 16 hours and then analyzed cancer cells' invasive ability by in vitro invasion assays. TNF-{alpha} increased in culture supernatant after antibody stimulation (Figure 4A). The invasive ability of cancer cells increased dose dependently when the antibody concentration was greater than 5 µg/ml (P < 0.01) (Figure 4B).


Figure 4
View larger version (21K):
[in this window]
[in a new window]

  		Figure 4. Activation of blood monocytes by triggering receptor expressed on myeloid cells (TREM)-1 agonist increased cancer cells invasive ability. (A) Different concentrations of TREM-1 agonist (anti–TREM-1 monoclonal antibody, MAB1278; R&D Systems, Minneapolis, MN) were added in the lower chamber with blood monocytes and cocultured with CL1-5 cancer cells that were seeded in the upper chamber. TNF-{alpha} levels in culture medium supernatants were analyzed after coculture for 16 hours. (B) CL1-5 cells that invaded to the lower surface of membranes were counted after 16 hours of coculture. {dagger}P < 0.05, compared with concentration of 0 µg/ml; *P < 0.01, compared with concentration of 0 µg/ml.

 
Inhibition of TREM-1 by shRNA in Macrophages Resulted in a Loss of Invasive Potential in Cancer Cells
To knock down TREM-1 expression, lentiviruses containing TREM-1 shRNA were prepared. Luciferase shRNA was used as a control. THP-1 macrophages were infected with lentivirus and were then cocultured with cancer cells for 16 hours. Compared with luciferase shRNA, TREM-1 shRNA–infected THP-1 macrophages consistently showed at least 80% reduction in the expression of TREM-1 protein and mRNA levels (Figures 5A and 5B). In the in vitro invasion assays, the cancer cells' invasive ability decreased significantly (P < 0.01) after coculture with TREM-1 shRNA–infected macrophages (Figure 5C).


Figure 5
View larger version (16K):
[in this window]
[in a new window]

  		Figure 5. Inhibition of triggering receptor expressed on myeloid cells (TREM)-1 by shRNA in macrophages suppresses cancer cell invasion. (A) Western blot of THP-1 macrophages infected with lentivirus containing TREM-1 shRNA after trans-well coculture with cancer cells for 16 hours. Luciferase shRNA was used as a control. (B) TREM-1 mRNA expressions in macrophages were measured by quantitative reverse transcriptase–polymerase chain reaction (RT-PCR) after 16 hours of coculture. {dagger}P < 0.05, compared with control. (C) Cancer cells' invasive ability was measured by in vitro invasion chamber assays after coculture with macrophages. *P < 0.01, compared with control.

 

Figure 6
View larger version (162K):
[in this window]
[in a new window]

  		Figure 6. Triggering receptor expressed on myeloid cells (TREM)-1–positive cells in non–small cell lung cancer tumor specimens. (A) Immunohistochemistry using anti–TREM-1 antibody showed TREM-1–positive cells were localized in the stroma and cancer margin (arrowheads). (B) Negative control using anti–caveolin-3 antibody. (C) Enlarged view of (A). (D) Enlarged view from another patient. T indicates tumor part. Arrowheads indicate TREM-1–positive cells.

 

Figure 7
View larger version (12K):
[in this window]
[in a new window]

  		Figure 7. Triggering receptor expressed on myeloid cells (TREM)-1–positive tumor-associated macrophages in tumor of patients with non–small cell lung cancer (NSCLC) correlates with clinical outcome. (A) Kaplan-Meier estimates of disease-free survival in 68 patients with NSCLC according to high or low TREM-1 expression. (B) Kaplan-Meier estimates of overall survival in 68 patients with NSCLC according to high or low TREM-1 expression.

 
Increased TREM-1 Expression in Tumor Tissue of Patients with NSCLC Is Associated with Poor Clinical Outcome
In Figure 2C, immunostaining of lung cancer tissue sections showed that TREM-1 was only expressed in macrophages as confirmed by positive CD68 staining. We examined TREM-1 expression in paraffin-embedded tumor tissues from patients who underwent surgical resection for their NSCLC. All TREM-1–positive cells identified were tumor-associated macrophages (Figure 6, arrowhead). We used the mean value of TREM-1–positive cells per high-power field (mean = 15) as the cutoff point to divide tumors into high or low TREM-1 expression. There was no significant difference in clinical characteristics between patients with low versus high TREM-1 expression (Table 1). Patients' median follow-up time was 41 months. The disease-free survival of patients with high TREM-1 expression (median, 22 mo) was shorter than those with low TREM-1 expression (median not reached; P = 0.011, log-rank test) as shown in Figure 7A. The overall survival of patients with high TREM-1 expression (median, 29 mo) was significantly shorter than those with low TREM-1 expression (median not reached; P = 0.004, log-rank test) as shown in Figure 7B. Univariate Cox regression analysis showed that TREM-1 expression was associated with overall survival of patients with NSCLC (Table 2). Multivariate Cox regression analysis showed that high TREM-1 expression was the only factor associated with reduced overall survival of patients with NSCLC (hazard ratio, 2.72; 95% confidence interval, 1.33–5.57; P = 0.006) (Table 2).


View this table:
[in this window]
[in a new window]

  		TABLE 1. CLINICAL CHARACTERISTICS OF PATIENTS

 

View this table:
[in this window]
[in a new window]

  		TABLE 2. UNIVARIATE AND MULTIVARIATE ANALYSIS OF TREM-1 AND SURVIVAL IN NON–SMALL CELL LUNG CANCER

 

   DISCUSSION
TOP
 ABSTRACT
 AT A GLANCE COMMENTARY
 METHODS
 RESULTS
 DISCUSSION
REFERENCES
 
The interaction of cancer cells, macrophages, and inflammatory response in the tumor microenvironment may facilitate cancer cell invasion, angiogenesis, tumor progression, or metastasis (6, 27, 29, 30). TREM-1 is a receptor expressed by macrophages. TREM-1 is crucial in the triggering and amplification of inflammatory response and is a diagnostic marker for sepsis or pneumonia. The role of TREM-1 in cancer progression is unknown.

Results of this study indicate that TREM-1 is expressed in tumor-associated macrophages in the tumor microenvironment in malignant pleural effusion and primary lung tumor. We found that lung cancer cells can directly stimulate TREM-1 expression and proinflammatory cytokine production in primary isolated peripheral blood macrophages. We showed that TREM-1 expression in tumor-associated macrophages in tumor tissue of patients with NSCLC was associated with reduced disease-free and overall survival. TREM-1 expression is an independent predictor of survival in NSCLC, and may be involved in cancer progression in patients with lung cancer.

Our finding that cancer cells can directly stimulate TREM-1 expression in peripheral macrophages by direct contact may explain the observation that increased TREM-1–positive macrophages in tumor tissue of patients with NSCLC can predict increased cancer recurrence and poor patient survival. TREM-1 may be the missing link between tumor-associated macrophage activation, inflammatory response, tumor microenvironment, and cancer progression.

Our finding that cancer cells could up-regulate proinflammatory cytokine (TNF-{alpha} and IL-1β) expression in primary isolated macrophages may explain the increased TNF-{alpha} and IL-1β observed in the blood or bronchoalveolar lavage of patients with lung cancer (7, 31–36). Our data are consistent with previous reports from our group and others that cytokine production is increased in macrophages cocultured with cancer cells (26, 37, 38).

TREM-1 macrophage activation may play an important role in cancer progression. This is suggested by the fact that increased TREM-1–positive macrophages in tumor tissue of patients with NSCLC are associated with reduced disease-free and overall survival in this study. We also found abundant macrophages in the stroma and invasive margin of the tumor tissue, and these macrophages have both TREM-1 and CD68 expressions. CD68 is a macrophage marker for tumor-associated macrophages that plays an important role in angiogenesis and metastasis and was most abundant in the stroma and invasive margin of lung adenocarcinoma (26, 27). Increased TREM-1 expression associated with increased cancer recurrence and poor patient survival in this study may support the hypothesis that macrophages/inflammatory response are a double-edged sword in cancer progression (26).

Previous reports of various other inflammatory cytokines had no correlation with patient survival (31–36, 38). A recent report of macrophage CSF level in serum can predict patient prognosis in NSCLC indicates that macrophages may be a key player in cancer progression (33).

Our finding that TREM-1 expression can predict cancer recurrence and survival of patients with lung cancer may have important clinical implications. High TREM-1 expression may be a better predictor shown to outperform clinical/pathologic staging. The prognostic significance of TREM-1–positive tumor-infiltrating macrophages in surgical tumor samples may be merely a reflection of the prognostic significance of infiltrating macrophages, which overexpress hypoxia responsive transcription factor HIF-{alpha}, IL–8, and vascular endothelial growth factor (26, 39). These factors may contribute to enhanced tumor angiogenesis and correlate with poor prognosis (26).

Our findings that increased TREM-1 expression in tumor-associated macrophages of patients with NSCLC is associated with cancer recurrence and poor survival may have other clinical implications. TREM-1 may be a potential target for the development of new, targeted anticancer therapy to inhibit the TREM-1 pathway, block the specific inflammatory response, and stop the cancer progression. Blocking activation of the TREM-1 pathway may be feasible using fusing protein containing the TREM-1 extracellular domain and immunoglobulin-{gamma} Fc portion or by synthetic peptide mimicking the reserved domain of sTREM-1, which has been shown to block the inflammatory response to infection and protect mice against septic shock (9, 13).

This study may have several limitations. We showed that TREM-1 is associated with clinical outcome of NSCLC using Chinese patients. Chinese patients may have different clinicopathologic characteristics compared with the Western population (40). The patient sample size was also relatively small. We showed that cancer cells can directly stimulate peripheral macrophages to up-regulate TREM-1 expression, but the mechanisms remain to be elucidated.

In conclusion, TREM-1 expression in macrophages can be directly up-regulated by cancer cells. Increased TREM-1 expression in tumor-associated macrophages in tumor tissue of patients with NSCLC is associated with increased cancer recurrence and poor survival. TREM-1 and the inflammatory response may play an important role in cancer progression.


   Acknowledgments
 
The authors thank Yu-Feng Wei, Kou-chou Hsieh for sample collection and Ting-Fang Che for lentivirus preparation. shRNA constructs were obtained from the National RNAi Core Facility located at the Institute of Molecular Biology/Genomic Research Center, Academia Sinica, supported by the National Research Program for Genomic Medicine Grants of the National Science Council (NSC-94-3112-B-001-003 and NSC-94-3112-B-001-018-Y).


   FOOTNOTES
 
Supported by grants from the National Science Council (Taiwan) numbers 94-2314-B-002-220 and 95-2314-B002-086-MY3 to C.-C. H.

This article has an online supplement, which is accessible from this issue's table of contents at www.atsjournals.org

Originally Published in Press as DOI: 10.1164/rccm.200704-641OC on December 20, 2007

Conflict of Interest Statement: None of the authors has a financial relationship with a commercial entity that has an interest in the subject of this manuscript.

Received in original form April 30, 2007; accepted in final form December 20, 2007


   REFERENCES
TOP
 ABSTRACT
 AT A GLANCE COMMENTARY
 METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Sporn MB. The war on cancer. Lancet 1996;347:1377–1381.[CrossRef][Medline]
  2. Hanahan D, Weinberg RA. The hallmarks of cancer. Cell 2000;100:57–70.[Medline]
  3. Coussens LM, Werb Z. Inflammation and cancer. Nature 2002;420:860–867.[CrossRef][Medline]
  4. Crowther M, Brown NJ, Bishop ET, Lewis CE. Microenvironmental influence on macrophage regulation of angiogenesis in wounds and malignant tumors. J Leukoc Biol 2001;70:478–490.[Abstract/Free Full Text]
  5. Lin EY, Nguyen AV, Russell RG, Pollard JW. Colony-stimulating factor 1 promotes progression of mammary tumors to malignancy. J Exp Med 2001;193:727–740.[Abstract/Free Full Text]
  6. Mantovani A. Cancer inflammation by remote control. Nature 2005;435:752–753.[CrossRef][Medline]
  7. Pollard JW. Tumour-educated macrophages promote tumour progression and metastasis. Nat Rev Cancer 2004;4:71–78.[CrossRef][Medline]
  8. Bouchon A, Dietrich J, Colonna M. Cutting edge: inflammatory responses can be triggered by TREM-1, a novel receptor expressed on neutrophils and monocytes. J Immunol 2000;164:4991–4995.[Abstract/Free Full Text]
  9. Bouchon A, Facchetti F, Weigand MA, Colonna M. TREM-1 amplifies inflammation and is a crucial mediator of septic shock. Nature 2001;410:1103–1107.[CrossRef][Medline]
  10. Gibot S, Cravoisy A, Kolopp-Sarda MN, Bene MC, Faure G, Bollaert PE, Levy B. Time-course of sTREM (soluble triggering receptor expressed on myeloid cells)-1, procalcitonin, and C-reactive protein plasma concentrations during sepsis. Crit Care Med 2005;33:792–796.[CrossRef][Medline]
  11. Gibot S, Cravoisy A, Levy B, Bene M-C, Faure G, Bollaert P-E. Soluble triggering receptor expressed on myeloid cells and the diagnosis of pneumonia. N Engl J Med 2004;350:451–458.[Abstract/Free Full Text]
  12. Gibot S, Kolopp-Sarda M-N, Bene MC, Cravoisy A, Levy B, Faure GC, Bollaert P-E. Plasma level of a triggering receptor expressed on myeloid cells-1: its diagnostic accuracy in patients with suspected sepsis. Ann Intern Med 2004;141:9–15.[Abstract/Free Full Text]
  13. Gibot S, Kolopp-Sarda M-N, Bene M-C, Bollaert P-E, Lozniewski A, Mory F, Levy B, Faure GC. A soluble form of the triggering receptor expressed on myeloid cells-1 modulates the inflammatory response in murine sepsis. J Exp Med 2004;200:1419–1426.[Abstract/Free Full Text]
  14. Nathan C, Ding A. TREM-1: a new regulator of innate immunity in sepsis syndrome. Nat Med 2001;7:530–532.[CrossRef][Medline]
  15. Gonzalez-Roldan N, Ferat-Osorio E, Aduna-Vicente R, Wong-Baeza I, Esquivel-Callejas N, Astudillo-de la Vega H, Sanchez-Fernandez P, Arriaga-Pizano L, Villasis-Keever MA, Lopez-Macias C, et al. Expression of triggering receptor on myeloid cell 1 and histocompatibility complex molecules in sepsis and major abdominal surgery. World J Gastroenterol 2005;11:7473–7479.[Medline]
  16. Koussoulas V, Vassiliou S, Demonakou M, Tassias G, Giamarellos-Bourboulis EJ, Mouktaroudi M, Giamarellou H, Barbatzas C. Soluble triggering receptor expressed on myeloid cells (sTREM-1): a new mediator involved in the pathogenesis of peptic ulcer disease. Eur J Gastroenterol Hepatol 2006;18:375–379.[CrossRef][Medline]
  17. Wang DY, Qin RY, Liu ZR, Gupta MK, Chang Q. Expression of TREM-1 mRNA in acute pancreatitis. World J Gastroenterol 2004;10:2744–2746.[Medline]
  18. Dietrich J, Cella M, Seiffert M, Buhring H-J, Colonna M. Cutting edge: signal-regulatory protein β1 is a DAP12-associated activating receptor expressed in myeloid cells. J Immunol 2000;164:9–12.[Abstract/Free Full Text]
  19. Gingras M-C, Lapillonne H, Margolin JF. TREM-1, MDL-1, and DAP12 expression is associated with a mature stage of myeloid development. Mol Immunol 2002;38:817–824.[CrossRef][Medline]
  20. Bleharski JR, Kiessler V, Buonsanti C, Sieling PA, Stenger S, Colonna M, Modlin RL. A role for triggering receptor expressed on myeloid cells-1 in host defense during the early-induced and adaptive phases of the immune response. J Immunol 2003;170:3812–3818.[Abstract/Free Full Text]
  21. Colonna M. TREMs in the immune system and beyond. Nat Rev Immunol 2003;3:445–453.[CrossRef][Medline]
  22. Chen JJW, Peck K, Hong T-M, Yang S-C, Sher Y-P, Shih J-Y, Wu R, Cheng J-L, Roffler SR, Wu C-W, et al. Global analysis of gene expression in invasion by a lung cancer model. Cancer Res 2001;61:5223–5230.[Abstract/Free Full Text]
  23. Shih J-Y, Yang S-C, Hong T-M, Yuan A, Chen JJW, Yu C-J, Chang Y-L, Lee Y-C, Peck K, Wu C-W, et al. Collapsin response mediator protein-1 and the invasion and metastasis of cancer cells. J Natl Cancer Inst 2001;93:1392–1400.[Abstract/Free Full Text]
  24. Mohamadzadeh M, Coberley SS, Olinger GG, Kalina WV, Ruthel G, Fuller CL, Swenson DL, Pratt WD, Kuhns DB, Schmaljohn AL. Activation of triggering receptor expressed on myeloid cells-1 on human neutrophils by Marburg and ebola viruses. J Virol 2006;80:7235–7244.[Abstract/Free Full Text]
  25. Albini A, Iwamoto Y, Kleinman HK, Martin GR, Aaronson SA, Kozlowski JM, McEwan RN. A rapid in vitro assay for quantitating the invasive potential of tumor cells. Cancer Res 1987;47:3239–3245.[Abstract/Free Full Text]
  26. Chen JJW, Lin Y-C, Yao P-L, Yuan A, Chen H-Y, Shun C-T, Tsai M-F, Chen C-H, Yang P-C. Tumor-associated macrophages: the double-edged sword in cancer progression. J Clin Oncol 2005;23:953–964.[Abstract/Free Full Text]
  27. Takanami I, Takeuchi K, Kodaira S. Tumor-associated macrophage infiltration in pulmonary adenocarcinoma: association with angiogenesis and poor prognosis. Oncology 1999;57:138–142.[CrossRef][Medline]
  28. Chen JJW, Yao P-L, Yuan A, Hong T-M, Shun C-T, Kuo M-L, Lee Y-C, Yang P-C. Up-regulation of tumor interleukin-8 expression by infiltrating macrophages: its correlation with tumor angiogenesis and patient survival in non-small cell lung cancer. Clin Cancer Res 2003;9:729–737.[Abstract/Free Full Text]
  29. Balkwill F, Mantovani A. Inflammation and cancer: back to Virchow? Lancet 2001;357:539–545.[CrossRef][Medline]
  30. Mantovani A, Sozzani S, Locati M, Allavena P, Sica A. Macrophage polarization: tumor-associated macrophages as a paradigm for polarized M2 mononuclear phagocytes. Trends Immunol 2002;23:549–555.[CrossRef][Medline]
  31. Balkwill F, Osborne R, Burke F, Naylor S, Talbot D, Durbin H, Tavernier J, Fiers W. Evidence for tumour necrosis factor/cachectin production in cancer. Lancet 1987;2:1229–1232.[CrossRef][Medline]
  32. Guadagni F, Ferroni P, Basili S, Facciolo F, Carlini S, Crecco M, Martini F, Spila A, D'Alessandro R, Aloe S. Correlation between tumor necrosis factor-alpha and -dimer levels in non-small cell lung cancer patients. Lung Cancer 2004;44:303–310.[CrossRef][Medline]
  33. Kaminska J, Kowalska M, Kotowicz B, Fuksiewicz M, Glogowski M, Wojcik E, Chechlinska M, Steffen J. Pretreatment serum levels of cytokines and cytokine receptors in patients with non-small cell lung cancer, and correlations with clinicopathological features and prognosis. M-CSF: an independent prognostic factor. Oncology 2006;70:115–125.[CrossRef][Medline]
  34. Matanic D, Beg-Zec Z, Stojanovic D, Matakoric N, Flego V, Milevoj-Ribic F. Cytokines in patients with lung cancer. Scand J Immunol 2003;57:173–178.[CrossRef][Medline]
  35. Trejo YG, Bordenave RH, Beviacqua M, Rumi LS. In vitro secretion of cytokines and prostaglandin-E2 by monocytes from lung cancer patients. Respir Med 2001;95:243–245.[CrossRef][Medline]
  36. Trejo YG, Bordenave RH, Beviacqua M, Zanoni L, Rumi LS. Tumor necrosis factor-alfa production by monocytes from lung and colorectal cancer patients. J Exp Clin Cancer Res 2001;20:71–73.[Medline]
  37. Voronov E, Shouval DS, Krelin Y, Cagnano E, Benharroch D, Iwakura Y, Dinarello CA, Apte RN. IL-1 is required for tumor invasiveness and angiogenesis. Proc Natl Acad Sci USA 2003;100:2645–2650.[Abstract/Free Full Text]
  38. Yao P-L, Lin Y-C, Wang C-H, Huang Y-C, Liao W-Y, Wang S-S, Chen JJW, Yang P-C. Autocrine and paracrine regulation of interleukin-8 expression in lung cancer cells. Am J Respir Cell Mol Biol 2005;32:540–547.[Abstract/Free Full Text]
  39. Cramer T, Yamanishi Y, Clausen BE, Forster I, Pawlinski R, Mackman N, Haase VH, Jaenisch R, Corr M, Nizet V, et al. HIF-1[alpha] is essential for myeloid cell-mediated inflammation. Cell 2003;112:645–657.[CrossRef][Medline]
  40. Chen K-Y, Chang C-H, Yu C-J, Kuo S-H, Yang P-C. Distribution according to histologic type and outcome by gender and age group in Taiwanese patients with lung carcinoma. Cancer 2005;103:2566–2574.[CrossRef][Medline]



This article has been cited by other articles:


Home page
 Am. J. Respir. Crit. Care Med.Home page
S. Dubey and C. A. Powell
Update in Lung Cancer 2008
Am. J. Respir. Crit. Care Med., May 15, 2009; 179(10): 860 - 868.
[Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Online Supplement
Right arrow All Versions of this Article:
200704-641OCv1
177/7/763    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Ho, C.-C.
Right arrow Articles by Yang, P.-C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Ho, C.-C.
Right arrow Articles by Yang, P.-C.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Proc. Am. Thorac. Soc. Am. J. Respir. Cell Mol. Biol.
Copyright © 2008 American Thoracic Society