This Article Abstract Full Text (PDF) Online Supplement All Versions of this Article: 200309-1311OCv1 170/6/647    most recent Alert me when this article is cited Alert me if a correction is posted Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Murata, T. Articles by Ozaki, H. Search for Related Content PubMed PubMed Citation Articles by Murata, T. Articles by Ozaki, H.

Dexamethasone Blocks Hypoxia-induced Endothelial Dysfunction in Organ-cultured Pulmonary Arteries

Department of Veterinary Pharmacology, Graduate School of Agriculture and Life Sciences, The University of Tokyo, Tokyo, Japan

Correspondence and requests for reprints should be addressed to Takahisa Murata, D.V.M., Ph.D., Department of Veterinary Pharmacology, Graduate School of Agriculture and Life Sciences, The University of Tokyo, Bunkyo-ku, Tokyo 113-8657, Japan. E-mail: murata{at}mail.vm.a.u-tokyo.ac.jp

	ABSTRACT

TOP ABSTRACT METHODS RESULTS DISCUSSION REFERENCES

 
We assessed the effects of dexamethasone (DEX) on hypoxia-induced dysfunction of the pulmonary endothelium using organ-cultured rabbit intrapulmonary arteries; 3-µM DEX inhibited the 7-day hypoxia (5% oxygen)-induced impairments of endothelial-dependent relaxation, cGMP accumulation, and increase in intracellular Ca²⁺ level under substance P-stimulated conditions. Treatment with DEX over the final 3 days of the 7-day hypoxic exposure period also restored the decreased endothelium-dependent relaxation. Although chronic hypoxia did not change the mRNA expression of endothelial nitric oxide synthase (eNOS), 3 µM of DEX increased eNOS mRNA expression in both the hypoxic and normoxic (20% oxygen) pulmonary endothelium. On the other hand, eNOS protein expression was not changed in any of the arteries. We next assessed the effects of DEX on the eNOS activation pathway. Chronic hypoxia impaired eNOS phosphorylation and Akt phosphorylation under both the nonstimulated and substance P-stimulated conditions, and 3-µM DEX restored these phosphorylations. Morphologic study revealed that 3-µM DEX inhibited chronic hypoxia-induced atrophy of endothelial cells and eNOS protein condensation into plasma membranes. These results suggest that DEX exerts beneficial effects on chronic hypoxia-induced impairments of nitric oxide–mediated arterial relaxation by increasing eNOS mRNA expression and inhibiting hypoxia-induced impairments in eNOS activation pathway with atrophy of endothelial cells.

Key Words: endothelium-dependent relaxation • dexamethasone • hypoxia • organ culture

Chronic hypoxia, which results from chronic obstructive pulmonary disease and congestive heart failure, causes sustained pulmonary hypertension, which is characterized by elevated pulmonary arterial pressure in association with pulmonary vascular muscularization (1–3). Various forms of pulmonary hypertension pose a significant medical problem, and the current options for effective prevention and therapy are limited (4, 5).

There is evidence that endothelial dysfunction is intimately involved in the onset and progression of pulmonary hypertension through abnormalities in the production, release, or degradation of endothelium-derived relaxing factors, especially nitric oxide (NO), which contributes not only to the local regulation of vascular smooth muscle tone (6) but also to cell proliferation (7). Endothelial NO synthase (eNOS) activity is regulated by the cellular localization of eNOS (8, 9) and by protein–protein interactions such as that between eNOS and caveolin-1 (10) or the phosphorylation of eNOS Ser¹¹⁷⁷ by serine/threonine kinase Akt (11, 12).

In our previous study, we clarified the mechanisms responsible for the impairment of endothelium-dependent NO production at the eNOS post-transcriptional level using intrapulmonary arteries isolated from hypoxia-induced pulmonary hypertensive rats (13). Notably, chronic hypoxia induced an impairment of the increase in intracellular Ca²⁺ level ([Ca²⁺]_i), tight coupling between eNOS and caveolin-1 with atrophy of endothelial cells, and a decrease in the level of eNOS Ser¹¹⁷⁷ phosphorylation in rat pulmonary arteries.

In a subsequent study, we successfully established a hypoxic organ–culture procedure to examine the changes in endothelial NO synthesis in rabbit pulmonary arteries (14). The results indicated that chronic hypoxia impairs endothelium-dependent relaxation (EDR) without changing eNOS mRNA or protein expression and specifically causes atrophy of endothelial cells and condensation of eNOS protein into caveolae in the pulmonary artery. These results were consistent with that of an in vivo study (13) and suggest that the hypoxic organ–culture method can duplicate the endothelial dysfunction in hypoxia-induced pulmonary hypertension. The organ–culture method also makes it possible to dissociate the influence of other factors from the direct effect of hypoxia without the need to account for the individual differences of experimental animals. Finally, the method allows us to incubate the tissue under constant oxygen tension for a long period of time and to examine easily the effects of various agents on the morphology and function of tissue.

Glucocorticoids are used to treat a wide variety of inflammatory diseases, and Wang and colleagues reported that treatment with the glucocorticoid dexamethasone (DEX) restored the decrease in plasma NO content in hypoxia-induced pulmonary hypertensive rats (15). However, the detailed mechanisms of the beneficial effects of glucocorticoids have not yet been clarified. The actions of glucocorticoids are mediated by the glucocorticoid receptor, a member of the nuclear receptor family of ligand-dependent transcription factors (16). After activation by its ligand, the receptor can act as a transcription factor; that is, it can alter the expression of specific target genes. Several studies have reported that glucocorticoids have various protective effects on the vascular endothelium, such as inhibition of apoptosis mediated by lipopolysaccharide and tumor necrosis factor- (17), and inhibition of endothelial inflammatory response (18, 19).

Consequently, the goal of this study was to determine whether a glucocorticoid, DEX, prevents hypoxia-induced endothelial dysfunction in the pulmonary artery and, if so, to investigate the detailed mechanisms of this effect using the vascular organ–culture method. The results showed that DEX had beneficial effects on chronic hypoxia-induced pulmonary endothelial dysfunction through its protective effect on endothelial NO production.

	METHODS

TOP ABSTRACT METHODS RESULTS DISCUSSION REFERENCES

 
Chemicals and Antibodies
The chemicals used were as follows: DEX, prostaglandin F₂, substance P, ionomycin calcium salt (Sigma, St. Louis, MO), 1,1'-dioctadecyl-3,3,3',3'-tetramethylindo-carbocyanine perchlorate (Biomedical Technologies, Stoughton, MA), anti-eNOS antibody (Santa Cruz Biotechnology, Santa Cruz, CA), anti-phosphorylated eNOS, anti-Akt antibody and antiphosphorylated Akt antibody (Cell Signaling, Beverly, MA), and fluo-4AM (Molecular Probes, Eugene, OR).

Tissue Preparation and Organ–Culture Procedure
Male Japanese White rabbits (2–3 kg) were killed by stunning and exsanguination. The organ–culture procedure was performed as described previously (14, 20). Briefly, the main branches of the intrapulmonary arteries were isolated, and each artery was cut into rings approximately 1.5 mm wide. The arterial rings were then placed in 2 ml of Dulbecco's modified Eagle's medium in the presence or absence of 3 µM of DEX. The muscle rings were maintained at 37°C under an atmosphere of 90% N₂–5% O₂ and 5% CO₂ (hypoxia) or 95% air and 5% CO₂ (normoxia) for 7 days. In some experiments, to examine the improvement effects of DEX on hypoxia-induced impairment, we started DEX treatment after the 4-day exposure to hypoxia. The medium was changed every 2 days until the experiments were started. Animal care and treatment were conducted in conformity with the institutional guidelines of the University of Tokyo (Tokyo, Japan).

Measurement of Muscle Tension
In the experiments to examine the effect of DEX on vascular smooth muscle, the endothelium was removed by gently rubbing the intimal surface with forceps after the organ–culture procedure. Muscle tension was recorded isometrically under a resting tension of 10 mN as reported previously (14, 20). Data are shown as the percent relaxation of the steady-state preconstriction.

Measurement of cGMP Content
After the incubation, the vascular rings were immediately frozen in liquid nitrogen, homogenized in 6% trichloroacetic acid solution, and centrifuged at 2,000 x g for 15 minutes at 4°C, as described previously (14). The supernatants were applied to a cGMP enzyme–immunoassay system (Amersham Biosciences, Buckinghamshire, UK), whereas pellets were used to determine protein content by the method of Bradford (1976). cGMP contents are expressed as pmol/mg protein content.

[Ca²⁺]_i Imaging
Measurement of the [Ca²⁺]_i in endothelial cells in situ was performed using fluo-4AM according to the method described previously (13). The artery (1 mm wide) was incubated in physiological salt solution (PSS) with 5-µM fluo-4AM and 0.02% cremophor EL for 30 minutes at 25°C. The opened strip was mounted on the stage of a laser microscope, and the images were captured by means of a fluorescence imaging system (Aquacosmos; Hamamatsu Photonics, Tokyo, Japan) (x600). Images of vascular endothelial cells stained with fluo-4 were taken every 20 seconds at 37°C. For each artery, the mean fluorescent intensities of four to seven endothelial cells were averaged, as were the fluorescent intensities of four arteries for each condition. The microscope was equipped with 488-nm (excitation) and 540-nm (emission) filters.

Semiquantitative Reverse Transcription-polymerase Chain Reaction Analysis
Total RNA was extracted from the arteries, and the concentration of total RNA was adjusted to 1 µg/µl with RNase-free distilled water. Reverse transcription-polymerase chain reaction (PCR) was performed as described previously (14, 20). The oligonucleotide primers for eNOS and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) were designed as described previously (14). The forward primers and reverse primers for eNOS and GAPDH were designed as follows: ATA GAA TTC ACC AGC ACC TTT GGG AAT GGC GAT (forward primer for eNOS), ATA GAA TTC GGA TTC ACT GTC TGT GTT GCT GGA CTC CTT (reverse primer for eNOS), TCC CTC AAG ATT GTC AGC AA (forward primer for GAPDH), and AGA TCC ACA ACG GAT ACA TT (reverse primer for GAPDH). The PCR products were electrophoresed onto 2% agarose gel containing 0.1% ethidium bromide. The detectable fluorescence bands were visualized using an ultraviolet transilluminator. The densitometric intensity of 260 base pairs for eNOS and of 308 base pairs for GAPDH at 33 cycles was quantified using an image-processing program (National Institutes of Health Image 1.55). The results are expressed as the ratio of the optical density of eNOS to that of GAPDH.

Real-time PCR Analysis
The following primers and probes were used for the real-time PCR analysis: GAPDH: TGCACCACCAACTGCTTAGC (sense), TCTTCTGGGTGGCAGTGATG (antisense), TCATCCACGACCACTTCGGCATTG (probe); and eNOS: GAGTTACAAAATCCGCTTCAACAG (sense), TCCGCCGCCAAGAAGAC (antisense), CTCCTGCTCAGACCCGCTGG (probe). The mRNA expressions of the unknown samples were divided by the endogenous reference (GAPDH) amount to obtain a normalized target value. All PCR reactions were performed using an ABI Prism 7,000 Sequence Detection System (Perkin-Elmer Applied Biosystems, Norwalk, CT).

Western Blots for eNOS, Phosphorylated eNOS, Akt, and Phosphorylated Akt
Western blots were performed as described previously (13). Briefly, equal amounts (60 µg) of protein from the total homogenate of the arteries were loaded for the sodium dodecyl sulfate-polyacrylamide gel electrophoresis. Antibodies that recognize -actin and the other proteins (for eNOS, phosphorylated eNOS, Akt, and phosphorylated Akt) were used at a dilution of 1:2,000 and 1:500, respectively. The densitometric intensity was quantified by National Institutes of Health Image 1.55. To ensure that equal amounts of proteins were loaded, we confirmed that the same densitometric intensities of actin were observed in each preparation.

Whole-mount Immunostaining Measurement of Endothelial Cell Area
Whole-mount immunostaining was performed as described previously (13, 14). The arterial rings were fixed with 4% paraformaldehyde and then probed with anti-eNOS monoclonal antibody and anti–caveolin-1 polyclonal antibody (1:100 dilution). In addition, to measure the surface area of endothelial cells, the endothelium was labeled with a specific endothelial cell marker, acetylated low-density-lipoprotein labeled with 1,1'-dioctadecyl-3,3,3',3'-tetramethylindo-carbocyanine perchlorate. The arterial rings after the organ–culture procedure were incubated with 10 µg/ml of 1,1'-dioctadecyl-3,3,3',3'-tetramethylindo-carbocyanine perchlorate at 37°C for 4 hours. The images were captured using a Carl Zeiss confocal laser scanning microscope LSM510 imaging system (x630). Five-micrometer thick images from the endothelial cell surface were digitized under constant exposure time, gain, and offset. After capturing images, protein colocalization and cell area were measured by the LSM510 program.

Statistical Analysis
The results of the experiments are expressed as the means ± SEM. Statistical evaluation of the data was performed by analysis of variance, followed by the Tukey post-test for comparison between groups using Prism 3.0. A value of p < 0.05 was regarded as statistically significant.

	RESULTS

TOP ABSTRACT METHODS RESULTS DISCUSSION REFERENCES

 
EDR
In the normoxic pulmonary arteries with endothelium, substance P (0.1–10 nM) caused vasorelaxation of the muscle contraction elicited by 1 µM prostaglandin F₂ in a concentration-dependent manner (Figure 1A). At a higher concentration (30 nM), substance P induced contraction, possibly via a direct contractile effect on smooth muscle. In the hypoxic pulmonary arteries, the substance P–induced EDR was attenuated compared with that in the normoxic pulmonary arteries (n = 8). Treatment of tissue with 3 µM of DEX during the hypoxic condition significantly prevented these impairments of EDR (n = 8). We examined different treatment regimens to examine further this improvement of EDR by DEX. In the hypoxic pulmonary artery treated with 3 µM of DEX over the last 3 of the 7 days of hypoxic exposure, EDR was greater than that of 4- or 7-day hypoxic pulmonary arteries (Figure 1B; n = 5). In addition, we examined the effect of DEX on the relaxation of 35 mM high K⁺-induced contraction by substance P (10 nM) and revealed that in the hypoxic pulmonary arteries substance P–induced EDR was smaller than that in the normoxic pulmonary arteries, and DEX treatment completely prevented the impairments (the relaxation caused by substance P was 43.5 ± 4.0% in the normoxic arteries, 8.6 ± 3.5% in the hypoxic pulmonary arteries, 42.3 ± 2.7% in the DEX-treated normoxic arteries, and 43.9 ± 3.2% in the DEX-treated hypoxic pulmonary arteries; n = 4 each). In the preliminary experiments, we examined the influence of DEX-administration dosage (1–10 µM) on endothelial-dependent relaxation. At the lower dose (1 µM), DEX had no significant protective effects against the hypoxia-induced endothelial dysfunction (the maximum relaxation was 29.3 ± 3.5%; n = 4). On the other hand, no additional improvement was observed in the pulmonary arteries treated with 10 µM of DEX in comparison with those receiving 3 µM of DEX (the maximum relaxation was 58.6 ± 2.1%; n = 4). Consequently, we chose 3 µM of DEX as our treatment dosage and investigated the mechanism of the beneficial effect of this treatment on hypoxia-induced pulmonary endothelial dysfunction in the following experiments.

View larger version (31K): [in this window] [in a new window]   Figure 1. (A) Effects of 3 µM of dexamethasone (DEX) on substance P (0.1–30 nM)–induced relaxation in pulmonary arteries cultured under normoxic (20% O2) or hypoxic (5% O2) conditions for 7 days. (B) Effects of post-treatment with 3 µM of DEX on substance P (0.1–30 nM)–induced relaxation in pulmonary arteries cultured under hypoxic (5% O2) conditions. DEX (3 µM) was administered for the final 3 days of the 7-day hypoxic culture. Substance P was added after the 1-µM prostaglandin F2–induced contraction had reached a steady-state level. Results are expressed as the means ± SEM. **Significantly different from the normoxic arteries with P < 0.01. Significantly different from the hypoxic arteries with p < 0.01. PG = prostaglandin F2.

2

View larger version (26K): [in this window] [in a new window]   Figure 2. (A) Effects of 3 µM DEX on ionomycin (1–100 nM)-induced relaxation in pulmonary arteries cultured under normoxic or hypoxic conditions. Ionomycin was added after the 1-µM prostaglandin F2–induced contraction had reached a steady-state level. (B) Effects of 3 µM of DEX on NO dependency in substance P (10 nM)–induced relaxation in pulmonary arteries cultured under normoxic or hypoxic conditions. NG-monomethyl-L-arginine (L-NMMA) (200 µM), a nitric oxide synthase (NOS) inhibitor, was administered 30 minutes before the addition of prostaglandin F2. Results are expressed as the means ± SEM. *Significantly different from the normoxic arteries with p < 0.05. **Significantly different from the normoxic arteries with p < 0.01. Significantly different from the hypoxic arteries with p < 0.01.

2

2

Various stimuli activate eNOS through a PI3-kinase/Akt–dependent pathway (8, 11). In this study, treatment with a PI3-kinase inhibitor, wortmannin (10 µM), for 30 minutes attenuated substance P–induced relaxation (n = 5 each; data not shown), suggesting that PI3-kinase/Akt–dependent eNOS activation plays a role in substance P–induced NO generation in the pulmonary artery.

Smooth Muscle Contraction
In pulmonary arteries with endothelium cultured under normoxia or hypoxia for 7 days, the cumulative addition of prostaglandin F₂ (3 nM–10 µM) induced contractions with similar amplitudes in a concentration-dependent manner (n = 10 each; see Figure E1 in the online supplement). Chronic 3 µM of DEX treatment did not affect the prostaglandin F₂–induced contraction in either normoxic or hypoxic pulmonary arteries. These results suggest that chronic treatments with hypoxia and/or DEX do not change the myogenic contractile activity in the pulmonary artery.

Sodium Nitroprusside-induced Relaxation
In all of the pulmonary arteries without endothelium (i.e., those subjected to normoxia or hypoxia with or without DEX), sodium nitroprusside (1 nM–3 µM) caused vasorelaxation of the contractions elicited by 1 µM of prostaglandin F₂ in a concentration-dependent manner with similar potency (n = 5 each; see Figure E2 in the online supplement).

cGMP Content
In all of the arteries with endothelium with or without DEX under a normoxic or hypoxic condition, the cyclic guanosine monophosphate (cGMP) contents under the resting condition were roughly the same (n = 5 each; Figure 3). Sodium nitroprusside (1 µM) increased the cGMP content in all of the pulmonary arteries, and there were no significant differences under any condition (n = 5 each). In contrast, in the normoxic pulmonary arteries, the 2-minute treatment with substance P (10 nM) increased the cGMP content (n = 5), which was significantly greater than that in hypoxic pulmonary arteries. The chronic treatment with 3 µM of DEX recovered the 10-nM substance P–induced cGMP content in the hypoxic pulmonary arteries. However, in both the DEX-treated normoxic and hypoxic arteries, the substance P–induced cGMP contents were significantly smaller than that in the nontreated normoxic arteries.

View larger version (37K): [in this window] [in a new window]   Figure 3. Changes in cGMP content induced by substance P and sodium nitroprusside in pulmonary arteries cultured under normoxic (20% O2) or hypoxic (5% O2) conditions in the presence or absence of 3 µM of DEX for 7 days. Endothelium-intact pulmonary arteries were treated with 10 nM of substance P for 2 minutes, and endothelium-denuded pulmonary arteries were treated with 1 µM of sodium nitroprusside for 3 minutes. Results are expressed as the means ± SEM. **Significantly different from the normoxic arteries with p < 0.01. Significantly different from the hypoxic arteries with p < 0.05. SNP = sodium nitroprusside.

View larger version (59K): [in this window] [in a new window]   Figure 4. The effects of DEX on the increase in intracellular Ca2+ ([Ca2+]i) induced by 10 nM substance P in endothelial cells of hypoxic rat pulmonary arteries. Images of fluo-4-stained vascular endothelial cells were taken every 20 seconds. (A) Typical fluorescent images induced by 10 nM substance P before (–100 seconds) or after (5 and 200 seconds) the stimulation. (B) Summary of the results. Results are expressed as means ± SEM. After the substance P treatment, the results for the hypoxic arteries were significantly different from those for the normoxic arteries with p < 0.01. At 20 and 80 seconds after substance P treatment, the results for the DEX-treated hypoxic arteries were significantly different from those for the hypoxic arteries with p < 0.01.

View larger version (54K): [in this window] [in a new window]   Figure 5. Semiquantitative reverse transcription-polymerase chain reaction (PCR) for determination of endothelial NOS (eNOS) mRNA in endothelium-intact pulmonary arteries cultured under normoxic (20% O2) and hypoxic (5% O2) conditions in the presence or absence of 3 µM DEX for 7 days. (A) A typical trace of agarose–gel electrophoresis of reverse transcription-PCR products for eNOS and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) after 28–38 cycles of amplification. Total RNA was isolated from endothelium-intact normoxic or hypoxic pulmonary arteries. Agarose–gel electrophoresis demonstrated reverse transcription-PCR products of expected size corresponding to mRNA encoding eNOS (260 base pairs) and GAPDH (308 base pairs). (B) Quantitative data for the eNOS mRNA expression level (ratio of GAPDH) at 33 cycles of amplification. Results are expressed as the means ± SEM. *Significantly different from the normoxic arteries with p < 0.05. Significantly different from the hypoxic arteries with p < 0.05.

View larger version (40K): [in this window] [in a new window]   Figure 6. The eNOS protein expression (A and B) and Ser1177 phosphorylation of eNOS in endothelium-intact pulmonary arteries cultured under normoxic (20% O2) and hypoxic (5% O2) conditions in the presence or absence of 3 µM DEX for 7 days (A and C). Sixty micrograms of homogenate were loaded on sodium dodecyl sulfate-polyacrylamide gel electrophoresis and blotted using anti-eNOS antibody and anti-phospho-Ser1177 eNOS antibody; 1.0 represents the densitometric intensity of the -actin or total eNOS in each homogenate (B and C, respectively). Results are expressed as the means ± SEM. **and Significantly different from the normoxic or hypoxic arteries with p < 0.01, respectively.

View larger version (40K): [in this window] [in a new window]   Figure 7. The Akt protein expression (A and B) and phosphorylation of Akt in endothelium-intact pulmonary arteries cultured under normoxic (20% O2) and hypoxic (5% O2) conditions in the presence or absence of 3 µM DEX for 7 days (A and C). Sixty micrograms of homogenate were loaded on sodium dodecyl sulfate-polyacrylamide gel electrophoresis and blotted using anti-Akt antibody anti–phospho-Akt antibody; 1.0 represents the densitometric intensity of the -actin or total Akt in each homogenate (B and C, respectively). Results are expressed as the means ± SEM. **and Significantly different from the normoxic or hypoxic arteries with p < 0.01, respectively.

Localization of eNOS Protein in Endothelial Cells and Atrophy of Endothelial Cell Area
The localization of eNOS on the caveolae in the plasma membrane in endothelial cells is considered to be important for its activation (21). Figure 8A shows the immunohistochemical images demonstrating the intracellular localization of eNOS and eNOS inhibitory protein, caveolin-1, in the endothelium. eNOS was located on the plasma membrane in the normoxic control, hypoxic control, and normoxic DEX-treated and hypoxic DEX-treated pulmonary arteries. The endothelial cells were closely blocked together like cobblestones in the normoxic arteries. In the hypoxic arteries, however, many endothelial cells were shriveled, and the eNOS protein was condensed on the periphery of the cell membrane, as previously reported (13). Treatment with 3 µM of DEX restored these morphologic changes (n = 4 each).

View larger version (174K): [in this window] [in a new window]   Figure 8. (A) The effect of 3-µM DEX on the condensation of the eNOS protein on the periphery of the cell membrane in the hypoxic (5% O2) pulmonary endothelium in situ under whole-mount double staining. Antibodies recognizing eNOS (green) and caveolin-1 (red) were used. These figures are typical traces out of four experiments. Five-micrometer thick images from the endothelial cell surface were digitized under constant exposure time, gain, and offset. Bar = 20 µm. (B) The effect of 3 µM DEX on the atrophy of endothelial cells in the hypoxic (5% O2) pulmonary endothelium in situ under whole-mount staining. Endothelial cells were stained with a specific endothelial cell marker, 1,1'-dioctadecyl-3,3,3',3'-tetramethyl indocarbocyanine perchlorate. These figures are typical traces out of four experiments. Five-micrometer thick images from the endothelial cell surface were digitized under constant exposure time, gain, and offset. Bar = 5 µm. The area of each cell (including the nucleus without 1,1'-dioctadecyl-3,3,3',3'-tetramethyl indocarbocyanine perchlorate labeling) was measured using National Institutes of Health Image 1.55 software. Results are shown as the means ± SEM µm2/cell. **and Significantly different from the normoxic or hypoxic arteries with p < 0.01, respectively.

	DISCUSSION

TOP ABSTRACT METHODS RESULTS DISCUSSION REFERENCES

 
In these experiments, we found that the 3 µM DEX treatment prevented chronic hypoxia-induced endothelial dysfunction and endothelial morphologic changes and that DEX protected and facilitated the post-transcriptional eNOS activation pathway.

First, we found that DEX treatment improved the substance P–induced EDR in hypoxic pulmonary arteries. To investigate the mechanisms of this effect, we measured [Ca²⁺]_i under a substance P–stimulated condition and found that DEX completely prevented the decreased Ca²⁺ reaction induced by chronic hypoxia (Figure 4). DEX treatment prevented the impairments of EDR induced not only by receptor stimulation but also by the Ca²⁺ ionophore, ionomycin (Figures 1A and 2A). These results suggest that DEX may also inhibit the disturbance of signal transduction of eNOS activity after the Ca²⁺ increase in pulmonary artery endothelial cells after chronic hypoxia. eNOS is dynamically targeted to specialized cell-surface signal-transducing domains termed plasmalemmal caveolae to control the production of NO. Caveolin-1, an integral membrane protein that comprises a key structural component of caveolae, is known to interact with eNOS (22). We previously reported that chronic hypoxia (10% O_2, 1 week) induced the atrophy of endothelial cells, impairment of the [Ca²⁺]_i increase, and tight coupling between eNOS and caveolin-1, which in turn blocked such eNOS-activation processes as binding between eNOS and Ca²⁺-calmodulin, binding between eNOS and HSP90, and impairment of eNOS Ser¹¹⁷⁷ phosphorylation by serine/threonine kinase Akt in the rat pulmonary arterial endothelium (13). Furthermore, similar changes, such as atrophy of endothelial cells and condensation of eNOS into caveolae, were observed in the hypoxic organ-cultured pulmonary endothelium (14). From these results, we concluded that the hypoxic organ–culture model can recreate a functional disturbance of eNOS in pulmonary artery endothelial cells and is very useful to assess the effects of various agents on the hypoxia-induced impairment.

The actions of glucocorticoids are known to be mediated by alteration of the expression of specific target genes. We examined the effect of actinomycin D, a transcriptional inhibitor, on hypoxia-induced endothelial dysfunction and clarified that actinomycin D also partially restored the impairment of hypoxia-induced EDR (n = 4; data not shown). These results suggested that the expression of an as yet undetermined gene may contribute to the occurrence of hypoxia-induced endothelial impairment and that DEX may decrease the degree of impairment by inhibiting this gene expression. On the other hand, reverse transcription-PCR analysis indicated that DEX treatments increased eNOS mRNA expression (Figures 5A and 5B). The mechanisms by which DEX induces an increase in the eNOS mRNA level are unknown at present. Although there is no evidence for the existence of a glucocorticoid-responsive element in the promoter region of the eNOS gene, the increase in eNOS expression could result from the induction of other transcription factors acting on the promoter region of this isoform gene or from an increase in the eNOS mRNA stabilizer HSP90, which has been shown to interact with eNOS, resulting in a marked increase in eNOS mRNA stability and activity (23). More studies are needed to establish the molecular mechanism responsible for the induction of eNOS mRNA expression by DEX. Although an increase in eNOS mRNA expression was observed, 7-day treatment with DEX did not significantly increase eNOS protein expression (Figures 6A and 6B). A longer period of time may be required in order for the increase in eNOS to become obvious at the protein expression level. Several in vivo studies have reported an increase in eNOS expression induced by chronic hypoxia both at the mRNA and protein levels (24–26). In our previous study, however, chronic hypoxia itself did not change eNOS expression in the organ-cultured pulmonary artery. These findings suggest that increased shear stress and/or hemodynamic changes may be required for the upregulation of eNOS under a hypoxic condition in vivo.

As written previously here, at the post-transcriptional level for eNOS activity, efficient NO production requires the Ser¹¹⁷⁷ phosphorylation of eNOS (11, 12). We next examined the effects of DEX on eNOS Ser¹¹⁷⁷ and Akt phosphorylation and found that DEX treatments prevented the hypoxia-induced decreases in both the eNOS and Akt phosphorylations and even facilitated these phosphorylations in both normoxic and hypoxic pulmonary arteries (Figures 6A, 6C, 7A, and 7C). Limbourg and colleagues reported that glucocorticoid itself induces endothelial NO production, mediated by glucocorticoid receptor-dependent activation of the phosphatidylinositol 3-kinase/Akt pathway (27). It is important to note that the endothelial protective effects of glucocorticoid may be at least partially dependent on the nontranscriptional activation of eNOS through the phosphatidylinositol 3-kinase/Akt pathway.

In addition, our morphologic study revealed that DEX inhibited the hypoxia-induced atrophy of endothelial cells and eNOS protein condensation with caveolin-1 (Figures 8A and 8B). Because the cell membrane contains many functional facilities, including Ca²⁺ channel and caveolae, those are target of DEX's effects, and the protection of endothelial morphology against hypoxic stress may play an important role in the beneficial effects of DEX. Furthermore, these protective effects may occur via the regulation of several undefined genes. Further investigation is needed on this point.

We observed that cGMP production (Figure 3) and the NO dependency of EDR (Figure 2B) in the DEX-treated hypoxic and normoxic arteries were smaller than those in the nontreated normoxic arteries. However, DEX treatment increased eNOS phosphorylation and completely restored the hypoxia-induced endothelial dysfunction. The most characterized endothelial-derived relaxation factors are NO and prostacyclin, which cause smooth muscle relaxation by cGMP or cAMP accumulation to activate cGMP- or cAMP-dependent protein kinase, respectively (28, 29). However, an additional relaxant pathway that is resistant to inhibitors of cyclooxygenase and NOS and that is associated with smooth muscle endothelium-derived hyperpolarizing factor (30) also exists. The relative contribution of these three relaxation-factors in EDR depends on the kind of stimulator, the kind of vascular, and the animal species. In our preliminary experiments, we assessed the effect of organ culture on the ratio of the substance P–induced production of NO, prostacyclin, and endothelium-derived hyperpolarizing factor in rabbit pulmonary arteries using N^G-monomethyl-L-arginine and indomethacin. In the intact rabbit intrapulmonary artery, substance P–induced EDR was attributable 76.6% to NO and 23.4% to endothelium-derived hyperpolarizing factor production, whereas in the organ-cultured rabbit intrapulmonary artery, the EDR was attributable mainly (95.2%) to NO. Thus, a possible explanation for this result is that DEX treatment may also prevent the change of EDR factors induced by the organ–culture procedure.

Estradiol has been reported to have several endothelial protective effects, such as NO production (31) and increase in eNOS expression (32), which we similarly observed in the pulmonary endothelium treated with DEX. In fact, some steroids such as estradiol and dehydroepiandrosterone have been reported to have inhibitory effects on chronic hypoxia-induced pulmonary hypertension (33, 34). Based on these reports, these steroids are expected to have similar protective effects on the hypoxic organ-cultured endothelial impairment. To check this possibility, we examined the effects of 17-ß estradiol on hypoxia-induced endothelial impairment in organ-cultured pulmonary arteries (see Figure E3 in the online supplement) and found that estradiol significantly protected the hypoxia-induced endothelial impairment, but the beneficial effects were smaller than that of DEX. On the other hand, dehydroepiandrosterone has been reported to have direct effects on smooth muscle cells through potassium channel activation in pulmonary hypertensive rats (33). DEX may have direct effects on smooth muscle cell changes in pulmonary hypertension. A comparison of the different effects of these steroid treatments on the vascular bed may be important for the development of effective therapies, and further investigations are needed on this subject.

In summary, DEX was shown to have a significant inhibitory effect on hypoxia-induced pulmonary endothelial dysfunction without side effects on smooth muscle, and its beneficial effects, such as the increase in eNOS mRNA expression, the direct eNOS activation, and the protection of morphologic changes that impair efficient activation of the eNOS–NO pathway, all contribute to this response. These results suggested that DEX could be a potential therapeutic agent for the treatment of patients with pulmonary hypertension.

	FOOTNOTES

 
Supported partly by a Grant-in-Aid for Scientific Research from the Ministry of Education of Japan and by research fellowships from the Japan Society for the Promotion of Science for Young Scientists.

This article has an online supplement, which is accessible from this issue's table of contents online at www.atsjournals.org

Conflict of Interest Statement: T.M. does not have a financial relationship with a commercial entity that has an interest in the subject of this article; M.H. does not have a financial relationship with a commercial entity that has an interest in the subject of this article; K.S. does not have a financial relationship with a commercial entity that has an interest in the subject of this article; H.K. does not have a financial relationship with a commercial entity that has an interest in the subject of this article; H.O. does not have a financial relationship with a commercial entity that has an interest in the subject of this article.

Received in original form September 23, 2003; accepted in final form May 28, 2004

	REFERENCES

TOP ABSTRACT METHODS RESULTS DISCUSSION REFERENCES

 

1. Hampl V, Herget J. Role of nitric oxide in the pathogenesis of chronic pulmonary hypertension. Physiol Rev 2000;80:1337–1372.[Abstract/Free Full Text]
2. Xue C, Johns RA. Endothelial nitric oxide synthase in the lungs of patients with pulmonary hypertension. N Engl J Med 1995;333:1642–1644.[Free Full Text]
3. Tobin MJ. Chronic obstructive pulmonary disease, pollution, pulmonary vascular disease, transplantation, pleural disease, and lung cancer in AJRCCM 2003. Am J Respir Crit Care Med 2004;169:301–313.[Free Full Text]
4. Ghofrani HA, Schermuly RT, Rose F, Wiedemann R, Kohstall MG, Kreckel A, Olschewski H, Weissmann N, Enke B, Ghofrani S, et al. Sildenafil for long-term treatment of nonoperable chronic thromboembolic pulmonary hypertension. Am J Respir Crit Care Med 2003;167:1139–1141.[Abstract/Free Full Text]
5. Kuhn KP, Byrne DW, Arbogast PG, Doyle TP, Loyd JE, Robbins IM. Outcome in 91 consecutive patients with pulmonary arterial hypertension receiving epoprostenol. Am J Respir Crit Care Med 2003;167:580–586.[Abstract/Free Full Text]
6. Rudic RD, Shesely EG, Maeda N, Smithies O, Segal SS, Sessa WC. Direct evidence for the importance of endothelium-derived nitric oxide in vascular remodeling. J Clin Invest 1998;101:731–736.[Medline]
7. Maeda Y, Ikeda U, Oya K, Shimpo M, Ueno S, Okada K, Saito T, Mano H, Ozawa K, Shimada K. Endogenously generated nitric oxide by nitric-oxide synthase gene transfer inhibits cellular proliferation. J Pharmacol Exp Ther 2000;292:387–393.[Abstract/Free Full Text]
8. Govers R, Rabelink TJ. Cellular regulation of endothelial nitric oxide synthase. Am J Physiol Renal Physiol 2001;280:F193–F206.[Abstract/Free Full Text]
9. Sessa WC, Garcia-Cardena G, Liu J, Keh A, Pollock JS, Bradley J, Thiru S, Braverman IM, Desai KM. The Golgi association of endothelial nitric oxide synthase is necessary for the efficient synthesis of nitric oxide. J Biol Chem 1995;270:17641–17644.[Abstract/Free Full Text]
10. Gratton JP, Fontana J, O'Connor DS, Garcia-Cardena G, McCabe TJ, Sessa WC. Reconstitution of an endothelial nitric-oxide synthase (eNOS), hsp90, and caveolin-1 complex in vitro: evidence that hsp90 facilitates calmodulin stimulated displacement of eNOS from caveolin-1. J Biol Chem 2000;275:22268–22272.[Abstract/Free Full Text]
11. Fulton D, Gratton JP, McCabe TJ, Fontana J, Fujio Y, Walsh K, Franke TF, Papapetropoulos A, Sessa WC. Regulation of endothelium-derived nitric oxide production by the protein kinase Akt. Nature 1999;399:597–601.[CrossRef][Medline]
12. Fleming I, Fisslthaler B, Dimmeler S, Kemp BE, Busse R. Phosphorylation of Thr(495) regulates Ca(2+)/calmodulin-dependent endothelial nitric oxide synthase activity. Circ Res 2001;88:E68–E75.
13. Murata T, Sato K, Hori M, Ozaki H, Karaki H. Decreased endothelial nitric-oxide synthase (eNOS) activity resulting from abnormal interaction between eNOS and its regulatory proteins in hypoxia-induced pulmonary hypertension. J Biol Chem 2002;277:44085–44092.[Abstract/Free Full Text]
14. Murata T, Yamawaki H, Hori M, Sato K, Ozaki H, Karaki H. Hypoxia impairs endothelium-dependent relaxation in organ cultured pulmonary artery. Eur J Pharmacol 2001;421:45–53.[CrossRef][Medline]
15. Wang Y, Zhang L, Shen W, Chen L, Fan S. Interrelation between nitric oxide and endothelin-1 in an experimental acute hypoxia in rats and its intervention. Chin Med J (Engl) 1999;112:363–365.
16. Hollenberg SM, Weinberger C, Ong ES, Cerelli G, Oro A, Lebo R, Thompson EB, Rosenfeld MG, Evans RM. Primary structure and expression of a functional human glucocorticoid receptor cDNA. Nature 1985;318:635–641.[CrossRef][Medline]
17. Messmer UK, Winkel G, Briner VA, Pfeilschifter J. Glucocorticoids potently block tumour necrosis factor-alpha- and lipopolysaccharide-induced apoptotic cell death in bovine glomerular endothelial cells upstream of caspase 3 activation. Br J Pharmacol 1999;127:1633–1640.[CrossRef][Medline]
18. Suzuki Y, Nishio K, Takeshita K, Takeuchi O, Watanabe K, Sato N, Naoki K, Kudo H, Aoki T, Yamaguchi K. Effect of steroid on hyperoxia-induced ICAM-1 expression in pulmonary endothelial cells. Am J Physiol Lung Cell Mol Physiol 2000;278:L245–L252.[Abstract/Free Full Text]
19. Wheller SK, Perretti M. Dexamethasone inhibits cytokine-induced intercellular adhesion molecule- 1 up-regulation on endothelial cell lines. Eur J Pharmacol 1997;331:65–71.[CrossRef][Medline]
20. Murata T, Yamawaki H, Yoshimoto R, Hori M, Sato K, Ozaki H, Karaki H. Chronic effect of doxorubicin on vascular endothelium assessed by organ culture study. Life Sci 2001;69:2685–2695.[CrossRef][Medline]
21. Michel JB, Feron O, Sacks D, Michel T. Reciprocal regulation of endothelial nitric-oxide synthase by Ca²⁺-calmodulin and caveolin. J Biol Chem 1997;272:15583–15586.[Abstract/Free Full Text]
22. Garcia-Cardena G, Oh P, Liu J, Schnitzer JE, Sessa WC. Targeting of nitric oxide synthase to endothelial cell caveolae via palmitoylation: implications for nitric oxide signaling. Proc Natl Acad Sci USA 1996;93:6448–6453.[Abstract/Free Full Text]
23. Garcia-Cardena G, Fan R, Shah V, Sorrentino R, Cirino G, Papapetropoulos A, Sessa WC. Dynamic activation of endothelial nitric oxide synthase by Hsp90. Nature 1998;392:821–824.[CrossRef][Medline]
24. Shirai M, Pearson JT, Shimouchi A, Nagaya N, Tsuchimochi H, Ninomiya I, Mori H. Changes in functional and histological distributions of nitric oxide synthase caused by chronic hypoxia in rat small pulmonary arteries. Br J Pharmacol 2003;139:899–910.[CrossRef][Medline]
25. Le Cras TD, Xue C, Rengasamy A, Johns RA. Chronic hypoxia upregulates endothelial and inducible NO synthase gene and protein expression in rat lung. Am J Physiol 1996;270:L164–L170.
26. Shaul PW, North AJ, Brannon TS, Ujiie K, Wells LB, Nisen PA, Lowenstein CJ, Snyder SH, Star RA. Prolonged in vivo hypoxia enhances nitric oxide synthase type I and type III gene expression in adult rat lung. Am J Respir Cell Mol Biol 1995;13:167–174.[Abstract]
27. Limbourg FP, Huang Z, Plumier JC, Simoncini T, Fujioka M, Tuckermann J, Schutz G, Moskowitz MA, Liao JK. Rapid nontranscriptional activation of endothelial nitric oxide synthase mediates increased cerebral blood flow and stroke protection by corticosteroids. J Clin Invest 2002;110:1729–1738.[CrossRef][Medline]
28. Gruetter CA, Gruetter DY, Lyon JE, Kadowitz PJ, Ignarro LJ. Relationship between cyclic guanosine 3':5'-monophosphate formation and relaxation of coronary arterial smooth muscle by glyceryl trinitrate, nitroprusside, nitrite and nitric oxide: effects of methylene blue and methemoglobin. J Pharmacol Exp Ther 1981;219:181–186.[Abstract/Free Full Text]
29. Moore TM, Chetham PM, Kelly JJ, Stevens T. Signal transduction and regulation of lung endothelial cell permeability. Interaction between calcium and cAMP. Am J Physiol 1998;275:L203–L222.
30. Busse R, Edwards G, Feletou M, Fleming I, Vanhoutte PM, Weston AH. EDHF: bringing the concepts together. Trends Pharmacol Sci 2002;23:374–380.[CrossRef][Medline]
31. Kirsch EA, Yuhanna IS, Chen Z, German Z, Sherman TS, Shaul PW. Estrogen acutely stimulates endothelial nitric oxide synthase in H441 human airway epithelial cells. Am J Respir Cell Mol Biol 1999;20:658–666.[Abstract/Free Full Text]
32. MacRitchie AN, Jun SS, Chen Z, German Z, Yuhanna IS, Sherman TS, Shaul PW. Estrogen upregulates endothelial nitric oxide synthase gene expression in fetal pulmonary artery endothelium. Circ Res 1997;81:355–362.[Abstract/Free Full Text]
33. Bonnet S, Dumas-de-La-Roque E, Begueret H, Marthan R, Fayon M, Dos Santos P, Savineau JP, Baulieu EE. Dehydroepiandrosterone (DHEA) prevents and reverses chronic hypoxic pulmonary hypertension. Proc Natl Acad Sci USA 2003;100:9488–9493.[Abstract/Free Full Text]
34. Resta TC, Kanagy NL, Walker BR. Estradiol-induced attenuation of pulmonary hypertension is not associated with altered eNOS expression. Am J Physiol Lung Cell Mol Physiol 2001;280:L88–L97.[Abstract/Free Full Text]

This article has been cited by other articles:

				M. Fischler, M. Maggiorini, L. Dorschner, J. Debrunner, A. Bernheim, S. Kiencke, H. Mairbaurl, K. E. Bloch, R. Naeije, and H. P. B.-L. Rocca Dexamethasone But Not Tadalafil Improves Exercise Capacity in Adults Prone to High-Altitude Pulmonary Edema Am. J. Respir. Crit. Care Med., August 15, 2009; 180(4): 346 - 352. [Abstract] [Full Text] [PDF]

				R. B. Schoene Illnesses at High Altitude Chest, August 1, 2008; 134(2): 402 - 416. [Abstract] [Full Text] [PDF]

				B. A. Kaufmann, A. M. Bernheim, S. Kiencke, M. Fischler, J. Sklenar, H. Mairbaurl, M. Maggiorini, and H. P. Brunner-La Rocca Evidence supportive of impaired myocardial blood flow reserve at high altitude in subjects developing high-altitude pulmonary edema Am J Physiol Heart Circ Physiol, April 1, 2008; 294(4): H1651 - H1657. [Abstract] [Full Text] [PDF]

				M. Maggiorini, H.-P. Brunner-La Rocca, S. Peth, M. Fischler, T. Bohm, A. Bernheim, S. Kiencke, K. E. Bloch, C. Dehnert, R. Naeije, et al. Both tadalafil and dexamethasone may reduce the incidence of high-altitude pulmonary edema: a randomized trial. Ann Intern Med, October 3, 2006; 145(7): 497 - 506. [Abstract] [Full Text] [PDF]

				E. R. Swenson Hypoxic lung whiteout: further clearing but more questions from on high. Ann Intern Med, October 3, 2006; 145(7): 550 - 552. [Full Text] [PDF]

				M. Maggiorini High altitude-induced pulmonary oedema Cardiovasc Res, October 1, 2006; 72(1): 41 - 50. [Abstract] [Full Text] [PDF]

				T. Murata, K. Kinoshita, M. Hori, M. Kuwahara, H. Tsubone, H. Karaki, and H. Ozaki Statin Protects Endothelial Nitric Oxide Synthase Activity in Hypoxia-Induced Pulmonary Hypertension Arterioscler Thromb Vasc Biol, November 1, 2005; 25(11): 2335 - 2342. [Abstract] [Full Text] [PDF]

				T. D. Bradley, Y. E. Miller, F. J. Martinez, D. C. Angus, W. MacNee, and E. Abraham Interstitial Lung Disease, Lung Cancer, Lung Transplantation, Pulmonary Vascular Disorders, and Sleep-disordered Breathing in AJRCCM in 2004 Am. J. Respir. Crit. Care Med., April 1, 2005; 171(7): 675 - 685. [Full Text] [PDF]

				P. Bartsch, H. Mairbaurl, M. Maggiorini, and E. R. Swenson Physiological aspects of high-altitude pulmonary edema J Appl Physiol, March 1, 2005; 98(3): 1101 - 1110. [Abstract] [Full Text] [PDF]

This Article Abstract Full Text (PDF) Online Supplement All Versions of this Article: 200309-1311OCv1 170/6/647    most recent Alert me when this article is cited Alert me if a correction is posted Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Murata, T. Articles by Ozaki, H. Search for Related Content PubMed PubMed Citation Articles by Murata, T. Articles by Ozaki, H.