help button home button
AJRCCM
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

Published ahead of print on December 10, 2004, doi:10.1164/rccm.200404-530OC
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Online Supplement
Right arrow All Versions of this Article:
200404-530OCv1
171/7/773    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by LeVan, T. D.
Right arrow Articles by Merchant, J. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by LeVan, T. D.
Right arrow Articles by Merchant, J. A.
American Journal of Respiratory and Critical Care Medicine Vol 171. pp. 773-779, (2005)
© 2005 American Thoracic Society
doi: 10.1164/rccm.200404-530OC


Original Article

Polymorphisms in the CD14 Gene Associated with Pulmonary Function in Farmers

Tricia D. LeVan, Susanna Von Essen, Debra J. Romberger, G. Patrick Lambert, Fernando D. Martinez, Monica M. Vasquez and James A. Merchant

Arizona Respiratory Center and Departments of Internal Medicine and Pediatrics, College of Medicine, University of Arizona, Tucson, Arizona; Department of Exercise Science and Athletic Training, Creighton University; Department of Internal Medicine, Pulmonary and Critical Care Medicine Section, University of Nebraska Medical Center, Omaha, Nebraska; and Department of Occupational and Environmental Health, College of Public Health, University of Iowa, Iowa City, Iowa

Correspondence and requests for reprints should be addressed to Susanna Von Essen, M.D., M.P.H., Department of Internal Medicine, Pulmonary and Critical Care Medicine Section, University of Nebraska, Omaha, NE 68198-5300. E-mail: svonesse{at}unmc.edu


    ABSTRACT
 TOP
 ABSTRACT
 METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Rationale and Objectives: Farmers experience airway obstruction, which may be attributable in part to endotoxin inhalation. CD14 is a receptor for endotoxin. Materials and Methods: Based on our findings of increased circulating CD14 associated with the CD14/–159 T allele, we hypothesized that carriers of this allele would have decreased lung function among endotoxin-exposed individuals. CD14/–159TT farmers (n = 19) had significantly lower lung function as measured by FEV1 (p = 0.028) and mean forced expiratory flow during the middle half of the FVC (FEF25–75) (p = 0.05) compared with farmers with the C allele (n = 78). Also, farmers with the CD14/–1619GG genotype (n =11) were associated with lower lung function (FEV1, p = 0.008; FEF25–75, p = 0.009) compared with farmers with the A allele (n = 86). Results: No association between CD14/–550 and lung function was observed (FEV1, p = 0.32; FEF25–75, p = 0.11). Increased prevalence of wheezing was reported in farmers homozygous for CD14/–159T (p = 0.013) or CD14/–1619G (p = 0.019) compared with farmers with the CC or AA genotype, respectively. No association was found between TLR4/Asp299Gly and lung function or wheeze. Conclusion: We conclude that the CD14/–159 or CD14/–1619 loci may play a role in modulating lung function and wheeze among agricultural workers.

Key Words: endotoxin • farming • lipopolysaccharide • occupational exposure • wheeze

Environmental exposure to endotoxin—a cell wall component of gram-negative bacteria (1)—represents a major occupational hazard for the development of lung inflammation and the impairment of pulmonary function in production agriculture (25). Several studies have shown that farmers exposed to large amounts of endotoxin by organic dust as they handle grain and engage in swine and poultry production commonly display signs and symptoms of respiratory disease including asthma, rhinitis, chronic bronchitis, and organic dust toxic syndrome (6, 7). Furthermore, an asthma-like syndrome, characterized by cough, wheezing, and airway obstruction, has been described in one-fourth of swine production workers (8). Airway inflammation characterized by the presence of increased number of neutrophils and increased concentration of cytokines has been found in farmers during seasonal grain harvest and in full-time swine farmers (9, 10). Although these are complex clinical phenotypes, it is apparent that lung inflammation and decreased lung function are common among farmers, and that these findings are linked to the presence of endotoxin in inhaled dust.

Genetic factors are critical determinants of lung inflammation and pulmonary function. At high endotoxin exposure levels, only a portion of farmers experience respiratory symptoms or disease (11). It is hypothesized that genetic differences that affect responsiveness to endotoxin underlie the variability in airway responsiveness. CD14 is a high-affinity receptor for endotoxin (12, 13). CD14 acts by transferring endotoxin (14) and other bacterial ligands from circulating LPS-binding protein to the toll-like receptor 4 (TLR4)/MD-2 signaling complex. Engagement of this complex results in the activation of innate host defense mechanisms such as release of proinflammatory cytokines. Soluble CD14 (sCD14) is found in normal plasma at microgram concentrations (15) and has been shown to be elevated in the lung as a result of inflammation (16), infection (17, 18), or allergen provocation (19). The gene encoding CD14 is localized on chromosome 5q31.1 (20), a region that has been linked to asthma (21, 22) and pulmonary function (23). We and others have reported elevated serum sCD14 levels in homozygous carriers of the T allele at –159 compared with CC individuals (nomenclature relative to the CD14 transcription start site) (2427). Functional studies have revealed a biologic mechanism for increased expression of sCD14 among CD14/–159TT individuals (28). We found decreased affinity of DNA/protein interactions at the polymorphic Sp binding site with the T allele. The decreased affinity of the inhibitory Sp3 transcription factor resulted in increased transcriptional activity of the CD14 promoter.

Based on these findings of increased circulating CD14 associated with the CD14/–159 T allele, we hypothesized that carriers of this allele would have decreased lung function among endotoxin exposed individuals. We tested this hypothesis using a farming population typically exposed to abnormally high concentrations of endotoxin and with evidence of respiratory disease (4).

Some of these studies have been previously reported in the form of an abstract (29).


    METHODS
 TOP
 ABSTRACT
 METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Study Population
Nonsmoking, adult males (ages 21–80) who were currently farming or had farmed in the past were recruited from the Keokuk County Rural Health Cohort Study (see online supplement) (30). Eligible subjects (n = 155) were contacted with the option of participation. Health history and exposure questionnaires were administered by a nurse, followed by spirometry, skin prick test (SPT), and phlebotomy. The University of Iowa, University of Nebraska Medical Center, and the University of Arizona Institutional Review Boards approved the study.

Clinical Tests
All participants were skin prick–tested and considered positive with a wheal diameter greater than 3 mm to one or more allergens (tree pollen mix, grass pollen mix, cockroach mix, mold mix, dust mite mix, grain dust mix, soybean dust, insect mix, cat pelt, hog hair, cattle hair, turkey feathers, dog hair, horse hair, chicken feathers and mouse, rat mix). Spirometry was used to assess pulmonary function. Results were adjusted for the mean age, height, and weight of the population (31). Airway obstruction was defined as FEV1/FVC ratio of less than 70% (n = 22). Subjects with more than 70% FEV1/FVC ratio were considered to have no airway obstruction (n = 75).

Genetic Analysis
Polymerase chain reaction was performed with DNA isolated from blood, 200 µM dNTP, MgCl2, buffer, 0.4 U Taq polymerase, and 0.1 µM each of the forward and reverse primers (Table 1). Polymerase chain reaction–amplified DNA was digested at 37°C for 16 hours. Allele-specific polymerase chain reaction was used for CD14/-1619 (Table 1). An internal control was used to amplify the granulocyte macrophage-colony stimulating factor (GM-CSF) gene. The forward primer was 5' CTGGAGTCAGAATGAGGCAC and the reverse primer was 5' CTCAGCTGATAAAGGAGCTC. For the TLR4/Asp299Gly polymorphism, the procedure was as described by Michel and colleagues (32).


View this table:
[in this window]
[in a new window]
 
TABLE 1. Polymerase chain reaction–based restriction fragment assays for CD14 polymorphisms

 
Statistical Analyses
{chi}2, Fisher's exact test, and analysis of variance (ANOVA) were used to assess statistical significance using SPSS Windows 10.1 software (SPSS, Inc., Chicago, IL). In the ANOVA post hoc analysis, the p value for pairwise comparisons is reported using Bonferroni's correction.

Multiple regression was done using a univariate model. Exploratory analysis tested the significance of each independent variable (SPT, asthma, years of farming [tertiles], currently farming, and farm exposures [i.e., corn, oats, soy, hay, poultry, hog, dairy]) on the dependent variables FEV1 or mean forced expiratory flow during the middle half of the FVC (FEF25–75). Significant independent variables were then added to the model in a step-up approach. Interaction terms were then tested in the model (haplotypes x years of farming (tertiles), x harvested hay, and x raised hogs). The interaction terms, haplotype x SPT, x asthma; x currently farming; x harvested corn, soybeans, or oats; x raised dairy; or poultry were not considered in the model because there were less than five subjects per cell in a cross-tab analysis.

Linkage disequilibrium (r2) was calculated using Linkage Disequilibrium Analyzer software 1.0. Haplotypes were inferred using Phase software (33) with a 95% probability threshold. In the haplotype analysis, pulmonary function results from each subject were associated with each of the two haplotypes carried by the same subject; consequently, the analyses were performed by chromosomes rather than by subject (34).


    RESULTS
 TOP
 ABSTRACT
 METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Ninety-seven nonsmoking, male, white farmers with a mean age of 59 years (range 25–89) were studied. The participation rate was 62.5% of all eligible subjects. Subjects with airway obstruction were significantly older (p < 0.0001) and reported a higher prevalence of wheeze (p = 0.077) and cough/phlegm (p < 0.0001) than nonobstructed subjects (Table 2). A similar proportion of obstructed and nonobstructed subjects harvested corn, soybeans, hay, and oats (data not shown), or raised hogs, dairy, or poultry. The lack of association between airway obstruction and asthma, corn, poultry, and dairy may be the result of too few subjects and the lack of statistical power.


View this table:
[in this window]
[in a new window]
 
TABLE 2. Study population demographics—comparison between obstructed and nonobstructed farmers

 
TLR4/Asp299Gly Gene Polymorphism and Susceptibility to Airway Obstruction
The allele frequencies for the TLR4/Asp299Gly polymorphism were A = 94.4% and G = 5.6% and were found to be in Hardy-Weinberg equilibrium. No association was found between the TLR4/Asp299Gly polymorphism and either lung function or wheezing (data not shown). The TLR4/Thr399Ile variant was not analyzed in this study because of the report by Arbour and colleagues indicating complete linkage disequilibrium between these two loci (35).

CD14 Proximal Promoter Single Nucleotide Polymorphisms
Ninety-seven adult farmers were genotyped for three CD14 promoter polymorphisms at locations –1619, –550, and –159 relative to the transcription start site (Figure 1A). The allele frequencies were CD14/–1619 (A = 64%, G = 36%), CD14/–550 (C = 76%, T = 24%) and CD14/–159 (C = 55%, T = 45%) and were found to be in Hardy-Weinberg equilibrium. The strength of pairwise linkage disequilibrium between the three single nucleotide polymorphisms (SNPs) is as follows: –1619 and –550, r2 = 0.18; –1619 and –159, r2 = 0.68; –550 and –159, r2 = 0.27.



View larger version (12K):
[in this window]
[in a new window]
 
Figure 1. Gene structure and location of CD14 promoter polymorphisms (> 10% frequency). ATG represents translational start codon. Boxed polymorphisms are those selected for genotyping. Polymorphism nomenclature is relative to transcription start site (GenBank Accession No. U00699).

 
CD14 Gene Polymorphisms and Susceptibility to Airway Obstruction and Wheeze
When using lung function as a dichotomous variable (< 70% or >= 70% FEV1/FVC ratio), the CD14/–1619, CD14/–550, and CD14/–159 loci showed no significant association with airway obstruction (Table 3), although the odds of having airway obstruction was 2–3 times greater in carriers of the G allele for CD14/–1619 and of the T allele for CD14/–159. There was a significant association between CD14 polymorphisms and self-reported wheeze (Table 4). Individuals homozygous for –1619G or –159T had a higher prevalence of wheeze than individuals with the A or C allele, respectively (p = 0.019 and p = 0.013). There was no association between the CD14/–550 loci and wheeze.


View this table:
[in this window]
[in a new window]
 
TABLE 3. Frequency of CD14 polymorphisms in obstructed and nonobstructed farmers

 

View this table:
[in this window]
[in a new window]
 
TABLE 4. Frequency of CD14 polymorphisms in ever-wheeze and never-wheeze farmers

 
Pulmonary function data were used as a continuous variable to investigate the association between FEV1, FEF25–75, and CD14 polymorphisms. There was a strong association between CD14/–1619 genotypes and lung function (ANOVA; FEV1, p = 0.008; FEF25–75, p = 0.009, respectively) (Figure 2). As indicated from the pairwise comparisons, FEV1 levels for AG subjects were significantly lower than those for subjects with the AA genotype (p = 0.006). Similarly, FEF25–75 levels associated with the GG genotype were lower than the AA homozygotes (p = 0.017).



View larger version (38K):
[in this window]
[in a new window]
 
Figure 2. Association of FEV1 (L) and FEF25–75 (L/second) with CD14/–1619 and CD14/–159 genotypes. (Left) Lung function values versus CD14/–1619 genotypes. (Middle) Lung function values versus CD14/–550 genotypes. (Right) Lung function values versus CD14/–159 genotypes. Overall p value was determined by analysis of variance. *Pairwise comparisons (n = 3) were done using Bonferroni correction. n = number of subjects for each genotype.

 
A significant association was observed between the CD14/–159 polymorphism and FEV1 (ANOVA; p = 0.028) or FEF25–75 (ANOVA; p = 0.05) (Figure 2). This significant association was due to lower FEV1 (pairwise comparison, p = 0.06) and FEF25–75 (pairwise comparison, p = 0.05) values for the TT subjects compared with individuals with the CC genotype. There was no association between the CD14/–550 loci and lung function (Figure 2).

To incorporate the relative contribution of both CD14/–1619 and CD14/–159 polymorphisms on decreased lung function, haplotypes were constructed using the two SNPs: –1619 and –159. Three haplotypes were identified in the population. Their estimated frequencies were 54.6% for A|C (–1619, –159), 36.1% for G|T, and 9.3% for A|T. There was a significant association between the three haplotypes and FEV1 (ANOVA; p = 0.045) or FEF25–75 (ANOVA; p = 0.014) values (Figure 3). The A|C haplotype showed consistently higher lung function than the G|T haplotype as measured by FEV1 (pairwise comparison, p = 0.04) and FEF25–75 (pairwise comparison, p = 0.014). Some variability in the A|T haplotype was observed depending on the lung function test. When the CD14/–550 locus was included in the haplotype analysis, similar results were obtained (data not shown).



View larger version (15K):
[in this window]
[in a new window]
 
Figure 3. Association of FEV1 and FEF25–75 with CD14 haplotypes. Haplotypes (AC, GT, AT) are defined as CD14/–1619 and CD14/–159. Overall p value was determined by analysis of variance. *Pairwise comparisons (n = 3) were done using Bonferroni correction. n = number of chromosomes.

 
Multiple Regression Analysis
To rule out potential confounding interactions and evaluate other main effects, we reevaluated the effect of haplotypes on FEV1 and FEF25–75 when testing for the following variables in a step-up approach: SPT, asthma, years of farming (tertiles), currently farming, and farm exposures (i.e., corn, oats, soy, hay, poultry, hog, and dairy). Table 5 shows the results of the multiple regression analysis for factors related to FEV1 and FEF25–75. The only independent variables that were significant predictors of lung function, and therefore were included in the final model, were CD14/haplotypes and exposure to corn. For example, the G|T haplotype was associated with lower FEV1 and FEF25–75 levels (1.39 and 1.10 units, respectively) than was the A|C haplotype. Subjects who grew corn as their main crop were more likely to have lower FEV1 and FEF25–75 levels (1.19 and 0.70 units, respectively) than were those who did not grow corn. However, because of the low number of subjects not exposed to corn (n = 7), the importance of exposure to corn as a risk factor for decreased lung function in this population must be considered cautiously. Interestingly, there was a significant interaction between CD14 haplotypes and years of farming (Table 5). The relationship between CD14 haplotypes and lung function described was observed only in subjects who farmed, on average, 37.9 years or less. There was no relationship between CD14 haplotypes and lung function among subjects who farmed, on average, 57.2 years. Note that of the subjects with the G|T haplotype, the number of subjects with many years of farming (mean 57.2 years) tended to be less than those with fewer years of farming (mean 15.4 years).


View this table:
[in this window]
[in a new window]
 
TABLE 5. Association of fev1 and fef25–75 with CD14 haplotypes (1619 | 159): multiple regression models

 
The gene by gene interaction for CD14 and TLR4 polymorphisms was not investigated because of the lack of association between airway obstruction and TLR4 polymorphisms.


    DISCUSSION
 TOP
 ABSTRACT
 METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
This study provides data on the association between three SNPs in the 5' flanking region of the CD14 gene and lung function using genotype and haplotype analysis. In this population sample, we demonstrate that the genotypes CD14/–1619GG and CD14/–159TT are associated with decreased FEV1 and FEF25–75 among nonsmoking, male farmers. In contrast, no association with lung function was found at the CD14/–550 locus. The association between self-reported wheeze and CD14/–1619 and CD14/–159 polymorphisms substantiates these results and suggests that CD14 gene polymorphisms are important determinants of airway obstruction among farmers.

As part of the Program for Genomic Applications of the NHLBI, 37 SNPs in the CD14 gene were identified by sequencing the complete coding region of CD14, intron I, and approximately 6 kb of 5' genomic DNA for 90 individuals (36, 37). Only nine SNPs had a minimal allele frequency greater than 10%, and none of the SNPs resulted in a putative amino acid change. Of the nine frequent SNPs in the CD14 gene, seven were identified in the proximal promoter region (2 kb) (36, 37). Of these seven SNPs, almost complete linkage disequilibrium was reported among CD14/–1855, CD14/–1359, CD14/–809, and CD14/–550, and between CD14/–1145 and CD14/–159 (36). Consequently, allelic association analyses performed with only three SNPs at positions –1619, –550, and –159 represent all SNPs in the proximal promoter region of the CD14 gene.

Farmers who were homozygous for the G allele at the –1619 loci were more likely to have decreased pulmonary function as measured by FEV1 and FEF25–75 and a higher prevalence of wheeze compared with those with the A allele. In addition, we observed a strong association between the CD14/–159 T allele and decreased lung function and increased wheeze compared with farmers with the C allele. Haplotype analysis duplicated the pulmonary function and wheeze results at the individual –1619 and –159 loci, suggesting that either the –1619 or –159 locus is a strong predictor of lung function and wheeze. It is difficult to ascertain which polymorphism is functionally associated with lung function in farmers because these SNPs are highly redundant as a result of the high linkage disequilibrium between these two loci.

Our group has previously described the gene polymorphism at CD14/–159 (26). In a longitudinal cohort, we found that children carrying the CD14/–159TT genotype have higher serum sCD14 levels than carriers of the CC or CT genotypes. Similarly, sCD14 was found to be elevated in carriers of the CD14–159T allele among healthy adults (LeVan and colleagues, unpublished) and in adult patients with inflammatory diseases such as ulcerative colitis (27), Helicobacter pylori infection (25), and stable coronary artery disease (24). Functional studies have revealed a potential biologic mechanism for increased expression of sCD14 among CD14/–159TT individuals (28). We found that CD14/–159 had enhanced (32% increase) transcriptional activity in luciferase reporter assays compared with CD14/–159C. By electromobility shift assays, the sequence of the CD14 promoter encompassing the SNP was found to be a Sp1, 2, and 3 protein binding motif. Furthermore, the binding affinity of Sp1, 2, and 3 proteins were found to be enhanced for an oligo containing the CD14/–159C allele compared with the T allele. Sp1 has been shown to function as a transcriptional activator, whereas Sp3 as a repressor. Therefore, we hypothesized that enhanced binding affinity of Sp3, as well as Sp1 and Sp2, at CD14/–159C could result in transcriptional repression of CD14/–159C relative to CD14/–159T. Functionality of the –1619 SNP has not yet been demonstrated; however, its location in the 5' untranslated region of the CD14 gene corresponds to a hepatocyte nuclear factor-3 consensus site, which is juxtaposed to two Alu sequences (38). Interestingly, this transcription factor is expressed in the liver, which is a major site of sCD14 synthesis (39). Further studies are necessary to understand the role of the –1619 locus and its interaction with the –159 locus on CD14 gene regulation.

The mechanism by which CD14 polymorphisms affect pulmonary function is uncertain; however, we hypothesize that farmers homozygous for the –159 T allele have decreased pulmonary function and increased wheeze because of increased levels of sCD14 and inflammation in the lung. As described previously, we have defined the molecular mechanism by which CD14/–159 T affects sCD14 levels; therefore, there is strong evidence to suggest that CD14/–159TT farmers may have increased levels of serum sCD14. Genetically determined higher levels of sCD14 in the lung may result in increased responsiveness to environmental endotoxin and subsequent increased levels of inflammatory cells and cytokines in the lung. There is increasing evidence showing a strong relationship between bronchoalveolar lavage (BAL) sCD14 levels and lung inflammation. Increased sCD14 levels were shown in BAL fluids from subjects with acute respiratory distress syndrome and were correlated with lung inflammatory markers such as polymorphonuclear neutrophils and total protein (16). In mice, blockade of CD14 in the lungs via anti-CD14 monoclonal antibodies was found to attenuate lung inflammation (40). Virchow and colleagues found increased levels of sCD14 in BAL fluids from asthmatic subjects after segmental allergen provocation (41). Many allergen extracts are contaminated with endotoxin, which may account for some of the effects of segmental allergen challenge. Also, increased levels of sCD14 in BAL fluid were correlated with impaired pulmonary function in subjects with tuberculosis and subjects with sarcoidosis (42). Altogether, these results suggest that CD14/–159 may play a role in modulating sCD14 levels and inflammation in the lung and subsequent pulmonary function and wheeze.

Few studies have explored the possible genetic risk factors for lung disease (4347), specifically endotoxin-induced lung disease. Genetic studies performed on mice have shown that the TLR4 gene, which plays a key role in endotoxin signal transduction, regulates endotoxin responsiveness (48). Mutations of the TLR4 gene were shown to abolish responses to endotoxin, causing these animals to be hypersensitive to infection by gram-negative bacteria. Arbour and colleagues found that the missense mutations Asp299Gly and Thr399Ile were associated with hyporesponsiveness to inhaled endotoxin in normal human subjects (35). A blunted response to endotoxin was defined as a failure to decrease FEV1 by less than 20% after inhalation challenge. In addition, LeVan and colleagues found these missense mutations were also associated with a decreased inflammatory response to inhaled endotoxin as measured by plasma levels of C-reactive protein, LPS-binding protein, and white blood cells (32). Thus it seems likely that the mutations of the TLR4 gene play an important role in regulating endotoxin responsiveness. However, we found no association between the TLR4/Asp299Gly polymorphism, lung function, and wheeze in this population. This result may have been due to the low frequency of the TLR4/Asp299Gly polymorphism (5.6%), thus limiting the power of our analysis. Also, acute exposure to endotoxin may have different effects on pulmonary function compared with intermittent or chronic exposure such as that found in the farming occupation. Last, endotoxin is but one causative agent modulating lung function in farmers. Despite numerous studies indicating endotoxin as the primary agent affecting lung function in farmers, the farming environment is complex and composed of gram-negative and gram-positive bacterial ligands, aeroallergens, and fungi, as well as many undefined inhalants that may very well modulate lung function (4, 49).

For reasons of both statistical significance and biological plausibility, the final model for FEV1 or FEF25–75 in farmers included exposure to corn, CD14 haplotypes, and the interaction between CD14 haplotypes and years of farming. We hypothesize that decreased lung function associated with exposure to corn is potentially a result of the high endotoxin content of dust from stored corn (50). Farmers are potentially exposed to high levels of corn dust while performing various tasks that include cleaning the bin where the corn is stored. Studies by Schwartz and colleagues (51, 52) have demonstrated that inhaled grain dust and endotoxin produce similar physiologic and biological effects in humans, which include airflow obstruction chronic cough and wheeze (5355). Farmers with the CD14 haplotype, G|T, were at higher risk for impaired lung function than farmers with the A|C haplotype; however, this relationship was only observed in farmers with on average of 37.5 years or less of active farm work. There was no relationship between CD14 haplotypes and lung function among farmers with an average of 57.2 years of farming. We propose this interaction between CD14 haplotypes and lung function is due to a healthy worker effect. Specifically, farmers with the G|T haplotype and at risk for airway obstruction may quit farming earlier than those farmers with the low-risk haplotype A|T. This notion is supported by the fact that among subjects with the G|T haplotype, there were fewer subjects that had farmed on average 57.2 years compared with subjects who had farmed 15.4 years. From a public health perspective, farmers with the susceptible genotype may develop chronic airway symptoms on farm exposures and hence be forced to terminate or change employment. Future investigations will evaluate the length of exposure to corn to validate our hypothesis.

Subjects included in this study were all male, nonsmoking farmers. These selection criteria can be viewed as strengths or limitations of the study. With restricted selection, confounding of the association between CD14 polymorphisms and lung function by gender and smoking status was controlled. The study was limited to male farmers because men perform the majority of the labor in production agriculture. Also, previous studies have shown that smoking (56) is associated with airway obstruction. Therefore, we considered that it was important to control for both of these factors in the process of subject selection. However, because of the selection criteria used, the results of our study could not be generalized to farmers who do not match the selection criteria used herein.

Another potential confounding factor that affects genetic association studies is population stratification. Fifty percent of the population was of German descent; however, there was no significant difference in the prevalence of airway obstruction among Germans and non-Germans. This would suggest that association from population heterogeneity is unlikely; however, it cannot be completely excluded.

In summary, we have demonstrated that variations in the CD14 gene may play an important role in the development of airway obstruction among adult, male farmers.


    FOOTNOTES
 
Funded in part by NIH grant ES0036 (T.L.), K30 HL004519 (T.L.), HL66447 (F.M.), HL66806 (F.M.), and NIOSH ES 00296–05.

This article has an online supplement, which is accessible from this issue's table of contents at www.atsjournals.org

Conflict of Interest Statement: T.D.L. does not have a financial relationship with a commercial entity that has an interest in the subject of this manuscript; S.V.E. does not have a financial relationship with a commercial entity that has an interest in the subject of this manuscript; D.J.R. does not have a financial relationship with a commercial entity that has an interest in the subject of this manuscript; G.P.L. does not have a financial relationship with a commercial entity that has an interest in the subject of this manuscript; F.D.M. received $13,000 in 2002 and $3,000 in 2003 and $2,500 from Merck for serving as a member on the Merck Scientific Advisory Board and received money from GlaxoSmithKline for presenting at a sponsored event in 2003 ($1,500) and as a member of the AstraZeneca Speakers Bureau received $10,000 in 2002 and $2,500 in 2003 for lectures; M.M.V. does not have a financial relationship with a commercial entity that has an interest in the subject of this manuscript; J.A.M. does not have a financial relationship with a commercial entity that has an interest in the subject of this manuscript.

Received in original form April 22, 2004; accepted in final form December 7, 2004


    REFERENCES
 TOP
 ABSTRACT
 METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Janeway CA Jr. The immune system evolved to discriminate infectious nonself from noninfectious self. Immunol Today 1992;13:11–16.[CrossRef][Medline]
  2. Zejda JE, Barber E, Dosman JA, Olenchock SA, McDuffie HH, Rhodes C, Hurst T. Respiratory health status in swine producers relates to endotoxin exposure in the presence of low dust levels. J Occup Med 1994;36:49–56.[Medline]
  3. Reynolds SJ, Donham KJ, Whitten P, Merchant JA, Burmeister LF, Popendorf WJ. Longitudinal evaluation of dose–response relationships for environmental exposures and pulmonary function in swine production workers. Am J Ind Med 1996;29:33–40.[CrossRef][Medline]
  4. Omland O. Exposure and respiratory health in farming in temperate zones—a review of the literature. Ann Agric Environ Med 2002;9:119–136.[Medline]
  5. Hoppin JA, Umbach DM, London SJ, Alavanja MC, Sandler DP. Animal production and wheeze in the Agricultural Health Study: interactions with atopy, asthma, and smoking. Occup Environ Med 2003;60:e3.[Abstract/Free Full Text]
  6. Radon K, Monso E, Weber C, Danuser B, Iversen M, Opravil U, Donham K, Hartung J, Pedersen S, Garz S, et al. Prevalence and risk factors for airway diseases in farmers—summary of results of the European Farmers' Project. Ann Agric Environ Med 2002;9:207–213.[Medline]
  7. Monso E, Schenker M, Radon K, Riu E, Magarolas R, McCurdy S, Danuser B, Iversen M, Saiki C, Nowak D. Region-related risk factors for respiratory symptoms in European and Californian farmers. Eur Respir J 2003;21:323–331.[Abstract/Free Full Text]
  8. Von Essen S, Fryzek J, Nowakowski B, Wampler M. Respiratory symptoms and farming practices in farmers associated with an acute febrile illness after organic dust exposure (comment). Chest 1999;116:1452–1458.[Abstract/Free Full Text]
  9. Larsson K, Eklund A, Malmberg P, Belin L. Alterations in bronchoalveolar lavage fluid but not in lung function and bronchial responsiveness in swine confinement workers. Chest 1992;101:767–774.[Abstract/Free Full Text]
  10. Palmberg L, Larssson BM, Malmberg P, Larsson K. Airway responses of healthy farmers and nonfarmers to exposure in a swine confinement building. Scand J Work Environ Health 2002;28:256–263.[Medline]
  11. Rylander R. Endotoxin in the environment—exposure and effects. J Endotoxin Res 2002;8:241–252.[CrossRef]
  12. Wright SD, Ramos RA, Tobias PS, Ulevitch RJ, Mathison JC. CD14, a receptor for complexes of lipopolysaccharide (LPS) and LPS binding protein (comment). Science 1990;249:1431–1433.[Abstract/Free Full Text]
  13. Pugin J, Heumann ID, Tomasz A, Kravchenko VV, Akamatsu Y, Nishijima M, Glauser MP, Tobias PS, Ulevitch RJ. CD14 is a pattern recognition receptor. Immunity 1994;1:509–516.[CrossRef][Medline]
  14. Medzhitov R, Janeway C Jr. Innate immune recognition: mechanisms and pathways. Immunol Rev 2000;173:89–97.[CrossRef][Medline]
  15. Bazil V, Horejsi V, Baudys M, Kristofova H, Strominger JL, Kostka W, Hilgert I. Biochemical characterization of a soluble form of the 53-kDa monocyte surface antigen. Eur J Immunol 1986;16:1583–1589.[Medline]
  16. Martin TR, Rubenfeld GD, Ruzinski JT, Goodman RB, Steinberg KP, Leturcq DJ, Moriarty AM, Raghu G, Baughman RP, Hudson LD. Relationship between soluble CD14, lipopolysaccharide binding protein, and the alveolar inflammatory response in patients with acute respiratory distress syndrome. Am J Respir Crit Care Med 1997;155:937–944.[Abstract]
  17. Striz I, Zheng L, Wang YM, Pokorna H, Bauer PC, Costabel U. Soluble CD14 is increased in bronchoalveolar lavage of active sarcoidosis and correlates with alveolar macrophage membrane-bound CD14. Am J Respir Crit Care Med 1995;151:544–547.[Abstract]
  18. Hoheisel G, Zheng L, Teschler H, Striz I, Costabel U. Increased soluble CD14 levels in BAL fluid in pulmonary tuberculosis. Chest 1995;108:1614–1616.[Abstract/Free Full Text]
  19. Lensmar C, Prieto J, Dahlen B, Eklund A, Grunewald J, Roquet A. Airway inflammation and altered alveolar macrophage phenotype pattern after repeated low-dose allergen exposure of atopic asthmatic subjects. Clin Exp Allergy 1999;29:1632–1640.[CrossRef][Medline]
  20. Goyert SM, Ferrero E, Rettig WJ, Yenamandra AK, Obata F, Le Beau MM. The CD14 monocyte differentiation antigen maps to a region encoding growth factors and receptors. Science 1988;239:497–500.[Abstract/Free Full Text]
  21. Martinez FD, Solomon S, Holberg CJ, Graves PE, Baldini M, Erickson RP. Linkage of circulating eosinophils to markers on chromosome 5q. Am J Respir Crit Care Med 1998;158:1739–1744.[Abstract/Free Full Text]
  22. Postma DS, Bleecker ER, Amelung PJ, Holroyd KJ, Xu J, Panhuysen CI, Meyers DA, Levitt RC. Genetic susceptibility to asthma—bronchial hyperresponsiveness coinherited with a major gene for atopy. N Engl J Med 1995;333:894–900.[Abstract/Free Full Text]
  23. Malhotra A, Peiffer AP, Ryujin DT, Elsner T, Kanner RE, Leppert MF, Hasstedt SJ. Further evidence for the role of genes on the chromosome 2 and chromosome 5 in the inheritance of pulmonary function. Am J Respir Crit Care Med 2003;168:556–561.[Abstract/Free Full Text]
  24. Koenig W, Khuseyinova N, Hoffmann MM, Marz W, Frohlich M, Hoffmeister A, Brenner H, Rothenbacher D. CD14 C(-260)->T polymorphism, plasma levels of the soluble endotoxin receptor CD14, their association with chronic infections and risk of stable coronary artery disease. J Am Coll Cardiol 2002;40:34–42.[Abstract/Free Full Text]
  25. Karhukorpi J, Yan Y, Niemela S, Valtonen J, Koistinen P, Joensuu T, Saikku P, Karttunen R. Effect of CD14 promoter polymorphism and H. pylori infection and its clinical outcomes on circulating CD14. Clin Exp Immunol 2002;128:326–332.[CrossRef][Medline]
  26. Baldini M, Lohman IC, Halonen M, Erickson RP, Holt PG, Martinez FD. A Polymorphism* in the 5' flanking region of the CD14 gene is associated with circulating soluble CD14 levels and with total serum immunoglobulin E. Am J Respir Cell Mol Biol 1999;20:976–983.[Abstract/Free Full Text]
  27. Obana N, Takahashi S, Kinouchi Y, Negoro K, Takagi S, Hiwatashi N, Shimosegawa T. Ulcerative colitis is associated with a promoter polymorphism of lipopolysaccharide receptor gene, CD14. Scand J Gastroenterol 2002;37:699–704.[CrossRef][Medline]
  28. LeVan TD, Bloom JW, Bailey TJ, Karp CL, Halonen M, Martinez FD, Vercelli D. A common single nucleotide polymorphism in the CD14 promoter decreases the affinity of Sp protein binding and enhances transcriptional activity. J Immunol 2001;167:5838–5844.[Abstract/Free Full Text]
  29. Von Essen S, LeVan T, Lambert G, Merchant JA, Romberger D, Martinez F. Association between a promoter polymorphism of the CD14 gene and airway disease in non-atopic farmers. Am J Respir Crit Care Med 2003;167:A580.
  30. Merchant JA, Stromquist AM, Kelly KM, Zwerling C, Reynolds SJ, Burmeister LF. Chronic disease and injury in an agricultural county: the Keokuk County Rural Health Cohort Study. J Rural Health 2002;18:521–535.[Medline]
  31. Knudson RJ, Lebowitz MD, Holberg CJ, Burrows B. Changes in the normal maximal expiratory flow-volume curve with growth and aging. Am Rev Respir Dis 1983;127:725–734.[Medline]
  32. Michel O, LeVan T, Stern D, Dentener M, Thorn J, Gnat D, Beijer L, Cochaux P, Holt P, Martinez F, et al. Systemic responsiveness to lipopolysaccharide and polymorphims in the toll-like receptor 4 gene in human beings. J Allergy Clin Immunol 2003;112:923–929.[CrossRef][Medline]
  33. Stephens M, Smith NJ, Donnelly P. A new statistical method for haplotype reconstruction from population data. (comment). Am J Hum Genet 2001;68:978–989.[CrossRef][Medline]
  34. Clayton D. Population association. In: Balding D, editor. Handbook of statistical genetics. Hoboken, NJ: John Wiley and Sons, Inc.; 2001. p. 519–540.
  35. Arbour NC, Lorenz E, Schutte BC, Zabner J, Kline JN, Jones M, Frees K, Watt JL, Schwartz DA. TLR4 mutations are associated with endotoxin hyporesponsiveness in humans. Nat Genet 2000;25:187–191.[CrossRef][Medline]
  36. Martinez F. Innate immunity PGA, NHLBI program applications. http://innateimmunity.net. Accessed on Sept. 25, 2003.
  37. Lazarus R, Vercelli D, Palmer LJ, Klimecki WJ, Silverman EK, Richter B, Riva A, Ramoni M, Martinez FD, Weiss ST, et al. Single nucleotide polymorphisms in innate immunity genes: abundant variation and potential role in complex human disease. Immunol Rev 2002;190:9–25.[CrossRef][Medline]
  38. Werner T. Computer-assisted analysis of transcription control regions: matinspector and other programs. Methods Mol Biol 2000;132:337–349.[Medline]
  39. Su GL, Dorko K, Strom SC, Nussler AK, Wang SC. CD14 expression and production by human hepatocytes. J Hepatol 1999;31:435–442.[CrossRef][Medline]
  40. Tasaka S, Ishizaka A, Yamada W, Shimizu M, Koh H, Hasegawa N, Adachi Y, Yamaguchi K. Effect of CD14 blockade on endotoxin-induced acute lung injury in mice. Am J Respir Cell Mol Biol 2003;29:252–258.[Abstract/Free Full Text]
  41. Virchow JC Jr, Julius P, Matthys H, Kroegel C, Luttmann W. CD14 expression and soluble CD14 after segmental allergen provocation in atopic asthma. Eur Respir J 1998;11:317–323.[Abstract]
  42. Pforte A, Schiessler A, Gais P, Beer B, Ehlers M, Schutt C, Ziegler-Heitbrock HW. Expression of CD14 correlates with lung function impairment in pulmonary sarcoidosis. Chest 1994;105:349–354.[Abstract/Free Full Text]
  43. Raby BA, Klimecki WT, Laprise C, Renaud Y, Faith J, Lemire M, Greenwood C, Weiland KM, Lange C, Palmer LJ, et al. Polymorphisms in toll-like receptor 4 are not associated with asthma or atopy-related phenotypes. Am J Respir Crit Care Med 2002;166:1449–1456.[Abstract/Free Full Text]
  44. Raby BA, Weiss ST. Beta2-adrenergic receptor genetics. Curr Opin Mol Ther 2001;3:554–566.[Medline]
  45. Raby BA, Weiss ST. ADAM33: where are we now? (comment). Am J Respir Cell Mol Biol 2004;31:1–2.[Free Full Text]
  46. Sandford AJ, Joos L, Pare PD. Genetic risk factors for chronic obstructive pulmonary disease. Curr Opin Pulm Med 2002;8:87–94.[CrossRef][Medline]
  47. He JQ, Connett JE, Anthonisen NR, Pare PD, Sandford AJ. Glutathione S-transferase variants and their interaction with smoking on lung function. Am J Respir Crit Care Med 2004;170:388–394.[Abstract/Free Full Text]
  48. Poltorak A, He X, Smirnova I, Liu MY, Van Huffel C, Du X, Birdwell D, Alejos E, Silva M, Galanos C, et al. Defective LPS signaling in C3H/HeJ and C57BL/10ScCr mice: mutations in Tlr4 gene. Science 1998;282:2085–2088.[Abstract/Free Full Text]
  49. Hoppin JA, Umbach DM, London SJ, Alavanja MC, Sandler DP. Chemical predictors of wheeze among farmer pesticide applicators in the Agricultural Health Study (see comment). Am J Respir Crit Care Med 2002;165:683–689.[Abstract/Free Full Text]
  50. Todd B, Buchan R. Total dust, respirable dust, and microflora toxin concentration in Colorado corn storage facilities. Appl Occup Environ Hyg 2002;17:411–415.[CrossRef][Medline]
  51. Clapp WD, Becker S, Quay J, Watt JL, Thorne PS, Frees KL, Zhang X, Koren HS, Lux CR, Schwartz DA. Grain dust-induced airflow obstruction and inflammation of the lower respiratory tract. Am J Respir Crit Care Med 1994;150:611–617.[Abstract]
  52. Deetz DC, Jagielo PJ, Quinn TJ, Thorne PS, Bleuer SA, Schwartz DA. The kinetics of grain dust-induced inflammation of the lower respiratory tract. Am J Respir Crit Care Med 1997;155:254–259.[Abstract]
  53. Huy T, De Schipper K, Chan-Yeung M, Kennedy SM. Grain dust and lung function: dose–response relationships. Am Rev Respir Dis 1991;144:1314–1321.[Medline]
  54. Skorska C, Mackiewicz B, Dutkiewicz J, Krysinska-Traczyk E, Milanowski J, Feltovich H, Lange J, Thorne P. Effects of exposure to grain dust in Polish farmers: work-related symptoms and immunologic response to microbial antigens associated with dust. Ann Agric Environ Med 1998;5:147–153.[Medline]
  55. DoPico GA, Reddan W, Flaherty D, Tsiatis A, Peters ME, Rao P, Rankin J. Respiratory abnormalities among grain handlers: a clinical, physiologic, and immunologic study. Am Rev Respir Dis 1977;115:915–927.[Medline]
  56. Manfreda J, Cheang M, Warren CP. Chronic respiratory disorders related to farming and exposure to grain dust in a rural adult community. Am J Ind Med 1989;15:7–19.[Medline]



This article has been cited by other articles:


Home page
Am. J. Respir. Crit. Care Med.Home page
R. L. Miller and S.-m. Ho
Environmental Epigenetics and Asthma: Current Concepts and Call for Studies
Am. J. Respir. Crit. Care Med., March 15, 2008; 177(6): 567 - 573.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Respir. Crit. Care Med.Home page
T. Nawrot, A. Nemmar, and B. Nemery
Update in environmental and occupational medicine 2005.
Am. J. Respir. Crit. Care Med., May 1, 2006; 173(9): 948 - 952.
[Full Text] [PDF]


Home page
Am. J. Respir. Crit. Care Med.Home page
S. Choudhry, P. C. Avila, S. Nazario, N. Ung, J. Kho, J. R. Rodriguez-Santana, J. Casal, H.-J. Tsai, A. Torres, E. Ziv, et al.
CD14 Tobacco Gene-Environment Interaction Modifies Asthma Severity and Immunoglobulin E Levels in Latinos with Asthma
Am. J. Respir. Crit. Care Med., July 15, 2005; 172(2): 173 - 182.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Online Supplement
Right arrow All Versions of this Article:
200404-530OCv1
171/7/773    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by LeVan, T. D.
Right arrow Articles by Merchant, J. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by LeVan, T. D.
Right arrow Articles by Merchant, J. A.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Proc. Am. Thorac. Soc. Am. J. Respir. Cell Mol. Biol.
Copyright © 2005 American Thoracic Society