Published ahead of print on October 4, 2007, doi:10.1164/rccm.200706-806OC
© 2008 American Thoracic Society doi: 10.1164/rccm.200706-806OC
Inhibition of Integrin
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| ABSTRACT |
|---|
|
|
|---|
vβ6 is a major TGF-β activator in the lung, inhibition of
vβ6-mediated TGF-β activation is a logical strategy to treat lung fibrosis.
Objectives: To determine, by genetic and pharmacologic approaches, whether murine radiation-induced lung fibrosis is dependent on
vβ6.
Methods: Wild-type mice,
vβ6-deficient (Itgb6–/–) mice, and mice heterozygous for a Tgfb1 mutation that eliminates integrin-mediated activation (Tgfb1+/RGE) were exposed to 14 Gy thoracic radiation. Some mice were treated with an anti-
vβ6 monoclonal antibody or a soluble TGF-β receptor fusion protein.
vβ6 expression was determined by immunohistochemistry. Fibrosis, inflammation, and gene expression patterns were assessed 20–32 weeks postirradiation.
Measurements and Main Results: β6 Integrin expression increased within the alveolar epithelium 18 weeks postirradiation, just before onset of fibrosis. Itgb6–/– mice were completely protected from fibrosis, but not from late radiation-induced mortality. Anti-
vβ6 therapy (1–10 mg/kg/wk) prevented fibrosis, but only higher doses (6–10 mg/kg/wk) caused lung inflammation similar to that in Itgb6–/– mice. Tgfb1-haploinsufficient mice were also protected from fibrosis.
Conclusions:
vβ6-Mediated TGF-β activation is required for radiation-induced lung fibrosis. Together with previous data, our results demonstrate a robust requirement for
vβ6 in distinct fibrosis models. Inhibition of
vβ6-mediated TGF-β activation is a promising new approach for antifibrosis therapy.
Key Words: inflammation lymphocyte monoclonal antibody
Scientific Knowledge on the Subject Transforming growth factor (TGF)-β is a profibrotic cytokine, and its latent form is activated by the integrin vβ6 in the lung. A monoclonal antibody has been developed that potently and specifically inhibits vβ6.
What This Study Adds to the Field
|
Of three TGF-β isoforms, TGF-β1 likely has the most important role in fibrosis. TGF-β genes encode a C-terminal TGF-β sequence and an N-terminal prodomain called latency-associated peptide (LAP). TGF-β and LAP are secreted as a complex in which TGF-β is latent (i.e., unable to bind to TGF-β receptors). LAP also interacts with proteins of the latent TGF-β binding protein family, which anchor latent TGF-β to the extracellular matrix (4). Release of TGF-β from LAP (TGF-β activation) is a highly regulated step in TGF-β signaling (5).
Putative TGF-β activators include proteases that degrade LAP (6, 7), thrombospondin-1 (8, 9), reactive oxygen species (10), and the integrins
vβ6 and
vβ8, which interact with the amino acid sequence arginine–glycine–aspartic acid (RGD) located near the C terminus of TGF-β1–LAP and TGF-β3–LAP (11–13). Integrin-mediated TGF-β1 activation is required for TGF-β1's roles in vasculogenesis, immune tolerance, and formation of Langerhans cells (14).
In the lung,
vβ6 is expressed at a low level in normal epithelium and is up-regulated after injury. Mice lacking
vβ6 because of a deletion mutation in the β6 subunit gene (Itgb6–/–) are healthy in most respects, but have lung inflammation similar to that in TGF-β1–null mice and delayed-onset emphysema due to loss of TGF-β–mediated suppression of matrix metalloproteinase-12 expression by alveolar macrophages (AMs) (15, 16). Intratracheal administration of bleomycin causes an acute lung injury and a rapid fibrotic response; both the early capillary leak and the fibrosis in this model are dependent upon TGF-β signaling and expression of
vβ6 (13, 17). These observations raise the possibility that
vβ6 inhibition might prevent lung fibrosis without eliminating all TGF-β signaling, as shown in a kidney model (18).
We examined the role of
vβ6 in the radiation-induced lung fibrosis (RILF) model. In contrast to bleomycin-induced fibrosis, RILF is delayed in onset, occurring 20 weeks or longer after radiation injury, and is not contemporaneous with acute injury or severe inflammation. We chose this model to test whether
vβ6 is involved in mechanistically distinct lung fibrosis models, and in order to test the effect of therapy given during the fibrotic response but not during the initial lung injury. Our results indicate that
vβ6 plays a robust role in distinct forms of lung fibrosis and is a promising target for therapeutics.
| METHODS |
|---|
|
|
|---|
Lung, Blood, and Bronchoalveolar Lavage Fluid Procedures
Lungs from dead or moribund mice were inflated with 800 µl 10% formalin. In anti-
vβ6 monoclonal antibody (mAb) experiments, lungs were lavaged twice with 700 µl phosphate-buffered saline (PBS). The right mainstem bronchus was ligated and the right lungs frozen in liquid N2. The left lung was inflated with 400 µl 10% formalin. Left lungs were cut transversely into 5-µm sections and stained with Masson's trichrome. Aliquots of bronchoalveolar lavage (BAL) fluid were used for cell counts and cytospins, and the remainder frozen in liquid N2. Immunohistochemical detection of β6 protein with the anti-β6 chimeric mAb, 2A1, was as previously described (18). The percent fibrosis area (%FA) was calculated as previously described (19) using ImageJ software (National Institutes of Health). For Tgfb1+/+ and Tgfb1+/RGE mice, %FA was measured using both left and right lung from each mouse. The measurement of hydroxyproline content was as previously described (20).
Antibody Treatments
The inhibitory anti-
vβ6 mAb, 6.3G9, isotype control antibody, 1E6, and recombinant soluble TGF-β receptor II-Fc fusion protein (rsTGF-βRII-Fc) have previously been described (18, 21). Antibodies were injected weekly, either intraperitoneally (first experiment) or subcutaneously. Injection volumes were 200 µl.
Right:Left Ventricle Mass Ratio Measurement
Hearts from mice that died between 28 and 32 weeks postirradiation were compared with hearts from mice killed at 32 weeks postirradiation or from 7 unirradiated C57BL/6J mice. The right ventricular free wall (RV) was dissected from the left ventricle and septum (LV), and individual pieces were weighed.
Multiplex Analysis of BAL Fluid Proteins
BAL fluid aliquots were analyzed by Rules-Based Medicine, Inc. (Austin, TX), for a standard panel of 60 mouse proteins (http://www.rulesbasedmedicine.com/) using dyed microspheres permeated with capture antibodies specific for each target analyte (Luminex, Austin, TX).
RNA Isolation
Total RNA was prepared from lungs stored at –80°C using the Qiazol reagent (Qiagen, Valencia, CA) according to the manufacturer's protocol. The RNA quality was verified by capillary electrophoresis on Bioanalyzer 2100 (Agilent, Santa Clara, CA).
Design of Primers, Probes, and Oligonucleotide Standard Templates for Taqman
Oligonucleotide primers and Taqman minor groove binder (MGB) probes were designed from Affymetrix (Santa Clara, CA) consensus sequences using Primer Express version 2.0.0 (Applied Biosystems, Inc., Foster City, CA). Taqman MGB probes were designed with a 5' fluorescent reporter dye, 6-carboxy-fluorescein (FAM), and a 3' MGB/nonfluorescent quencher (MGBNF). Oligonucleotide standard templates were designed by the addition of 10 bp of gene-specific sequence to the 5' and 3' ends of the amplicon. Reverse-phase HPLC–urified primers and oligonucleotide standard templates were purchased from Biosearch Technologies Inc. (Novato, CA). HPLC-purified primers and probe for murine glyceraldehyde-3-phosphate dehydrogenase were synthesized at Biogen Idec (sequences CATGGCCTTCCGTGTTCCTA, GCGGCACGTCAGATCC, and 6FAM-CCCCAATGTGTCCGTC).
Taqman Thermal Cycling
Quadruplicate polymerase chain reactions for samples and standards were cycled in a 7900HT (Applied Biosystems, Inc.) thermal cycler under the following conditions: 50°C for 2 minutes, 95°C for 10 minutes, and 40 cycles of 95°C for 15 seconds and 60°C for 60 seconds. The fluorescence emission was collected every 7 seconds for each reaction well. Relative transcript quantities were determined for each sample by comparison to oligonucleotide standard curve using Sequence Detection Software (Applied Biosystems, Inc.)
Microarray Procedures
The quality of RNA samples (minimum 5 per experimental group) was verified by capillary electrophoresis on a Bioanalyzer 2000 (Agilent). Hybridization probes were prepared from individual RNA samples and profiled on separate Mouse Genome 430 2.0 oligonucleotide arrays (Affymetrix). Hybridization probe synthesis, hybridization, and microarray scanning were performed using the manufacturer's protocols. The array scans were converted into Affymetrix .CEL files and the resulting data set (group of .CEL files representing the complete experiment) was normalized using the GC content–adjusted robust microarray average method. Statistical and clustering analyses were done using the GeneSpring (Agilent) software. We used two-step t test filtering to identify probesets whose signal intensity was altered, first, when comparing irradiated, PBS-treated mice to the aged, unirradiated control group (P < 0.001) and, second, when comparing irradiated, PBS-treated mice and irradiated mice treated with 1 mg/kg 6.3G9 (P < 0.05; n = 3 for the PBS-treated radiation group, and n = 5–8 for the other groups tested). Functional annotation of selected gene lists was done using the Ingenuity Pathways Analysis database (Ingenuity, Redwood City, CA).
Statistical Analysis
Significance of the differences between mean %FA of different treatment groups was assessed by the Mann-Whitney U test. Differences between mean hydroxyproline concentrations or mean RV:LV ratios were evaluated with Student's t test. Mean values of measurements are displayed with error bars indicating SEM. Statistical comparisons of protein levels in the BAL fluid were made between vehicle control and/or isotype control, and various doses of test article using one-way analysis of variance. When statistically significant differences were established, significant differences between groups were evaluated by Dunnet's multiple comparison test (significance defined as P < 0.05).
| RESULTS |
|---|
|
|
|---|
vβ6 by Alveolar Epithelium Is a Late Event after Radiation Injury
vβ6 integrin is normally expressed at a low level in lung epithelium, but can be up-regulated by injury and inflammation. At 2-week intervals postirradiation, we assessed β6 integrin expression by immunohistochemical staining with an mAb that recognizes the β6 subunit. β6 expression did not change from baseline low levels until a sharp increase 18–20 weeks postirradiation throughout the alveolar epithelium (Figure 1A and data not shown). Areas of fibrosis first became apparent 20–22 weeks postirradiation (data not shown). At 24 weeks postirradiation, β6 expression was prominent throughout alveolar epithelium in nonfibrotic areas and in epithelial cells within regions of fibrosis, which were located subpleurally; by 27 weeks postirradiation and later, intensely positive β6 expression persisted in epithelial cells within fibrotic areas, but often became less prominent in nonfibrotic areas (Figure 1B and data not shown).
|
vβ6 Do Not Develop RILF
vβ6 expression and RILF lesions supports the idea that
vβ6-mediated TGF-β activation is involved in the fibrotic process. To determine whether
vβ6 is necessary for development of RILF, we compared the fibrotic responses of irradiated Itgb6+/+ and Itgb6–/– mice. In Itgb6+/+ lungs (Figure 2A), fibrotic areas were well demarcated and subpleural. We observed fibrotic areas in sections from 21 of 23 Itgb6+/+ mice killed 24–28 weeks postirradiation (mean, 26.0 wk postirradiation), but found no fibrotic areas in any of 17 lung sections from Itgb6–/– mice 26–28 weeks postirradiation (mean, 27.1 wk postirradiation), a difference that is statistically significant (P = 0.001, Fisher's exact test). The %FA of sections from Itgb6+/+ mice (27 wk after irradiation) was 17 ± 3%. Analysis of additional sections from Itgb6–/– mice did not reveal fibrotic areas, confirming the report by Haston and colleagues that analysis of a single lung section per mouse is adequate for assessment of fibrosis (19). We confirmed the histologic findings by measuring the hydroxyproline content of lungs from Itgb6+/+ and Itgb6–/– mice 27 weeks postirradiation (Figure 2B).
|
An Inhibitory Anti-
vβ6 mAb and a TGF-β Antagonist Prevent RILF
The effect of blocking TGF-β signaling during the late radiation-induced fibrosis phase has not been defined. To address this issue, we initiated treatment 16 weeks postirradiation, just prior to the up-regulation of
vβ6, with the anti-
vβ6 mAb 6.3G9, a specific and potent inhibitor of
vβ6 able to prevent
vβ6-mediated TGF-β activation (21). In addition, we treated mice with rsTGF-βRII-Fc, which inhibits active TGF-β (18). Fibrosis was assessed in mice that died more than 20 weeks postirradiation and in mice killed at the study endpoint, 26 weeks after irradiation.
Mice treated with PBS, control IgG, or 0.3 mg/kg/week 6.3G9 developed fibrosis of similar extent (Figure 3A). In contrast, mice treated with 5 mg/kg/week rsTGF-βRII-Fc or 1 or 10 mg/kg/week 6.3G9 had significant reductions of histologically defined areas of fibrosis, measured as %FA. Treatment also reduced the fraction of mice with any degree of fibrosis on histologic analysis, from 17/24 and 10/14 for control IgG and PBS groups, respectively, to 14/24, 3/23, 3/21, and 10/27 for the 0.3, 1.0, and 10.0 mg/kg/week 6.3G9 and rsTGF-βRII-Fc groups, respectively (P = 0.55, P < 0.0001, P = 0.0002, and P = 0.025, respectively, compared with IgG control [Fisher's exact test]).
|
We compared Kaplan-Meier survival curves for all groups of mice, and found that 50% survival was reached at 23–25 weeks (Figure 3C), compared with 26 weeks in the initial experiment (Figure 2C). There was no significant difference among all the groups (P = 0.088 by log-rank test of all groups), but a trend toward decreased survival in the 10 mg/kg/week 6.3G9 group was apparent.
These results confirm that murine RILF is TGF-β–dependent, and that inhibition of TGF-β or
vβ6 just before and during the fibrosis phase prevents RILF. The results also suggest a potentially important difference in the effects of different 6.3G9 doses. Although both the 1 and 10 mg/kg/week doses of 6.3G9 prevent RILF, only the higher dose is associated with an increase in BAL lymphocytes and neutrophils. A similar increase in lung lymphocytes (three- to fourfold), but not neutrophils, occurs in untreated Itgb6–/– mice (16).
Dose–Response Assessment of 6.3G9 in RILF
We performed a second
vβ6 inhibition experiment to examine the effect of additional doses of 6.3G9 and to reexamine the effect of 6.3G9 on survival. We examined mice at longer times since irradiation (28–32 wk) to determine whether 6.3G9 treatment delays rather than prevents RILF. Injections were again started 16 weeks after irradiation, and 41–44 mice per group were irradiated.
We measured %FA in all mice that died after 20 weeks or were killed at endpoints of 28 or 32 weeks. Representative lesions in control mice are shown in Figure 4A. Compared with mice treated with control IgG, the groups treated with any dose of 6.3G9 had significant reductions in %FA (Figure 4B). The %FA in mice treated with the lowest dose of 6.3G9 (1 mg/kg/wk) was 18% of control, and, in mice treated with higher doses (3–10 mg/kg/wk), was only 3–5% of control. As before, differences were also statistically significant when the numbers of samples with or without fibrosis were compared. Among control IgG-treated mice, 35/42 had histologic fibrosis; for mice treated with 1, 3, 6, or 10 mg/kg/week 6.3G9, only 25/42, 10/42, 8/42, and 9/41 mice, respectively, had histologically apparent fibrosis (P = 0.029 for 1 mg/kg/wk 6.3G9 and P < 0.0001 for the other groups, compared with the control IgG group [Fisher's exact test]).
|
Survival curves for the various treatment groups are shown in Figure 4D: 50% survival was reached at 27–31 weeks postirradiation, except by the 6 mg/kg/week 6.3G9 group, for which 50% survival occurred at 24 weeks. The differences in survival curves were statistically significant (P < 0.005, log-rank test for all groups).
Prior studies demonstrated that RV hypertrophy (RVH) and loss of lung perfusion are late sequelae of lung irradiation (22, 23), which might explain respiratory insufficiency and death. To assess the association of RVH and lethality in our experiments, we measured the RV:LV mass ratio in three groups of mice: irradiated mice that died between 28 and 32 weeks postirradiation; mice that survived to be killed at 32 weeks; and control nonirradiated mice. The RV:LV ratio was significantly increased in mice that died, regardless of treatment status, compared with mice in the other two groups (Figure 4E).
The dose titration experiments suggested that more
vβ6-activated TGF-β is needed to cause fibrosis than to control lung inflammation. To test this hypothesis in a different way, we used mice with a knockin mutation of Tgfb1 that eliminates TGF-β1–LAP's integrin-binding site (14). Mice homozygous for this mutation (Tgfb1RGE/RGE) produce normal levels of latent TGF-β1 protein, but have a phenotype identical to that of Tgfb–/– mice. Heterozygous mice have less integrin-activatable latent TGF-β1, but have no inflammatory phenotype. We irradiated Tgfb1+/+ and Tgfb1+/RGE littermates and assessed fibrosis 26 weeks after irradiation (Figure 4F). The %FA in Tgfb1-haploinsufficient mice was significantly less than in wild types (P < 0.001).
Multiplex Analysis of BAL Fluid Protein Concentrations
To further characterize the effects of anti-
vβ6 treatment in the RILF model, we measured the levels of 60 selected proteins in BAL fluid by multianalyte protein profiling. Mice from the second
vβ6 inhibition experiment, killed at 28 or 32 weeks postirradiation, were used for these measurements. The most striking finding was that many proteins in the panel, primarily inflammatory mediators, were present at significantly elevated levels in BAL fluid from irradiated mice treated with 6 and/or 10 mg/kg/week 6.3G9, compared with levels in BAL fluid from irradiated mice treated with lower doses of 6.3G9 or with control antibody. Data for four representative proteins are shown in Figures 5B and 5C. A qualitatively similar dose–response pattern was observed in nonirradiated mice treated with 6.3G9 or control mAb for 4 weeks (Figure 5A). Other proteins that were significantly elevated compared with control in the 6 and 10 mg/kg/week 6.3G9 groups, but not elevated in the 1 and 3 mg/kg/week 6.3G9 groups, were matrix metalloproteinase-9, oncostatin M, vascular endothelial growth factor, and tumor necrosis factor-
, and the chemokines granulocyte chemotactic protein (GCP)-2, IFN-inducible protein-10, and macrophage inflammatory protein-1β. Soluble CD40 and macrophage inflammatory protein-2 levels were significantly increased compared with control in mice treated with 10 mg/kg/week 6.3G9, but not in those treated with 1, 3, or 6 mg/kg/week 6.3G9. The dose–response behavior of these proteins, many of which are inflammatory mediators, closely parallels the changes in inflammatory cell counts (described previously here).
|
vβ6-dependent disease mechanism was identified as a group of 595 GeneChip probesets showing significant changes in normalized signal intensity in response to both irradiation and
vβ6 blockade (see Table E1 in the online supplement). Hierarchical clustering (Figure 6) of the corresponding transcript expression profiles shows considerable similarity of gene expression patterns between the naive control and 1 mg/kg/week 6.3G9 groups relative to the PBS and 1E6 control groups, whereas the rsTGF-βRII-Fc and low-dose (0.3 mg/kg/wk) 6.3G9 dose had less effect on gene expression compared with the control injury (PBS and 1E6) groups. The effect of rsTGFbRII-Fc was similar to 1 mg/kg/week 6.3G9, although not as strong. These results are consistent with the decreased fibrosis observed in the 1 mg/kg/week 6.3G9 and soluble receptor treatment groups. Functional annotation of the gene list suggested a strong association of the radiation- and 6.3G9-affected genes with mechanisms involved in cell cycle regulation, especially with p21-dependent G1/S checkpoint control (data not shown). These results are similar to those obtained from microarray analysis of irradiated cells (24, 25). The cyclin-dependent kinase inhibitor, p21, an inhibitor of cell cycle progression and a mediator of apoptosis, is a target of TGF-β (26), and shows the highest fold up-regulation in lungs of irradiated mice. These results suggest that inhibition of TGF-β by either the soluble receptor or by
vβ6 blockade is effective in partially normalizing the gene expression patterns that characterize the response to radiation injury, even when treatment is initiated long after the initial insult.
|
| DISCUSSION |
|---|
|
|
|---|
Compared with other organs, the lung is relatively sensitive to radiation injury. Acutely, radiation causes DNA damage, with cell injury and death. Later, in a time frame of weeks to a few months after exposure, a pneumonitis phase can occur. In patients, pneumonitis is manifested by fever, cough, and infiltrates on radiographs, and often responds to corticosteroids. In rodent models, TGF-β1 expression is increased during both the acute and pneumonitis phases (28–30). At later time points (typically 5–6 mo in mice and >6 mo in humans), fibrosis can develop. Strategies to mitigate adverse radiation effects might allow treatment of lung malignancies with higher radiation doses, leading to better outcomes.
We found that
vβ6 expression is temporally, spatially, and causally linked to RILF. Up-regulation of
vβ6 in the alveolar epithelium of irradiated lung occurs just before fibrosis and persists in fibrotic lesions. In addition, Itgb6–/– mice do not develop RILF, and a specific inhibitor of
vβ6, administered just before and during the fibrosis phase of the RILF model, prevented fibrosis for up to 12 weeks after the normal time of onset. Soluble TGF-β receptor also prevented RILF. The equivalent antifibrotic efficacy of a global TGF-β inhibitor and an anti-
vβ6 inhibitor provides further evidence that
vβ6-mediated TGF-β activation is a major contributor to fibrosis.
vβ6 is now known to be involved in two distinct models of lung fibrosis (bleomycin- and radiation-induced), as well as in two models of kidney fibrosis (18, 31).
Mice lacking
vβ6 develop lymphocytic lung inflammation (16). We noted increased percentages of both lymphocytes and neutrophils in lungs of irradiated mice treated with higher doses of 6.3G9. We did not observe increased neutrophils in histologic sections of Itgb6–/– lungs after radiation exposure (data not shown). Therefore, in irradiated mice, there is an undefined inflammatory stimulus associated with high-level
vβ6 inhibition leading to accumulation of lung neutrophils that does not occur in
vβ6-null mice. The cytologic findings are mirrored by increases in several inflammation-related cytokines in BAL fluid only at doses of 6–10 mg/kg/week 6.3G9 (Figure 5). Of note, however, a 6.3G9 dose of 1 mg/kg/week prevented fibrosis without altering BAL cell counts (Figures 3 and 4) or selected inflammatory mediators (Figure 5).
There is a high mortality rate in the mouse RILF model during the fibrosis phase. Studies by Sharplin and Franko demonstrated three types of lung damage that might contribute to lethality: loss of functional acini due to obstruction by edema and hyaline membranes, extensive contracted fibrosis, and loss of lung perfusion with associated RVH (22, 23). The relative contribution of these abnormalities depends upon the mouse strain and the time since irradiation. Some strains of mice have severely reduced survival after lung irradiation in the absence of fibrosis, indicating that fibrosis is clearly not the only possible contributor to death in this model (19). However, Sharplin and Franko speculated that the extensive fibrosis in C57BL/6J mice accounts for postirradiation lethality in this mouse strain. This idea is indirectly supported by the fact that several interventions reduce both lethality and fibrosis in C57BL/6 mice exposed to lung irradiation (32–35).
In our study, the effects on fibrosis and lethality are dissociated: the dramatic prevention of fibrosis by Itgb6 deletion or
vβ6 inhibition does not improve survival. Therefore, fibrosis does not appear to be the major cause of death in these studies. Decreased lung perfusion may be involved, because RVH was noted in mice that died during the study, but not in mice that survived, regardless of treatment. Thus, our evidence, interpreted in light of prior work (23), suggests that loss of lung perfusion occurs in C57BL/6 mice even when fibrosis is prevented, and that loss of lung perfusion is responsible at least in part for death in this model.
Radiation injury sets in motion a series of events that include vascular injury, inflammation, oxidant injury, hypoxia, and alterations in multiple signaling pathways (36, 37), which unfold over months. One consequence of these events is increased expression of
vβ6 by alveolar epithelial cells, permitting more TGF-β to be activated. Other consequences (e.g., vascular insufficiency) evidently occur upstream of, or in parallel with,
vβ6 up-regulation and fibrosis. In this view,
vβ6-mediated TGF-β activation is a more proximate cause of RILF than are factors such as oxidants, CD40/CD40L interactions, and platelet-derived growth factor signaling. Our attempts at staining for the endothelial markers, platelet endothelial cell adhesion molecule-1 and von Willebrand factor have not given us additional insight into the vascular abnormalities in these mice (data not shown). As this process is delineated, it will be interesting to determine whether the presumed vascular dysfunction in these mice is required for the
vβ6-mediated fibrotic response.
TGF-β signaling may be a component of the early events leading to increased
vβ6 expression and fibrosis, as well as a required factor in the fibrotic process. TGF-β levels in lung and serum increase in the first days after radiation injury (28, 30, 36). Short-term treatment with TGF-β antagonists at the time of irradiation reduces acute pneumonitis and, surprisingly, late-onset fibrosis at 6 months postirradiation (30, 38). Similarly, in acute lung injury, TGF-β activated by
vβ6 mediates early capillary leak (17), and is also required for subsequent fibrosis. During radiation exposure, TGF-β activation can occur by an alternate route involving direct effects of ionizing radiation on LAP (10).
Survival rates in this model are a sensitive indicator of toxicity because of the tenuous status of the mice and the long duration of treatment (up to 16 wk). We found an inconsistent tendency for high doses of 6.3G9 to worsen survival. Further studies will be needed to define whether high-dose 6.3G9 affects survival, and whether any such effect is due to enhanced inflammation or some other process.
However, our data indicate that antifibrotic efficacy is attained at doses of 6.3G9 that do not cause significant changes in BAL inflammatory cells or survival. High doses of 6.3G9 (6–10 mg/kg/wk) cause changes in BAL cell counts and macrophage morphology similar to those observed in Itgb6–/– mice, suggesting that these doses produce near-complete loss of
vβ6 function. Doses of 1–3 mg/kg/week cause minimal changes in inflammatory cell counts, while still preventing fibrosis. Importantly, although the injected doses of anti-
vβ6 mAb producing antifibrotic and proinflammatory effects differ by less than a factor of 10, the difference in circulating plasma levels achieved by these doses is significantly greater. Pharmacokinetic analyses (unpublished data) show that 6.3G9 has a significantly shorter half-life at 1 mg/kg than it does at 10 mg/kg, and the difference in exposure (measured as area under the concentration–time curve) at these two doses is approximately 80-fold. These results suggest that near-maximal antifibrotic activity is achieved at concentrations of 6.3G9 that are significantly lower than those that produce inflammatory changes in the lung.
TGF-β elicits distinct cellular responses at different concentrations (39). Our results suggest that a small amount of active TGF-β produced by
vβ6-expressing epithelium is sufficient to suppress inflammation, and a larger amount is required to cause fibrosis. These differences might be due to intrinsic differences in the responses of target cells (e.g., lymphocytes and fibroblasts), or to differences in the efficiency of active TGF-β delivery from epithelium to different target cells. In any case, the idea is supported by the observation that Tgfb1-haploinsufficient mice are relatively protected from RILF (Figure 4E) without any evident increase in inflammation (data not shown).
Expression of
vβ6 increases 18 weeks after radiation treatment; interestingly, plasma TGF-β levels increase sharply 18 weeks after rat lung irradiation (29).
vβ6 up-regulation also immediately precedes bleomycin-induced fibrosis (13). These correlations do not prove that high levels of
vβ6 are required for fibrosis, but adenovirus-mediated over-expression of latent TGF-β1 in normal lung does not cause fibrosis (40), suggesting that the normal lung's capacity for TGF-β activation is rate limiting for fibrosis. Increased
vβ6 expression is likely not the only way to increase
vβ6-dependent TGF-β activation; protease activated receptor-1 signals, for example, enhance
vβ6 function (41), and latent TGF-β binding protein-1 enhances activation of TGF-β by
vβ6-expressing cells (42). TGF-β increases β6 expression in cultured cells (43), but we did not find evidence for TGF-β–induced
vβ6 up-regulation in our study, because mice treated with 6.3G9 or rsTGF-βRII-Ig still had strongly up-regulated
vβ6 expression (data not shown).
Inhibition of TGF-β signaling is potentially beneficial in fibrotic and other diseases, and has been well tolerated in mice (44). Early clinical trials of TGF-β antagonists are underway. However, data from genetic mouse models indicate that reduced TGF-β activation or signaling may cause enhanced inflammation, pulmonary emphysema, and increased malignancy. Our data suggest that optimal anti–TGF-β strategies may require carefully titrated, partial inhibition of TGF-β activity to maximize benefit and minimize potential toxicity. Addressing this issue in human studies will require comparison of different dosing regimens and quantitative markers of therapeutic and adverse effects.
In summary, our data and other results indicate that the
vβ6–TGF-β axis plays a key role in various forms of lung and kidney fibrosis (13, 18). Direct inhibition of
vβ6 and, perhaps, prevention of its up-regulation are potentially useful strategies to treat or prevent RILF and other forms of fibrosis.
| Acknowledgments |
|---|
| FOOTNOTES |
|---|
* These investigators contributed equally to this article. ![]()
This article has an online supplement, which is accessible from this issue's table of contents at www.atsjournals.org
Originally Published in Press as DOI: 10.1164/rccm.200706-806OC on October 4, 2007
Conflict of Interest Statement: K.P. does not have a financial relationship with a commercial entity that has an interest in the subject of this manuscript. N.H. does not have a financial relationship with a commercial entity that has an interest in the subject of this manuscript. S.C.J. does not have a financial relationship with a commercial entity that has an interest in the subject of this manuscript. E.B. does not have a financial relationship with a commercial entity that has an interest in the subject of this manuscript. Z.Z. does not have a financial relationship with a commercial entity that has an interest in the subject of this manuscript. Z.Y. does not have a financial relationship with a commercial entity that has an interest in the subject of this manuscript. M.L.D. does not have a financial relationship with a commercial entity that has an interest in the subject of this manuscript. G.S.H. is an employee of Biogen Idec and receives annual compensation of salary and stock. P.H.W. is an employee and shareholder of Biogen Idec. M.E.L. is an employee of Biogen Idec and receives annual compensation of salary and stock. S.M.V. is an employee of Biogen Idec and receives annual compensation of salary and stock. K.S.G. does not have a financial relationship with a commercial entity that has an interest in the subject of this manuscript. C.C. does not have a financial relationship with a commercial entity that has an interest in the subject of this manuscript. S.C.F. does not have a financial relationship with a commercial entity that has an interest in the subject of this manuscript. J.S.M. received a research grant from 2004 to 2007 from Biogen Idec.
Received in original form June 1, 2007; accepted in final form October 4, 2007
| REFERENCES |
|---|
|
|
|---|
vβ8 mediates epithelial homeostasis through MT1-MMP–dependent activation of TGF-β1. J Cell Biol 2002;157:493–507.
vβ6 binds and activates latent TGFβ3. FEBS Lett 2002;511:65–68.[CrossRef][Medline]
vβ6 binds and activates latent TGF-β1: a mechanism for regulating pulmonary inflammation and fibrosis. Cell 1999;96:319–328.[CrossRef][Medline]
vβ6–mediated TGF-β activation causes MMP12-dependent emphysema. Nature 2003;422:169–173.[CrossRef][Medline]
vβ6 Integrin regulates renal fibrosis and inflammation in alport mouse. Am J Pathol 2007;170:110–125.
vβ6 monoclonal antibodies: distinct ligand-mimetic and nonligand-mimetic classes. J Biol Chem 2004;279:17875–17887.
vβ6 integrin-dependent TGF-β activation and promotes acute lung injury. J Clin Invest 2006;116:1606–1614.[CrossRef][Medline]
vβ6–mediated activation of latent TGF-β requires the latent TGF-β binding protein-1. J Cell Biol 2004;165:723–734.Related articles in AJRCCM:
vβ6 Prevents Pulmonary Fibrosis without Exacerbating Inflammation
This article has been cited by other articles:
![]() |
A. Eslami, C. L. Gallant-Behm, D. A. Hart, C. Wiebe, D. Honardoust, H. Gardner, L. Hakkinen, and H. S. Larjava Expression of Integrin {alpha}v{beta}6 and TGF-{beta} in Scarless vs Scar-forming Wound Healing J. Histochem. Cytochem., June 1, 2009; 57(6): 543 - 557. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Behr and V. J. Thannickal Update in Diffuse Parenchymal Lung Disease 2008 Am. J. Respir. Crit. Care Med., March 15, 2009; 179(6): 439 - 444. [Full Text] [PDF] |
||||
![]() |
P. Aluwihare, Z. Mu, Z. Zhao, D. Yu, P. H. Weinreb, G. S. Horan, S. M. Violette, and J. S. Munger Mice that lack activity of {alpha}v{beta}6- and {alpha}v{beta}8-integrins reproduce the abnormalities of Tgfb1- and Tgfb3-null mice J. Cell Sci., January 15, 2009; 122(2): 227 - 232. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Sheppard The role of integrins in pulmonary fibrosis Eur. Respir. Rev., December 1, 2008; 17(109): 157 - 162. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Aluwihare and J. S. Munger What the Lung Has Taught Us about Latent TGF-{beta} Activation Am. J. Respir. Cell Mol. Biol., November 1, 2008; 39(5): 499 - 502. [Full Text] [PDF] |
||||
![]() |
Y. Song, J. F. Pittet, X. Huang, H. He, S. V. Lynch, S. M. Violette, P. H. Weinreb, G. S. Horan, A. Carmago, Y. Sawa, et al. Role of Integrin {alpha}v{beta}6 in Acute Lung Injury Induced by Pseudomonas aeruginosa Infect. Immun., June 1, 2008; 76(6): 2325 - 2332. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. S. Horan, S. Wood, V. Ona, D. J. Li, M. E. Lukashev, P. H. Weinreb, K. J. Simon, K. Hahm, N. E. Allaire, N. J. Rinaldi, et al. Partial Inhibition of Integrin {alpha}v 6 Prevents Pulmonary Fibrosis without Exacerbating Inflammation Am. J. Respir. Crit. Care Med., January 1, 2008; 177(1): 56 - 65. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Proc. Am. Thorac. Soc. | Am. J. Respir. Cell Mol. Biol. |