help button home button
AJRCCM
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

Published ahead of print on February 25, 2005, doi:10.1164/rccm.200407-917OC
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
200407-917OCv1
171/10/1083    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Webley, W. C.
Right arrow Articles by Stuart, E. S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Webley, W. C.
Right arrow Articles by Stuart, E. S.
American Journal of Respiratory and Critical Care Medicine Vol 171. pp. 1083-1088, (2005)
© 2005 American Thoracic Society
doi: 10.1164/rccm.200407-917OC


Original Article

The Bronchial Lavage of Pediatric Patients with Asthma Contains Infectious Chlamydia

Wilmore C. Webley, Paul S. Salva, Chester Andrzejewski, Frances Cirino, Corrie A. West, Yaphet Tilahun and Elizabeth S. Stuart

Department of Microbiology, University of Massachusetts, Amherst; and Departments of Pathology and Pediatric Pulmonology, Baystate Medical Center, Springfield, Massachusetts

Correspondence and requests for reprints should be addressed to Wilmore Webley, Ph.D., Department of Microbiology, University of Massachusetts, 639 North Pleasant Street, Amherst, MA 01003. E-mail: wilmore{at}microbio.umass.edu


    ABSTRACT
 TOP
 ABSTRACT
 METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
There has been a worldwide increase in the incidence of asthma, and the disease has greatly impacted the public health care system. Chlamydia pneumoniae has been reported as a possible contributing factor in asthma. The organism has been detected by polymerase chain reaction (PCR) in bronchial tissue, but there has been no direct evidence of viability. To determine the frequency of viable Chlamydia in children, blood and bronchoalveolar lavage were collected from 70 pediatric patients undergoing flexible fiberoptic bronchoscopy. Forty-two of these patients had asthma, whereas the remaining patients had various respiratory disorders. Fifty-four percent (38) of the bronchoalveolar lavage samples were PCR-positive for Chlamydia, and 31% (22) of the PCR-positive samples were positive when cultured on macrophages. Twenty-eight samples (40%) and 14 samples (20%) of the PCR- and culture-positive samples, respectively, were from patients with asthma. Culture of the blood samples revealed that 24 (34.3%) of 70 were positive for Chlamydia compared with 8 (11%) of 70 matched nonrespiratory control subjects (p < 0.01); 17 (24%) of the positive blood cultures from the respiratory group were from patients with asthma. Elevation of total IgE was strongly associated with lavage culture positivity for Chlamydia. We therefore conclude that viable Chlamydia pneumoniae organisms are frequently present in the lung lavage fluid from this cohort of predominantly asthmatic pediatric patients.

Key Words: asthma • bronchial lavage • Chlamydia pneumoniae • culture

Chlamydia pneumoniae has long been associated with community-acquired pneumonia, bronchitis, and pharyngitis (13). The organism has recently been associated with other chronic illnesses, including Alzheimer's disease, multiple sclerosis, and atherosclerosis (46). The worldwide increase in the incidence of asthma and the impact of the disease on public health care has led to new investigations into the etiology of the disease. Accumulating evidence suggests that infections of the respiratory tract may influence asthma pathogenesis in several ways, including disease inception, exacerbation, and severity (79). C. pneumoniae has been linked with both the exacerbation and increased incidence of chronic pulmonary conditions, including chronic obstructive pulmonary disease and bronchial asthma in adults (1013). It also appears that acute C. pneumoniae infections can initiate asthma in some previously asymptomatic patients (11).

The majority of research linking Chlamydia to asthma has been conducted with adult populations. However, there is evidence suggesting that C. pneumoniae may play a role in pediatric asthma onset (8, 14, 15). A limitation to definitively linking the presence of infectious organisms and asthma is the lack of effective diagnostic methods. Antibody titers, although indicative of past or ongoing infection, cannot be used to establish a direct link because C. pneumoniae infects the majority of humans at some point in our lifetime (16). Several permutations of the polymerase chain reaction (PCR) have been successfully used to study the association of C. pneumoniae with various clinical manifestations and chronic illnesses, including asthma. However, PCR cannot establish whether the amplified products derive from residual DNA fragments, nonviable elementary bodies, or viable inclusions. Therefore, in this respect, culture is the desired method for isolation and identification. C. pneumoniae, however, grows poorly in cultures using epithelial or fibroblast cells, and the inclusions formed are smaller than those seen for other Chlamydia species (16).

This study used a combination of modified tissue culture media and macrophage cells to successfully isolate and culture viable Chlamydia from blood and bronchoalveolar lavage (BAL) samples. The data presented establish the presence of infectious C. pneumoniae organisms in pediatric asthma. These organisms were cultured from both BAL and peripheral blood specimens of patients with asthma in a cohort of pediatric patients undergoing bronchoscopic examination for a variety of respiratory disorders. This is the first report of live culture from BAL in children. Some of the results of these studies have been previously reported in the form of an abstract (17).


    METHODS
 TOP
 ABSTRACT
 METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Specimens
The approval for using excess BAL fluid and peripheral blood was obtained from the Institutional Review Board at Baystate Medical Center, a community-based hospital setting. Written, informed consent was obtained from the patients or their guardians. From July 2002 to July 2003, samples were obtained from 70 pediatric patients with chronic respiratory symptoms for diagnostic purposes in the course of clinical practice, and diagnoses were only made after analysis of the BAL. BAL fluid was collected from the right middle lobe under general anesthesia using a flexible fiberoptic bronchoscope through a laryngeal mask airway, as described previously (18) by one investigator (P.S.S.). Samples of 3 to 5 ml of ethylenediaminetetraacetic acid blood were also collected. Control blood samples were collected from nonrespiratory patients at the University of Massachusetts Health Services Department. All patient identifiers were removed, and the specimens were given code numbers. Patients were not contacted with the results of the investigation.

Smear Examination
The buffy coat from whole blood and BAL cell pellets were smeared onto glass slides and fixed with methanol. The slides were stained with guinea pig polyclonal anti-Chlamydia antibody and a fluorescein isothiocyanate–conjugated secondary antibody (Biomedia Corp., Foster City, CA). Slides then were examined using an epifluorescence microscope.

Culture of BAL and Blood Samples
Buffy coats and BAL for culture were washed, and the cells lysed with sterile glass beads assisted by vortexing in a sucrose phosphate glutamate buffer. Lysates were centrifuged, and the Chlamydia-containing supernatants were collected. THP-1 or J774A.1 cell monolayers grown in Eagle's minimum essential medium with insulin (Irvine Scientific, Santa Ana, CA), supplemented with 10% fetal bovine serum (Atlanta Biologicals, Lawrenceville, GA), were inoculated. The inoculum was removed after 4 hours and cycloheximide/Eagle's minimum essential media added. Plates were incubated at 37°C for 96 hours, rinsed with phosphate-buffered saline, fixed, and then stained as previously described. All samples were examined in duplicate, and 20 randomly selected samples were retested in duplicate for repeatability.

PCR Analysis
Genomic DNA was isolated from BAL or blood samples using the QIAamp DNA Blood Mini Extraction Kit (Qiagen, Inc., Valencia, CA). DNA was amplified using a 16S signature sequence (16SIGF-5' CGGCGTGGATGAGGCAT 3' 16SIGR-5' TCAGTCCCAGTGTTGGC 3') to detect all Chlamydiales strains, resulting in a 298-bp product (19). C. pneumoniae–specific PCR was performed using the primer pair Cpn A and B (5'TGACAACTGTAGAAATACAGC3' and 5'ATTTATAGGAGAGAGGCG 3') to generate a 463-bp product (20). PCR was performed using a Bio-Rad MyCycler (Bio-Rad Laboratories, Hercules, CA), and the PCR products (10 µl) were separated by electrophoresis on a 2% agarose gel and visualized with ethidium bromide staining.

Evaluation of Total IgE
Determination of total IgE was performed using the Elecsys IgE kit (Roche Diagnostics, Indianapolis, IN), which uses the electrochemiluminescence immunoassay according to the manufacturer's instructions, and the plates were read on the Roche Elecsys 1020 analyzer. The analyzer automatically calculated the IgE concentration of each sample based on a standard curve. Elevated IgE levels were determined based on the manufacturer's recommended threshold by age range (neonates, 3.6 ng/ml; infants in first year of life, 36 ng/ml; children aged 1–5 years, 144 ng/ml; children aged 6–9 years, 216 ng/ml; children aged 10–15 years, 480 ng/ml; adults, 240 ng/ml).

Statistics
Data were analyzed using the SPSS 11.5 Graduate Pack (SPSS, Inc., Chicago, IL) statistics program. Cross-tabs with the Fisher exact test and {kappa} test were used to determine significance. For all analyses, tests were two-sided, and the level of significance was p <= 0.05.


    RESULTS
 TOP
 ABSTRACT
 METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Demographics of Patient Population
The average age of this group of community-based patients was 7.5 years, with an age range of 1 month to 19 years. There were 38 males and 32 females from four different ethnic groups: white (48 patients), Hispanic (14 patients), black (7 patients), and Asian (1 patient; Table 1). The single Asian patient did not have asthma. Asthma was diagnosed by family and/or personal history of atopy, elevated IgE, positive skin or RAST testing, reversible flow limitation on spirometry, the presence of increased eosinophils and basement membrane thickening on bronchial biopsy, or positive methacholine challenge. All of the black patients in this study had diagnosed asthma. Eight Hispanics (57%) and 30 whites (63%) also had diagnosed asthma. The remaining patients had various respiratory disorders, including aspiration bronchitis (17 patients), structural and airway anomalies (5 patients), gastroesophageal reflux disease (15 patients), cystic fibrosis (1 patient), and recurrent pneumonia of unknown etiology (1 patient). Many patients were diagnosed with a combination of asthma, gastroesophageal reflux disease, and airway aspiration bronchitis. There was no significant relationship between race or sex and BAL or blood culture positivity for infectious Chlamydia. Thirty of the 70 patients whose samples were analyzed were taking medications at the time of testing. The most common medications included fluticasone/salmetrol, budesonide, triamcinolone, montelukast, fluticasone, and prednisolone. Fourteen of the patients with asthma were on medications; however, there was no significant correlation between the finding of infectious Chlamydia and a course of medication.


View this table:
[in this window]
[in a new window]
 
TABLE 1. Patient characteristics

 
Visualization of Chlamydial Inclusions on Blood and BAL Smears
Smears were made from the isolated cells and stained with an anti-Chlamydia polyclonal antibody. Fluorescence microscopy examination of the stained smears revealed that 28 (40%) of the 70 samples tested had Chlamydia in the blood smears and/or in the BAL smears (Table 2). The chlamydial organisms could be seen inside lymphocytes and monocyte-like cells of the peripheral blood samples. Inclusions were seen in alveolar macrophages as well as epithelial cells in the BAL smears. Cellular differentiations were based solely on morphologic observations (Figure 1). These results demonstrate that C. pneumoniae can infect and be transported in cells of the peripheral blood as well as in cells of the respiratory tract.


View this table:
[in this window]
[in a new window]
 
TABLE 2. Cross-tabulation of bronchoalveolar lavage/blood culture and smears stained for chlamydia

 


View larger version (83K):
[in this window]
[in a new window]
 
Figure 1. Immunofluorescence stain of Chlamydia in peripheral blood and bronchoalveolar lavage (BAL) smears. Blood and BAL smears were prepared as described in METHODS and stained with a guinea pig anti-Chlamydia polyclonal antibody and a goat anti–guinea pig fluorescein isothiocyanate (FITC-) –conjugated secondary antibody. The slides were viewed and photographs taken using a Nikon Eclipse E600 epifluorescence microscope and a SPOT digital camera (Digital Instruments, Inc., Buffalo, NY). (A) A typical positive blood smear with a brightly stained inclusion inside a monocyte-like cell. (B) A representative picture of a positive BAL smear with two inclusions inside alveolar macrophages. Representative negative blood (C) and BAL (D) smear samples. Pictures were taken at an original magnification of 600x.

 
Isolation of Infectious C. pneumoniae Organisms from Blood and BAL Using Tissue Culture
All BAL and blood samples were cultured on human or mouse macrophage cells to determine if the organisms present were infectious. The results demonstrated that 22 (31%) of the 70 samples were positive for Chlamydia on BAL culture and 24 samples (34%) were positive when the peripheral blood was cultured (Table 2). Seventeen samples (59% of all culture-positive BAL or blood samples) were culture-positive in both blood and BAL. On many of the coverslips with infected monolayers, there were foci of infection, indicating that the majority of the inclusions in any given area resulted from progeny elementary bodies that infected neighboring cells (Figure 2). Organisms at all stages of development could be seen at 96 hours postinfection of culture monolayers. For comparison, nonrespiratory, age-matched blood samples were also similarly tested, and of the 70 tested, 8 (11%) samples were positive for cultivable Chlamydia (p < 0.01 compared with the respiratory study group, Fisher exact test). There was no difference in the finding of infectious Chlamydia between sexes; 11 of the BAL culture–positive samples were from female patients and 11 from males. Likewise, for the finding of the organism by blood smear and culture, the percentage positivity per sex was similar to the results obtained for BAL. Eight of the BAL culture–positive samples were from patients between the ages of 1 month and 5 years, whereas the age groups of 5.1 to 10.0 and 15.1 to 22 years accounted for four each. The age group of 10.1 to 15.0 years accounted for the remaining six culture-positive patients.



View larger version (69K):
[in this window]
[in a new window]
 
Figure 2. Immunofluorescence stain of Chlamydia in culture. Cells from buffy coat or BAL samples were washed, lysed to release any inclusions present, and then cultured on J774A.1 or THP-1 macrophage cells on 12-mm coverslips in 24-well plates for 96 hours. The coverslips were then rinsed and stained with a guinea pig anti-Chlamydia polyclonal antibody and visualized with an FITC-conjugated secondary. Mature as well as smaller, immature chlamydial inclusions can be seen on the coverslip (left). The image on the right is a stained slide of a negative sample. Original magnification, 600x.

 
Samples from Patients with Asthma Had Viable C. pneumoniae in Culture
Forty-two of the 70 samples analyzed (60%) were from patients with asthma, as defined by clinical diagnosis and/or laboratory testing. The remaining patients constituting a disease reference control subgroup without asthma (n = 28) exhibited various respiratory disorders, including aspiration bronchitis, structural and airway anomalies, and recurrent pneumonia of unknown etiology. Of 22 BAL samples positive by culture, 14 (64%) samples were from patients with asthma (Table 3). Of the 42 patients with asthma, one-third (14 patients) were BAL culture–positive. The remaining eight positives were from the respiratory disease population without asthma. Four of these culture-positive samples were from patients between the ages of 0 and 2 years. The age ranges of 2.1 to 5.0 and 5.1 to 10.0 years also accounted for four and five BAL culture–positive patients, respectively. The age group of 10.1 to 15.0 years accounted for the majority of BAL culture–positive samples (6). There were six patients with diagnosed asthma in age range of 0 to 2.0 years and eight in the age range of 2.1 to 5.0 years. Thirteen patients in the age range of 5.1 to 10.0 years had asthma, whereas 10 patients with asthma were in the age range of 10.1 to 15.0 years. Four patients in the age range of 15.1 to 20.0 years had asthma (Table 1). Seventeen of the 42 patients with asthma had culture-positive blood. In addition, using a specific peptide from the major outer membrane protein (MOMP) porin of C. pneumoniae, ELISAs were performed on all samples to assess the anti–C. pneumoniae antibody titers. Twenty-nine percent of all samples tested had positive antibody titers (>= 200; data not shown). Sixty-five percent of the C. pneumoniae antibody-positive samples derived from patients with diagnosed asthma.


View this table:
[in this window]
[in a new window]
 
TABLE 3. Culture-positive bronchoalveolar lavage samples analyzed by disease presentation

 
IgE Antibody Positivity, Viable C. pneumoniae, and Disease Association
Previous reports that sought to determine if C. pneumoniae infection triggers the production of C. pneumoniae–specific IgE in reactive airway disease in children detected 85.7% of patients with culture-positive asthma with wheezing compared with only 9.1% of patients with culture-positive asthma with pneumonia (21). We measured total serum IgE and defined an elevated level based on the Roche Diagnostics kit–recommended threshold values for age ranges. In the present cohort of respiratory patients, elevated total IgE was present in 17 (77.3%) of the 22 patients with positive BAL cultures compared with 9 (18.8%) of the 48 patients with negative BAL cultures (p < 0.0001). Elevated total IgE was also present in 20 (47.6%) of 42 patients with asthma versus 6 (21.4%) of 28 patients without asthma (p < 0.05; Table 4). C. pneumoniae–specific IgE was not evaluated.


View this table:
[in this window]
[in a new window]
 
TABLE 4. Elevated ige levels, disease diagnosis, and bronchoalveolar lavage culture

 
PCR Amplification of BAL Samples
Chlamydial organisms frequently revert to a persistent state soon after infection and are therefore often not easily cultivable. We performed PCR on the BAL samples using a 16S signature ribosomal DNA sequence to determine the infectious and noninfectious levels of chlamydial organism carriage. Amplification of the target sequence produced a 298-bp product when the PCR products were electrophoresed. Fifty-four percent of the BAL samples tested were positive by PCR (Figure 3). Of the 42 patients with asthma, 28 (67%) were PCR-positive. All samples that were BAL culture– or smear–positive also tested positive by PCR. This confirms the specificity of our culture technique and suggests that the culture-negative, PCR-positive samples could contain noninfectious elementary bodies or that the elementary body level was too low for detection by culture. We confirmed that the organisms were C. pneumoniae by using a specific 16S rRNA primer pair to yield a 463-bp product. Thirty-four of the 38 samples positive for Chlamydia using the general primers were also C. pneumoniae–positive. The four negative samples were subsequently shown to contain C. trachomatis using specific primers (data not shown).



View larger version (13K):
[in this window]
[in a new window]
 
Figure 3. Isolation and amplification of chlamydial DNA by polymerase chain reaction (PCR). Genomic DNA was isolated from BAL cell pellets and PCR amplified using a 16S signature sequence for the Chlamydiales. All culture- and smear-positive samples were also PCR-positive by this method. Samples 3 and 16 are negative, L is a 1-kb DNA ladder, P1 and P2 are the primer pairs used for amplification, and C is genomic DNA from C. pneumoniae strain AR39, which was purified and amplified in a similar manner as the samples and used as the positive control.

 

    DISCUSSION
 TOP
 ABSTRACT
 METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
In adults and children, various atypic pathogens have either been implicated or demonstrated to play definitive roles (8, 2224) as agents of lower respiratory tract infections. Asthma is characterized by airway hyperreactivity, inflammation, and atopy. Recently, it has been shown that respiratory infections caused by various bacterial and viral organisms play an important role in the exacerbation of asthma (7, 8, 25). In particular, C. pneumoniae has been shown to exacerbate asthma symptoms and might play a role in the initiation of adult disease (10, 26). The association of C. pneumoniae with pediatric asthma, however, has not been extensively studied. Moreover, none of the current studies investigated the viability, or infectivity, of the organisms present in BAL samples from young children with asthma.

Our study used a combination of professional phagocytic cells in the form of transformed human monocyte/macrophage cell line (THP-1), as well as a mouse macrophage cell line (J774A.1), together with modified culture medium to successfully isolate infectious organisms from the blood and BAL of these pediatric patients. The medium used was a minimum essential medium supplemented with 4 g/L of insulin. The quantities of calcium and other ions as well as several amino acids were sometimes more than two times the concentration present in media such as RPMI 1640, which is traditionally used to grow cells for isolating the organism. In normal passages, we observed larger inclusions and more efficient infection than with RPMI 1640 (W.C.W. and E.S.S., unpublished data). The results revealed a high prevalence of the infectious organisms in diagnosed asthma in this cohort of consecutive patients requiring diagnostic bronchoscopy to assess a variety of respiratory disorders. Our analysis indicates that 33% of patients diagnosed with asthma had infectious chlamydial organisms in their BAL samples, and overall, 67% of patients with asthma were PCR-positive. Fifty-seven percent (17) of the patients with PCR-positive asthma also carried infectious Chlamydia in their peripheral blood as seen by culture. PCR data confirmed the presence of chlamydial DNA in the BAL samples and, when specific primers were used, PCR definitively showed that the majority of the organisms were C. pneumoniae. There were four patient samples that tested positive using the general Chlamydiales primers but were negative using C. pneumoniae–specific primers. These samples were subsequently shown to contain C. trachomatis organisms. There were also samples with both C. pneumoniae and C. trachomatis organisms. The finding of C. trachomatis in the lungs of children with respiratory problems is not unusual because data suggest that C. trachomatis can cause neonatal lung infections that can persist (2729). All samples that tested positive by BAL culture and/or smear were also PCR-positive; however, an additional 13 (18.5%) samples, negative on culture and/or smear, were positive by PCR. It is possible that these samples contained persistent C. pneumoniae and therefore were not readily cultured. It is also likely that there were nonviable elementary bodies in some samples subjected to PCR, and this accounted for their lack of growth when cultured.

Previous studies performed on both adults and children demonstrated an elevated anti–C. pneumoniae–specific IgE titer in patients with culture-positive asthma with wheezing (21). In this study, total IgE levels were assessed, and 26 (37%) of the 70 samples tested exhibited elevations. C. pneumoniae–specific IgE was not evaluated here. However, there was a significant association (p < 0.001) between the presence of infectious organisms shown by culture of BAL and elevated total IgE levels, which was quantitatively and statistically stronger than the association between IgE and asthma diagnosis. The data presented here from a cohort of pediatric patients demonstrate the presence of infectious C. pneumoniae organisms in both BAL and peripheral blood samples of patients with asthma. A more extensive study that would span the full range of seasonal environmental conditions could further add significant insights into the implications of the presence of infectious C. pneumoniae organisms in this multifactorial disease.


    Acknowledgments
 
The authors thank Theresa Stec for her assistance in archiving the BAL and blood samples.


    FOOTNOTES
 
Conflict of Interest Statement: W.C.W. does not have a financial relationship with a commercial entity that has an interest in the subject of this manuscript; P.S.S. does not have a financial relationship with a commercial entity that has an interest in the subject of this manuscript; C.A. does not have a financial relationship with a commercial entity that has an interest in the subject of this manuscript; F.C. does not have a financial relationship with a commercial entity that has an interest in the subject of this manuscript; C.A.W. does not have a financial relationship with a commercial entity that has an interest in the subject of this manuscript; Y.T. does not have a financial relationship with a commercial entity that has an interest in the subject of this manuscript; E.S.S. does not have a financial relationship with a commercial entity that has an interest in the subject of this manuscript.

Received in original form July 15, 2004; accepted in final form February 15, 2005


    REFERENCES
 TOP
 ABSTRACT
 METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Grayston JT. Infections caused by Chlamydia pneumoniae strain TWAR. Clin Infect Dis 1992;15:757–761.[Medline]
  2. Grayston JT, Aldous MB, Easton A, Wang SP, Kuo CC, Campbell LA, Altman J. Evidence that Chlamydia pneumoniae causes pneumonia and bronchitis. J Infect Dis 1993;168:1231–1235.[Medline]
  3. Cook PJ, Honeybourne D. Clinical aspects of Chlamydia pneumoniae infection. Presse Med 1995;24:278–282.
  4. Byrne GI, Kalayoglu MV. Chlamydia pneumoniae and atherosclerosis: links to the disease process. Am Heart J 1999;138:S488–S490.[CrossRef][Medline]
  5. Layh-Schmitt G, Bendl C, Hildt U, Dong-Si T, Juttler E, Schnitzler P, Grond-Ginsbach C, Grau AJ. Evidence for infection with Chlamydia pneumoniae in a subgroup of patients with multiple sclerosis. Ann Neurol 2000;47:652–655.[CrossRef][Medline]
  6. Balin BJ, Gerard HC, Arking EJ, Appelt DM, Branigan PJ, Abrams JT, Whittum-Hudson JA, Hudson AP. Identification and localization of Chlamydia pneumoniae in the Alzheimer's brain. Med Microbiol Immunol (Berl) 1998;187:23–42.[CrossRef][Medline]
  7. Osur SL. Viral respiratory infections in association with asthma and sinusitis: a review. Ann Allergy Asthma Immunol 2002;89:553–560.[Medline]
  8. Montalbano MM, Lemanske RF Jr. Infections and asthma in children. Curr Opin Pediatr 2002;14:334–337.[CrossRef][Medline]
  9. Schmidt SM, Muller CE, Bruns R, Wiersbitzky SK. Bronchial Chlamydia pneumoniae infection, markers of allergic inflammation and lung function in children. Pediatr Allergy Immunol 2001;12:257–265.[CrossRef][Medline]
  10. Hahn DL, Dodge RW, Golubjatnikov R. Association of Chlamydia pneumoniae (strain TWAR) infection with wheezing, asthmatic bronchitis, and adult-onset asthma. JAMA 1991;266:225–230.[Abstract]
  11. Hahn DL, McDonald R. Can acute Chlamydia pneumoniae respiratory tract infection initiate chronic asthma? Ann Allergy Asthma Immunol 1998;81:339–344.[Medline]
  12. Gencay M, Rudiger JJ, Tamm M, Soler M, Perruchoud AP, Roth M. Increased frequency of Chlamydia pneumoniae antibodies in patients with asthma. Am J Respir Crit Care Med 2001;163:1097–1100.[Abstract/Free Full Text]
  13. Johnston SL. Is Chlamydia pneumoniae important in asthma? The first controlled trial of therapy leaves the question unanswered. Am J Respir Crit Care Med 2001;164:513–514.[Free Full Text]
  14. Esposito S, Principi N. Asthma in children: are chlamydia or mycoplasma involved? Paediatr Drugs 2001;3:159–168.[CrossRef][Medline]
  15. Emre U, Roblin PM, Gelling M, Dumornay W, Rao M, Hammerschlag MR, Schachter J. The association of Chlamydia pneumoniae infection and reactive airway disease in children. Arch Pediatr Adolesc Med 1994;148:727–732.[Abstract]
  16. Kuo CC, Jackson LA, Campbell LA, Grayston JT. Chlamydia pneumoniae (TWAR). Clin Microbiol Rev 1995;8:451–461.[Abstract]
  17. Webley WC, Cirino F, West C, Andrzejewski C, Stuart ES, Salva PS. Detection of viable Chlamydophila pneumoniae organisms in the blood and bronchial lavages of pediatric patients with chronic bronchial asthma [abstract]. Am J Respir Crit Care Med 2004;169(Suppl 7):A586.
  18. Salva PS, Theroux C, Schwartz D. Safety of endobronchial biopsy in 170 children with chronic respiratory symptoms. Thorax 2003;58:1058–1060.[Abstract/Free Full Text]
  19. Everett KD, Bush RM, Andersen AA. Emended description of the order Chlamydiales, proposal of Parachlamydiaceae fam. nov. and Simkaniaceae fam. nov., each containing one monotypic genus, revised taxonomy of the family Chlamydiaceae, including a new genus and five new species, and standards for the identification of organisms. Int J Syst Bacteriol 1999;49:415–440.[Abstract/Free Full Text]
  20. Gaydos CA, Quinn TC, Eiden JJ. Identification of Chlamydia pneumoniae by DNA amplification of the 16S rRNA gene. J Clin Microbiol 1992;30:796–800.[Abstract/Free Full Text]
  21. Emre U, Sokolovskaya N, Roblin PM, Schachter J, Hammerschlag MR. Detection of anti-Chlamydia pneumoniae IgE in children with reactive airway disease. J Infect Dis 1995;172:265–267.[Medline]
  22. Lieberman D, Korsonsky I, Ben-Yaakov M, Lazarovich Z, Friedman MG, Dvoskin B, Leinonen M, Ohana B, Boldur I. A comparative study of the etiology of adult upper and lower respiratory tract infections in the community. Diagn Microbiol Infect Dis 2002;42:21–28.[CrossRef][Medline]
  23. Numazaki K, Chiba S, Umetsu M, Tanaka T, Yoshimura H, Kuniya Y, Miura J, Adachi N, Ukae S, Mori T, et al. Etiological agents of lower respiratory tract infections in Japanese children. In Vivo 2004;18:67–71.[Medline]
  24. Ray CG, Holberg CJ, Minnich LL, Shehab ZM, Wright AL, Taussig LM. Acute lower respiratory illnesses during the first three years of life: potential roles for various etiologic agents. The Group Health Medical Associates. Pediatr Infect Dis J 1993;12:10–14.
  25. Kraft M. The role of bacterial infections in asthma. Clin Chest Med 2000;21:301–313.[CrossRef][Medline]
  26. Strachan DP, Carrington D, Mendall M, Butland BK, Yarnell JW, Elwood P. Chlamydia pneumoniae serology, lung function decline, and treatment for respiratory disease. Am J Respir Crit Care Med 2000;161:493–497.[Abstract/Free Full Text]
  27. Bell TA, Stamm WE, Wang SP, Kuo CC, Holmes KK, Grayston JT. Chronic Chlamydia trachomatis infections in infants. JAMA 1992;267:400–402.[Abstract]
  28. Bavastrelli M, Midulla M, Rossi D, Salzano M. Chlamydia trachomatis infection in children with wheezing simulating asthma. Lancet 1992;339:1174.[Medline]
  29. Sollecito D, Midulla M, Bavastrelli M, Panero A, Marzetti G, Rossi D, Salzano M, Roggini M, Bucci G. Chlamydia trachomatis in neonatal respiratory distress of very preterm babies: biphasic clinical picture. Acta Paediatr 1992;81:788–791.[Medline]



This article has been cited by other articles:


Home page
J. Immunol.Home page
G. E. Kaiko, S. Phipps, D. K. Hickey, C. E. Lam, P. M. Hansbro, P. S. Foster, and K. W. Beagley
Chlamydia muridarum Infection Subverts Dendritic Cell Function to Promote Th2 Immunity and Airways Hyperreactivity
J. Immunol., February 15, 2008; 180(4): 2225 - 2232.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Respir. Crit. Care Med.Home page
J. C. Horvat, K. W. Beagley, M. A. Wade, J. A. Preston, N. G. Hansbro, D. K. Hickey, G. E. Kaiko, P. G. Gibson, P. S. Foster, and P. M. Hansbro
Neonatal Chlamydial Infection Induces Mixed T-Cell Responses That Drive Allergic Airway Disease
Am. J. Respir. Crit. Care Med., September 15, 2007; 176(6): 556 - 564.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Respir. Crit. Care Med.Home page
W. C. Webley, P. S. Salva, C. Andrzejewski, F. Cirino, C. A. West, Y. Tilahun, and E. S. Stuart
Notice of Duplicate Publication
Am. J. Respir. Crit. Care Med., January 1, 2007; 175(1): 94 - 94.
[Full Text] [PDF]


Home page
ThoraxHome page
E Normann, J Gnarpe, B Wettergren, C Janson, M Wickman, and L Nordvall
Association between Chlamydia pneumoniae antibodies and wheezing in young children and the influence of sex
Thorax, December 1, 2006; 61(12): 1054 - 1058.
[Abstract] [Full Text] [PDF]


Home page
PediatricsHome page
T. T. Perry
The Bronchial Lavage of Pediatric Patients With Asthma Contains Infectious Chlamydia
Pediatrics, August 1, 2006; 118(Supplement_1): S28 - S28.
[Abstract] [PDF]


Home page
J. Immunol.Home page
X. Han, S. Wang, Y. Fan, J. Yang, L. Jiao, H. Qiu, and X. Yang
Chlamydia Infection Induces ICOS Ligand-Expressing and IL-10-Producing Dendritic Cells That Can Inhibit Airway Inflammation and Mucus Overproduction Elicited by Allergen Challenge in BALB/c Mice
J. Immunol., May 1, 2006; 176(9): 5232 - 5239.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Respir. Crit. Care Med.Home page
S. E. Wenzel and R. Covar
Update in asthma 2005.
Am. J. Respir. Crit. Care Med., April 1, 2006; 173(7): 698 - 706.
[Full Text] [PDF]


Home page
Eur Respir JHome page
D. L. Hahn
A theory explaining time trends in asthma prevalence
Eur. Respir. J., February 1, 2006; 27(2): 434 - 435.
[Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
200407-917OCv1
171/10/1083    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Webley, W. C.
Right arrow Articles by Stuart, E. S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Webley, W. C.
Right arrow Articles by Stuart, E. S.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Proc. Am. Thorac. Soc. Am. J. Respir. Cell Mol. Biol.
Copyright © 2005 American Thoracic Society