help button home button
AJRCCM
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

Published ahead of print on June 7, 2004, doi:10.1164/rccm.200311-1607OC
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
200311-1607OCv1
170/6/633    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Zhou, H.
Right arrow Articles by Visner, G. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Zhou, H.
Right arrow Articles by Visner, G. A.
American Journal of Respiratory and Critical Care Medicine Vol 170. pp. 633-640, (2004)
© 2004 American Thoracic Society


Original Article

Heme Oxygenase-1 Expression in Human Lungs with Cystic Fibrosis and Cytoprotective Effects against Pseudomonas Aeruginosa In Vitro

Hailan Zhou, Fuhua Lu, Christopher Latham, Dani S. Zander and Gary A. Visner

Departments of Pediatrics, University of Florida, Gainesville, Florida; and Department of Pathology, University of Texas Medical School at Houston, Houston, Texas

Correspondence and requests for reprints should be addressed to Gary A. Visner, D.O., University of Florida, Department of Pediatrics, P.O. Box 100296, Gainesville, FL 32610. E-mail: visnega{at}peds.ufl.edu


    ABSTRACT
 TOP
 ABSTRACT
 METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Inflammation and oxidative stress play important roles in cystic fibrosis (CF) lung disease. Inflammatory/oxidant-mediated induction of heme oxygenase-1 (HO-1) is believed to be a cytoprotective response. This study examined HO-1 expression in lung samples from patients with CF using immunohistochemistry and quantitative reverse transcription-polymerase chain reaction. In addition, we evaluated myeloperoxidase staining as a marker of acute inflammation and potentially an increase in oxidant stress and Prussian blue and ferritin staining to assess iron status of the lung. Macrophage HO-1 staining was increased in diseased lungs as compared with normal control subjects and correlated with myeloperoxidase staining. Quantitative reverse transcription-polymerase chain reaction further supported an increase in HO-1 expression in CF lung disease. Although iron staining was minimal, ferritin staining was increased in diseased lungs in concert with HO-1 staining. To determine whether HO-1 induction was cytoprotective, we evaluated a CF airway epithelial cell line, IB3.1, in response to Pseudomonas aeruginosa–induced injury/apoptosis in cells overexpressing HO-1 by either transient or stable transfection of pcDNA3.1/HO-1 construct. Overexpression of HO-1 resulted in protection against P. aeruginosa–induced injury/apoptosis. This suggests that the induction of HO-1 in patients with CF is a cytoprotective event and that augmenting its expression is a potential therapy against bacterial injury.

Key Words: chronic airway disease • heme oxygenase-1 • inflammation • oxidative stress • Pseudomonas aeruginosa

Cystic fibrosis (CF) is an autosomal recessive disorder that is caused by mutations of the CF transmembrane regulator gene. The defect leads to a dysfunction in epithelial chloride and water transport, increased mucus viscosity, decreased clearance of secretions, and airway defense mechanism resulting in chronic lung infection (1). Consequently, inflammatory cells are recruited in response to the infection leading to a state of chronic airway inflammation (2). Increased production of oxidants is a feature of chronic inflammatory lung diseases and is believed to contribute to the genesis of lung injury in CF (35). The cellular effects of oxidant stress are modulated by synthesis of proteins that have protective properties. Stress response protein-32, also known as heme oxygenase-1 (HO-1) (6), is one such protein that is induced by cytokines and oxidant stress (7), and its functions appear to ameliorate oxidative cellular injury (8).

The biological importance of HO stems from its function as the initial and rate-limiting enzyme in heme catabolism, in which it catalyzes the oxidative cleavage of heme molecules to equal moles of biliverdin, free iron, and carbon monoxide (CO) (6). There are three HO isoforms: HO-1, HO-2, and HO-3. HO-2 and HO-3, which is very similar to HO-2, are constitutively expressed, whereas HO-1 is inducible in response to reactive oxygen species, endotoxin, and proinflammatory cytokines (6, 9, 10). HO-1 and HO-2 are antigenically distinct, and their respective antisera do not cross-react, whereas less is known about recently described HO-3 (11).

Knowledge about the functions of HO-1 has come from investigations using animal models of inflammation, cell cultures, and genetically deficient mice and humans. Mice with a targeted disruption of HO-1 appear to exist in a state of chronic inflammation (12, 13). A well studied HO-1–deficient human demonstrated multiple abnormalities, including growth retardation, anemia, abnormal iron metabolism with increased iron deposition, and enhanced vulnerability to oxidant damage during stress (14). In a model of pleural space inflammation, inhibition of HO-1 worsened inflammation, whereas increasing HO-1 activity suppressed the inflammatory response (15). HO-1 inhibition also resulted in a loss of endotoxin-induced protection against oxidant injury in vascular smooth muscle cells (10).

CF is a disease in which airway inflammation is believed to play a crucial role in the pathophysiology of airway injury (1, 2). Because HO-1 appears to mitigate against inflammatory/oxidant-mediated injury, this study was performed to assess the relationship of HO-1 to the airway injury characteristic of this disease. Cellular HO-1 expression was evaluated by immunohistochemistry in human lungs with CF. Myeloperoxidase staining was used to measure neutrophil infiltration. Because cellular iron status is influenced by HO-1 activity and iron availability contributes to the oxidative environment, Prussian blue staining for iron and immunohistochemistry for ferritin were performed to assess the abundance of these substances.

Pseudomonas aeruginosa (P.a.) is a gram-negative facultative opportunistic pathogen that chronically infects airways of patients with CF, leading to bronchiectasis that eventually becomes incompatible with life. Infection of mammalian cells with P.a. has been shown to result in the internalization of P.a. and triggers apoptotic or necrotic death of the infected cells (1619). HO-1 overexpression protects airway epithelial cells, endothelial cells, and pancreatic ß cells from injury and apoptosis (8, 20, 21). To determine whether HO-1 induction in CF lung disease is potentially cytoprotective, a CF airway epithelial cell line, IB3.1, with enhanced HO-1 expression, was evaluated for apoptosis in response to P.a. exposure.


    METHODS
 TOP
 ABSTRACT
 METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Samples, Staining, and Morphologic Evaluation
Samples included sections from pneumonectomies, wedge resections, and transbronchial biopsies of lung from patients with CF (n = 12) and normal lung tissue from lung resections for cancer (n = 6) (Table 1). Lung samples were obtained from patients with CF at a time that they were relatively stable or after antibiotic treatment. Immunohistochemical staining was performed on a Ventana (Ventana Medical Systems, Inc., Tucson, AZ) immunostainer as previously described using a polyclonal rabbit anti–HO-1 antibody (SPA-895; StressGen Biotechnologies Corp., Victoria, BC, Canada) (22), polyclonal rabbit anti-human myeloperoxidase antibody (23) (Ventana Medical Systems, Inc.), and polyclonal rabbit anti-human ferritin antibody (24) (Dako, Carpinteria, CA). Positive and negative control slides were included with each staining run.


View this table:
[in this window]
[in a new window]
 
TABLE 1. Demographic, clinical, and diagnostic information

 
Cell types expressing HO-1 were assessed morphologically. In addition, to confirm that cells in alveoli were macrophages and not pneumocytes, double immunohistochemical staining using anti–HO-1 and mouse anti-human CD68 (clone KP1; Dako) was performed in 10 samples. The number of HO-1 or ferritin-stained alveolar macrophages was counted in 20 high-power fields or the maximum number available for examination (if less than 20). Staining of respiratory epithelium, type II pneumocytes, endothelium, myofibroblasts, and smooth muscle cells was graded as none, focal, patchy, or diffuse, and myeloperoxidase staining was assessed as none, intravascular only (+1), and extravascular focal, patchy, or diffuse (+2 to +4).

Quantitative Reverse Transcription-Polymerase Chain Reaction Protocol
A semiquantitative reverse transcription-polymerase chain reaction (RT-PCR) protocol (TaqMan RT-PCR; PE Applied Biosystems, Foster City, CA) was used to evaluate HO-1 mRNA expression from formalin-fixed tissue (25, 26) with 18s rRNA used as the control. The procedure was performed using ABI Prism 7,700 Sequence Detection System through the Institutional Core Biomedical Research of the University of Florida. The reverse transcriptase reaction was performed using 500 ng of the isolated RNA according to manufacturer guidelines (TaqMan RT-PCR Master Mix Reagents; PE Applied Biosystems). The primers and probe for HO-1 mRNA were designed as following: forward primer, GCCCTTCAGCATCCTCAGTTC; reverse primer, GTTTGAGACAGCTGCCACAT; and TaqMan probe, TGCAGCAGAGCCTGGAAGACACCCT. The primers and probe for 18s rRNA were purchased from PE Applied Biosystems, and reactions were performed according to instructions.

Cell Cultures, HO-1 Overexpression, and Western Analysis
Human CF bronchial epithelial cell line (IB3.1) ({Delta}F508/ W1282X) was a generous gift from Dr. Terence Flotte, University of Florida. IB3.1 cells were cultured in Lechner and LaVeck (LHC)-8 (Biofluids, Rockville, MD) medium supplemented with 10% fetal bovine serum (Invitrogen Corp., Carlsbad, CA). Human HO-1 cDNA 1.0 kb was cloned into pcDNA3.1/zeo(+) (Invitrogen) as previously described (27). Either pcDNA3.1/zeo(+)/HO-1 or empty vector were transfected into IB3.1 using the Lipofectamine-2000 (Invitrogen). Stable HO-1 or empty vector cell lines were selected by Zeocin 15 µg/ml. HO-1, cyclooxygenase-2 (COX-2), and interleukin-10 (IL-10) proteins levels were evaluated by Western analysis using a 1:1,000 dilution of the rabbit anti–HO-1 antibody (StressGen) (27), 1:100 goat anti–COX-2 antibody (Santa Cruz Biotechnology, Santa Cruz, CA), and 1:1000 rat anti–IL-10 antibody (BD Sciences Pharmingen, San Diego, CA).

Bacterial Infection Experiments and Measurement of Apoptosis
A P.a. lab strain called PAK (gift from Dr. Shouguan Jin, University of Florida) was grown to midlogarithmic phase and resuspended in LHC-8 medium without gentamicin (28); 4 x105 IB3.1 cells were grown for 2 days, washed with phosphate-buffered saline, and exposed to PAK at 20:1 (PAK:cell). PAK was killed by adding 50-µg/ml amikacin. After treatment, cells were harvested for annexin V–FITC/propidium iodide binding (BD Sciences Pharmingen) and measured by flow cytometry according to the manufacturer's protocol. Early apoptosis was measured by annexin V, whereas late apoptosis/necrosis was by annexin V and propidium iodide staining. Caspase-3 activity was determined according to manufacturer's protocol (EnzChek Caspase-3 Assay Kit #2; Molecular Probes, Eugene, OR).

Statistical Analysis
Data were expressed as mean ± SEM. Wilcoxon rank sum tests were used to compare staining for individual cell types between CF and control groups. The Spearman rank correlation coefficient was calculated to assess the correlation between HO-1 and ferritin staining. Unpaired t test was used to compare HO-1 mRNA expression from normal and CF lungs. In vitro experiments were repeated at least three times or more, and analysis of variance with Tukey-Kramer Multiple Comparisons Test used to compare the differences between treatment groups. A value of p < 0.05 was considered to be statistically significant.


    RESULTS
 TOP
 ABSTRACT
 METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Information about patient demographic characteristics and FEV1 is provided in Table 1. The majority of the human lung samples came from patients with advanced CF who were undergoing lung transplantation, accounting for the relatively low FEV1 values seen in many of these patients. Eight samples were obtained from native lungs with advanced CF, excised at the time of lung transplantation. Four patients with CF had wedge or transbronchial biopsies because of a progressive decline in pulmonary function despite several weeks of antibiotic therapy appropriate for bacterial culture sensitivities. All patients had positive cultures for P.a. except one, and there were no positive cultures for Burkholderia cepacia isolated in these patients. Lung biopsy in two of these patients showed organizing pneumonia, probably representing the residuum of acute bronchopneumonia, a third biopsy demonstrated Nocardia colonizing a bronchus, and the last biopsy was consistent with CF, although there were fewer inflammatory cells than expected. The last four patients' pulmonary function status was better (FEV1 > 45%) than the lung transplant recipients (FEV1 < 25%).

Immunohistochemical staining for HO-1 performed on these lung samples demonstrated cytoplasmic staining of macrophages, respiratory epithelial cells, type II pneumocytes, myofibroblasts, endothelial cells, and airway smooth muscle cells (Figures 1 and 2). Staining intensity in the macrophages substantially exceeded that observed in other cell types. The number of HO-1–stained alveolar macrophages in the advanced CF group significantly exceeded that of the normal control group (p < 0.05) and was higher than that observed in the less advanced CF group. Double staining of the macrophages with KP-1 and HO-1 (macrophage marker) confirmed that nearly all macrophages stained for HO-1, and therefore, the increase in the number of HO-1–stained macrophages reflects an increase in the number of macrophages present. The more severe CF samples also showed more intense macrophage HO-1 staining (Figure 1E), suggesting that HO-1 expression in individual cells was also increased.



View larger version (65K):
[in this window]
[in a new window]
 
Figure 1. (A) Normal alveolar parenchyma: alveoli contain small numbers of macrophages (arrow) with weak or moderate cytoplasmic heme oxygenase-1 (HO-1) staining (original magnification x400). (B) Cystic fibrosis (CF) alveolar parenchyma: Macrophages (arrows) stain intensely for HO-1. Reactive type II pneumocytes (arrowheads) and endothelial cells (<) also demonstrate HO-1 staining that is slightly less intense (original magnification x400). (C) Normal bronchus: the bronchial epithelium (arrow) and smooth muscle (*) demonstrate very weak HO-1 staining (original magnification x400). (D) CF bronchus: moderate staining for HO-1 is present in bronchial epithelium (arrow). Reactive type II pneumocytes (arrowhead) and lymphocytes show weaker HO-1 staining (original magnification x400). (E) Alveolar macrophage HO-1 staining in diagnostic groups: normal, FEV1 less than 25% and FEV1 more than 45% (*p < 0.05 for total number of HO-1 stained and grade 2–3 HO-1–stained macrophages compared with normal lungs).

 


View larger version (14K):
[in this window]
[in a new window]
 
Figure 2. (A) HO-1 staining patterns in individual cell types (none = 0; focal = 1; patchy = 2; and diffuse = 3). RE = respiratory epithelium; Endo = endothelium; Type II = type II pneumocytes; SMC = smooth muscle cells. *p < 0.05 CF compared with normal lungs. (B) Comparison of HO-1 mRNA levels in diagnostic groups based on quantitative reverse transcription-polymerase chain reaction (RT-PCR) (p < 0.05).

 
In addition to the macrophage results, evaluation of other cell types revealed a noticeable difference in type II pneumocytes in CF (p < 0.05) (Figure 2A). Alveolar extension of the inflammatory process is probably the trigger for the increased type II pneumocyte HO-1 expression in CF. Conversely, we observed no differences in the extensiveness of respiratory epithelial cells, smooth muscle cells, and endothelial cells HO-1 staining between the two groups.

A semiquantitative RT-PCR technique was used as another measure of HO-1 expression. RNA was isolated from paraffin-embedded formalin-fixed tissue, and HO-1 mRNA and 18s rRNA relative values were determined using Taqman RT-PCR. Assay of 12 samples (five control subjects and seven samples with CF) resulted in values in which the HO-1 and 18s rRNA RT-PCR products were within the linear range of their respective standard curves, and therefore, a ratio of HO-1 to 18s rRNA could be determined. HO-1 mRNA expression was increased in the disease state (CF) as compared with normal (p < 0.05) (Figure 2B).

Myeloperoxidase staining was used as a marker for neutrophil infiltration. Some weak macrophage staining was also observed, probably representing phagocytized myeloperoxidase-containing material (29). Not surprisingly, in CF, myeloperoxidase staining was heaviest in areas of severe airway inflammation (Figure 3), and in general, these regions had the most intense HO-1 staining. In control samples, there was relatively little myeloperoxidase staining (mostly +1 [intravascular only]) as compared with CF samples. Myeloperoxidase staining also correlated with HO-1 staining in macrophages (p < 0.05) (Figure 3C).



View larger version (41K):
[in this window]
[in a new window]
 
Figure 3. (A) Bronchiectasis due to CF: Myeloperoxidase staining (brown) in numerous luminal neutrophils and scattered neutrophils infiltrating the bronchial wall (original magnification x200). (B) Myeloperoxidase staining in diagnostic groups (none = 0, intravascular neutrophils = 1, focal = 2, patchy = 3, diffuse = 4). *p < 0.05 as compared with normal lungs. (C) Correlation of macrophage HO-1 staining and myeloperoxidase staining. Spearman rank correlation coefficient: 0.663 (p = 0.002).

 
Cellular iron stores and ferritin were also evaluated. Using the Prussian blue stain, cellular iron stores appeared minimal in both diagnostic groups, with few macrophages staining for iron. Ferritin staining was mainly in macrophages (Figure 4A). The number of macrophages staining for the iron storage protein, ferritin, was increased in patients with CF as compared with normal subjects (p < 0.05) (Figure 4B), and the number of ferritin-stained macrophages correlated with the amount of HO-1 staining (Figure 4C).



View larger version (38K):
[in this window]
[in a new window]
 
Figure 4. (A) This is an example illustrating ferritin staining (brown) in alveolar macrophages from a CF lung sample (original magnification x200). (B) Ferritin staining in alveolar macrophages in normal and CF lungs (p < 0.01). (C) Comparison of the numbers of HO-1–stained and ferritin-stained alveolar macrophages/x400. The correlation coefficient (r) = 0.9585 (p < 0.0001).

 
To determine whether HO-1 may be a cytoprotective protein in CF lung disease, cell culture studies using airway epithelial cells derived from a patient with CF, IB3.1, were performed. To determine whether the increase in HO-1 expression was in response to bacterial exposure or from one of its products such as lipopolysaccharide (LPS), cells were exposed to either LPS or P.a. HO-1 was induced by hemin, a known stimulus of HO-1, but neither LPS nor P.a. exposure resulted in an increase in HO-1 protein levels (Figure 5A). Both LPS and P.a. increased HO-1 protein expression in RAW264.7 (mice monocyte-like cell line) (Figure 5B) as other authors reported (30).



View larger version (36K):
[in this window]
[in a new window]
 
Figure 5. (A) Western analysis of HO-1 in IB3.1 cells exposed to 5-µM hemin, basal levels (control), stable cell line transfected with the empty pcDNA3.1 vector (Empty vector), stable cell line transfected with pcDNA3.1/HO-1 (HO-1 vector), cells exposed to 0.1 or 1.0 µg/ml of LPS for 24 hours, or cells exposed to P.a. strain (PAK) for 1 or 2 hours and protein isolated after 24 hours. (B) Western analysis of HO-1 in RAW 264 cells control cells, exposed to PAK for 1 or 2 hours and protein isolated after 24 hours, LPS (0.1 and 1.0 µg/ml), or 5-µM hemin. (C) Annexin V staining of either stable IB3.1 cell lines transfected with either the empty pcDNA3.1 (V) vector or pcDNA3.1/HO-1 (HO-1) and exposed to PAK for 1 or 2 hours or untreated (C). *p < 0.001 empty vector compared with HO-1 vector exposed to PAK for 1 hour; +p < 0.05 empty vector compared with HO-1 vector exposed to PAK for 2 hours. (D) Annexin V plus propidium iodide staining of stable IB3.1 cell lines (empty vector or HO-1 vector) exposed to PAK for 1 or 2 hours. *p < 0.01 empty vector compared with HO-1 vector exposed to PAK for 1 hour. +p < 0.05 empty vector compared with HO-1 vector exposed to PAK for 2 hours. (E) Caspase 3 activity of stable IB3.1 cells, empty (V) or HO-1 (H) vector, untreated (C) no PAK or exposed to PAK (P) for 1 hour and caspase 3 activity evaluated at 24 hours. (F) Caspase 3 activity of stable IB3.1 cells, empty (V) or HO-1 (H) vector, untreated (C) no PAK or exposed to PAK (P) for 2 hours and caspase 3 activity evaluated at 6 hours.

 
Survival of IB3.1 cells overexpressing HO-1 was next evaluated in response to P.a. The initial studies used a transient transfection protocol using a pcDNA3.1 empty vector or pcDNA3.1/HO-1 vector cotransfected with pcDNA3.1 vector containing ß-gal as a marker. Evaluation was based on the number of ß-gal–expressing cells. Treatment with the HO-1 vector nearly doubled the ß-gal expression (63%) as compared with control cells treated with ß-gal vector only (38%) or those with ß-gal and the empty pcDNA3.1 vector (37%) (Table 2), indicating improved survival of IB3.1 cells with HO-1 overexpression.


View this table:
[in this window]
[in a new window]
 
TABLE 2. Average percentage of ß-gal–positive cells/pak/ß-gal cells (three separate repetitions for each experiment)

 
To alleviate the problems inherent to transient transfection, stable IB3.1 cell lines containing the empty vector or pcDNA-HO-1 (HO-1/IB3.1) were generated and evaluated in response to P.a. (PAK). Figure 5A illustrates a Western analysis showing an increase in HO-1 protein levels in HO-1/IB3.1 cells. Both control and HO-1/IB3.1 cells exposed to PAK for 1 or 2 hours showed increased apoptosis/injury, as measured by annexin V staining alone for early apoptosis, annexin V plus propidium iodide for late apoptosis/necrosis, or caspase 3 activity as another marker for apoptosis. PAK exposure resulted in an increase in apoptosis/injury for both time intervals, with more cell injury after 2 hours of exposure. HO-1 overexpression was associated with a significant reduction in apoptosis/injury (Figures 5C–5F).

Previous studies have demonstrated that HO-1 overexpression in endothelial cells result in a decrease in COX-2 expression/activity (31, 32). To clarify whether HO-1 antiapoptosis involved COX-2, IB3.1 cells were evaluated for COX-2 expression by Western analysis in response to P.a. and/or the COX inhibitor, indomethacin, under both basal and increased HO-1 conditions. COX-2 was induced in IB3.1 cells exposed to PAK (Figure 6A) or LPS (data not shown). Cells overexpressing HO-1 (HO-1/IB3.1) had lower COX-2 protein levels in response to PAK, similar to what was observed with the COX inhibitor indomethacin (Figure 6A). To determine whether COX inhibition by HO-1 mediates its cytoprotective effects against P.a.-dependent apoptosis, we evaluated whether the COX inhibitor indomethacin resulted in a similar protective effect against P.a.-dependent injury. Indomethacin treatment failed to show a similar protection as observed with HO-1 overexpression (Figure 6B), suggesting that the cytoprotective effects of this model are not through HO-1 inhibition of COX-2.



View larger version (28K):
[in this window]
[in a new window]
 
Figure 6. (A) Western analysis of COX-2 in IB3.1 cells with protein isolated 24 hours after treatments; control, PAK for 1 or 2 hours, stable empty vector line (V), V plus PAK 1 or 2 hours, stable HO-1 cell line (HO-1), HO-1 plus PAK 1 or 2 hours, 0.1 or 1.0 µM of indomethacin with and without PAK for 1 or 2 hours. (B) Caspase 3 activity measured after 24 hours in stable IB3.1 cell lines containing the empty vector (V) or HO-1 vector (HO) in untreated cells (C), exposed to PAK (P) for 1 hour, and/or treated with 0.1 µM indomethacin (I). (C) Caspase 3 activity measured after 6 hours in stable IB3.1 cell lines containing the empty vector (V) or HO-1 vector (HO) in untreated cells (C), exposed to PAK (P) for 2 hours, and/or treated with 0.1-µM indomethacin (I).

 

    DISCUSSION
 TOP
 ABSTRACT
 METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
CF is a chronic airway disease in which inflammation and oxidative stress are critical in the pathophysiology of disease progression. In many models of inflammatory and/or oxidant-mediated injury, HO-1 induction is a cytoprotective response (6, 8, 10, 1315, 33, 34). Therefore, we evaluated HO-1 expression in lung tissue from patients with CF and evaluated its cytoprotective role in a CF airway epithelial cell line, IB3.1.

HO-1 staining was present in macrophages, respiratory epithelial cells, endothelial cells, type II pneumocytes, and myofibroblasts, and increased in macrophages and type II pneumocytes in CF samples. In general, macrophage HO-1 staining was most extensive and intense among patients with more advanced lung disease. The diverse cellular distribution of HO-1 is interesting because of its correlation with the site(s) of inflammation. Lungs from patients with CF typically show bronchopneumonia in addition to inflammation in the large airways. Parenchymal involvement by the inflammatory process is probably the trigger for type II pneumocyte HO-1 expression. Surprisingly, we did not observe an increase in other cell types, especially airway epithelial cells. This may be because we observed a relatively high amount of HO-1 staining in our control samples, which were from patients undergoing lung resection for cancer and receiving mechanical ventilation. In lungs isolated from mice or rats under normal conditions, we normally see little if any staining of airway epithelial cells, whereas mice given an intratracheal injection of agarose beads coated with P.a. show an increase in airway epithelial staining (data not shown).

The increased HO-1 expression that we observed correlates well with previous investigations demonstrating elevated exhaled CO levels in patients with CF and bronchiectasis (3, 3537). CO production is dependent on HO activity. Because HO-1 is the inducible form of HO, the elevated CO levels in these airway diseases would most likely stem from increased HO-1 activity. Our results support this conclusion. Elevated CO levels are thought to be a marker of inflammation or oxidant stress (3, 3537), a hypothesis that is supported by the finding of increased myeloperoxidase staining in the CF lungs.

The role of HO-1 in the host response to inflammation appears to be protective. HO-1 is induced by a variety of agents, including heme, cytokines, endotoxin, and agents causing oxidative stress that may also be responsible for its increase in CF lung disease. Upregulation of HO-1 has been shown to be protective against oxidant-induced kidney failure, endotoxin shock, hyperoxia-induced lung injury, LPS-induced acute lung injury (6, 10, 27, 38), and interestingly, overexpression of HO-1 protects pancreatic ß cells and endothelial cells from apoptosis (20, 21).

Over 80% of individuals with CF suffer from considerable morbidity caused by chronic lung infection with P.a., and chronic P.a. infection also is the cause of death in over three-fourths of CF patients. P.a. infection has been shown to damage cells and induced apoptosis in human conjunctiva epithelial Chang cells, respiratory epithelial cells, and endothelial cells (1618). Interestingly, P.a. exposure and LPS did not induce HO-1 in IB3.1 or the corrected CF airway epithelial cell line, S9 (data not shown), but induced HO-1 in RAW264.7 (Figure 5B). Our experiments demonstrate that HO-1 overexpression is cytoprotective against P.a.-induced apoptosis/injury in CF airway epithelial cells.

COX-1 and COX-2 are heme proteins that catalyze the oxygenation and peroxidation of arachidonic acid to prostaglandin endoperoxide H2. COX-1 is constitutively expressed, whereas COX-2 is inducible. Upregulated HO-1 associated with decreased COX-2 has been shown in microvessel endothelial cells and human femoral endothelial cells (31, 32), and we found this to be true in airway epithelial cells (IB3.1 cells). Interestingly, the antiinflammatory drug, indomethacin, a COX inhibitor, is used to slow the progression of CF lung disease (39), leading to the possibility that the protective effects of HO-1 in CF being related to COX-2 inhibition. However, the COX inhibitor indomethacin did not result in a similar protection against P.a.-induced apoptosis of airway epithelial as HO-1 overexpression, suggesting that this is not the protective mechanism for epithelial cells. Although inhibition of COX-2 by HO-1 does not appear to be the mechanism of its protection in epithelial cells, this is still a potential protective antiinflammatory response of HO-1 in CF lung disease.

There is evidence that CO accounts for at least some of the protective effects of HO-1 antiapoptosis/injury (21, 40). The mechanism by which CO might provide cytoprotection has not been entirely elucidated; it appears that the interaction between IL-10 and HO-1 plays a role (9, 41). IL-10 resistance to LPS-induced injury in RAW264.7 and lung injury involves HO-1 (9). However, we did not observed increased IL-10 protein level in overexpression HO-1 IB3.1 cells (data not shown), suggesting that HO-1 antiapoptosis/injury is not related to IL-10. Recently, P.a.-induced neutrophilic lung inflammation was shown to be attenuated by adenovirus-mediated transfer of the HO-1 cDNA in mice, and this protected against airway epithelial cell apoptosis by overexpressing Bcl-2 (42).

In airways, neutrophils comprise the main inflammatory response to infection by P.a. Myeloperoxidase, an enzyme found in neutrophils, is an accepted marker for this cell type (29). Myeloperoxidase activity is increased in disease states characterized by neutrophilic airway inflammation, such as CF (43), and lung function has been inversely correlated with sputum myeloperoxidase levels (44). The product of myeloperoxidase, hypochlorous acid, is released by neutrophils along with other oxidants as a consequence of the respiratory burst. In CF, myeloperoxidase-derived oxidants have been shown to be harmful to epithelial cells (45). In this study, diffuse and intense myeloperoxidase staining was found in areas of active disease in lungs with CF, and more HO-1 staining, especially in regions of active inflammation, was observed in patients who had greater amounts of myeloperoxidase staining. Oxidative stress and inflammatory cytokines are stimuli for HO-1, and the increased expression of HO-1 observed in CF may be a response to these factors.

A potentially beneficial effect of HO-1 activity against oxidant injury is related to its role in iron sequestration. Ferris and coworker correlated protection of cells by HO-1 with a decrease in intracellular iron and reproduced the protective effect by iron chelation (33). Heme is a ubiquitous iron-containing compound, and much of the cellular damage by activated oxygen species involves the collaboration of intracellular iron (46). Recent studies have demonstrated that HO-1 is important for cellular iron efflux and that this may be related to HO-1's cytoprotective effect against oxidant injury (32, 33). The iron released by HO activity is normally sequestered by ferritin, whose induction helps to prevent oxidant injury caused by iron-catalyzed reaction (46).

A functional iron deficiency is seen in adults with CF, possibly due to long-standing inflammation, although ferritin levels are not low in the majority of patients with CF, indicating that ferritin levels were not reflective of iron stores (47). In sputa and/or bronchoalveolar lavage fluid from patients with CF, there is an increase in the amount of extracellular iron and ferritin (48, 49). In this study, increased intracellular ferritin expression was found in lungs with CF; however, there was little intracellular iron staining. The differences may be related to the fact that we evaluated intracellular iron and ferritin levels rather than extracellular levels and that similar to the serum levels in patients with CF iron deficiency is not reflected by low serum ferritin levels (47). HO-mediated release of iron has been shown to influence ferritin expression, such that an increase in HO-1 may lead to increased ferritin expression (33). HO-1 and ferritin immunostaining was greatest in macrophages and may be directly related. However, we observed very little iron staining, which suggests that increased ferritin expression was not due to iron. Similar to HO-1, ferritin is also induced by oxidative stress and inflammation, and the similar pattern of expression may reflect a response to the same stimulus (50, 51).

In conclusion, CF is a chronic disease marked by chronic necrotizing inflammation of large airways. Neutrophils contribute to the airway damage via release of oxidants, leading to lung damage. HO-1 expression is increased in CF and likely represents an adaptive response to the oxidative stress and inflammation present in the lungs of patients with CF. Our cell culture data, showing HO-1–linked reduction in P.a.-mediated cell apoptosis/injury, suggest that HO-1 plays a cytoprotective role in CF lung disease. Future studies using an animal model of CF will further evaluate the role of HO-1 in this condition.


    FOOTNOTES
 
Supported by the Cystic Fibrosis Foundation (Gary A. Visner, D.O.) and the American Heart Association of Florida (Fuhua Lu, Ph.D.).

Conflict of Interest Statement: H.Z. does not have a financial relationship with a commercial entity that has an interest in the subject of this manuscript; F.L. does not have a financial relationship with a commercial entity that has an interest in the subject of this manuscript; C.L. does not have a financial relationship with a commercial entity that has an interest in the subject of this manuscript; D.S.Z. does not have a financial relationship with a commercial entity that has an interest in the subject of this manuscript; G.A.V. does not have a financial relationship with a commercial entity that has an interest in the subject of this manuscript.

Received in original form November 25, 2003; accepted in final form June 4, 2004


    REFERENCES
 TOP
 ABSTRACT
 METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Gibson RL, Burns JL, Ramsey BW. Pathophysiology and management of pulmonary infections in cystic fibrosis. Am J Respir Crit Care Med 2003;168:918–951.[Abstract/Free Full Text]
  2. Witko-Sarsat V, Sermet-Gaudelus I, Lenoir G, Descamps-Latscha B. Inflammation and CFTR: might neutrophils be the key in cystic fibrosis. Mediators Inflamm 1999;8:7–11.[CrossRef][Medline]
  3. Antuni JD, Kharitonov SA, Hughes D, Hodson ME, Barnes PJ. Increase in exhaled carbon monoxide during exacerbations of cystic fibrosis. Thorax 2000;55:138–142.[Abstract/Free Full Text]
  4. Hull J, Vervaart P, Grimwood K, Phelan P. Pulmonary oxidative stress response in young children with cystic fibrosis. Thorax 1997;52:557–560.[Abstract]
  5. Collins CE, Quaggiotto P, Wood L, O'Loughlin EV, Henry RL, Garg ML. Elevated plasma levels of F2 alpha isoprostane in cystic fibrosis. Lipids 1999;34:551–556.[Medline]
  6. Choi AMK, Alam J. Heme oxygenase-1: function, regulation, and implication of a novel stress-inducible protein in oxidant-induced lung injury. Am J Respir Cell Mol Biol 1996;15:9–19.[Abstract]
  7. Terry CM, Clikeman JA, Hoidal JR, Callahan KS. TNF-alpha and IL-1 alpha induce heme oxygenase-1 via protein kinase C, Ca2+, and phospholipase A2 in endothelial cells. Am J Physiol 1999;276(5 Pt 2):H1493–H1501.
  8. Yamada N, Yamaya M, Okinaga S, Lie R, Suzuki T, Nakayama K, Takeda A, Yamaguchi T, Itoyama K, Sekizawa K, et al. Protective effects of heme oxygenase-1 against oxidant-induced injury in the cultured human tracheal epithelium. Am J Respir Cell Mol Biol 1999;21:428–435.[Abstract/Free Full Text]
  9. Lee TS, Chau LY. Heme oxygenase-1 mediates the anti-inflammatory effect of interleukin-10 in mice. Nat Med 2002;8:240–246.[CrossRef][Medline]
  10. Yet SF, Pellacani A, Patterson C, Tan L, Folta SC, Foster L, Lee WS, Hsieh CM, Perrella MA. Induction of heme oxygenase-1 expression in vascular smooth muscle cells: a link to endotoxic shock. J Biol Chem 1997;272:4293–4301.
  11. McCoubrey WK, Huang TJ, Maines MD. Isolation and characterization of a cDNA from the rat brain that encodes hemoprotein heme oxygenase 3. Eur J Biochem 1997;247:725–732.[Medline]
  12. Poss KD, Tonegawa S. Heme oxygenase 1 is required for mammalian iron utilization. Proc Natl Acad Sci USA 1997;94:10919–10924.[Abstract/Free Full Text]
  13. Poss KD, Tonegawa S. Reduced stress defense in heme oxygenase 1-deficient cells. Proc Natl Acad Sci USA 1997;94:10925–10930.[Abstract/Free Full Text]
  14. Yachie A, Niida Y, Wada T, Igarashi N, Kaneda H, Toma T, Ohta K, Kasahara Y, Koizumi S. Oxidative stress causes enhanced endothelial cell injury in human heme oxygenase-1 deficiency. J Clin Invest 1999;103:129–135.[Medline]
  15. Willis D, Moore AR, Frederick R, Willoughby DA. Heme oxygenase: a novel target for the modulation of the inflammatory response. Nat Med 1996;2:87–90.[CrossRef][Medline]
  16. Rajan S, Cacalano G, Bryan R, Ratner AJ, Sontich CU, van Heerckeren A, Davis P, Prince A. Pseudomonas aeruginosa induction of apoptosis in respiratory epithelial cells: analysis of the effects of cystic fibrosis transmembrane conductance regulator dysfunction and bacterial virulence factors. Am J Respir Cell Mol Biol 2000;23:304–312.[Abstract/Free Full Text]
  17. Valente E, Assis MC, Alvim IM, Pereira GM, Plotkowski MC. Pseudomonas aeruginosa induces apoptosis in human endothelial cells. Microb Pathog 2000;29:345–356.[CrossRef][Medline]
  18. Jendrossek V, Fillon S, Belka C, Muller I, Puttkammer B, Lang F. Apoptotic response of Chang cells to infection with Pseudomonas aeruginosa strains PAK and PAO-I: molecular ordering of the apoptosis signaling cascade and role of type IV pili. Infect Immun 2003;71:2665–2673.[Abstract/Free Full Text]
  19. Grassme H, Kirschnek S, Riethmueller J, Riehle A, von Kurthy G, Lang F, Weller M, Gulbins E. CD95/CD95 ligand interactions on epithelial cells in host defense to Pseudomonas aeruginosa. Science 2000;290:527–530.[Abstract/Free Full Text]
  20. Tobiasch E, Gunther L, Bach FH. Heme oxygenase-1 protects pancreatic beta cells from apoptosis caused by various stimuli. J Investig Med 2001;49:566–571.[Medline]
  21. Brouard S, Otterbein LE, Anrather J, Tobiasch E, Bach FH, Choi AM, Soares MP. Carbon monoxide generated by heme oxygenase 1 suppresses endothelial cell apoptosis. J Exp Med 2000;192:1015–1026.[Abstract/Free Full Text]
  22. Lu F, Zander DS, Visner GA. Increased expression of heme oxygenase-1 in human lung transplantation. J Heart Lung Transplant 2002;21:1120–1126.[CrossRef][Medline]
  23. Pinkus GS, Pinkus JL. Myeloperoxidase: a specific marker for myeloid cells in paraffin sections. Mod Pathol 1991;4:733–741.[Medline]
  24. Kindblom LG, Jacobsen GK, Jacobsen M. Immunohistochemical investigation of tumors of supposed fibroblastic-histocytic origin. Hum Pathol 1982;13:834–840.[Medline]
  25. Krafft AE, Duncan BW, Bijwaard KE, Taubenberger JK, Lichy JH. Optimization of the isolation and amplification of RNA from formalin-fixed, paraffin-embedded tissue: the Armed Forces Institute of Pathology Experience and Literature Review. Mol Diagn 1997;2:217–230.[CrossRef][Medline]
  26. Masuda N, Ohnishi T, Kawamoto S, Monden M, Okubo K. Analysis of chemical modification of RNA from formalin-fixed samples and optimization of molecular biology applications for such samples. Nucleic Acids Res 1999;27:4436–4443.[Abstract/Free Full Text]
  27. Shiraishi F, Curtis LM, Truong L, Poss K, Visner GA, Madsen K, Nick HS, Agarwal A. Heme oxygenase-1 gene ablation or expression modulates cisplatin-induced renal tubular apoptosis. Am J Physiol Renal Physiol 2000;278:726–736.
  28. Kaufman MR, Jia J, Zeng L, Ha U, Chow M, Jin S. Pseudomonas aeruginosa mediated apoptosis requires the ADP-ribosylating activity of exoS. Microbiol 2000;146:2531–2541.[Abstract/Free Full Text]
  29. Schmekel B, Hornblad Y, Linden M, Sundstrom C, Venge P. Myeloperoxidase in human lung lavage: II: internalization of myeloperoxidase by alveolar macrophages. Inflammation 1990;14:455–461.[CrossRef][Medline]
  30. Lin HY, Juan SH, Shen SC, Hsu FL, Chen YC. Inhibition of lipopolysaccharide-induced nitric oxide production by flavonoids in RAW264.7 macrophages involves heme oxygenase-1. Biochem Pharmacol 2003;66:1821–1832.[CrossRef][Medline]
  31. Haider A, Olszanecki R, Gryglewski R, Schwartzman ML, Lianos E, Kappas A, Nasjletti A, Abraham NG. Regulation of cyclooxygenase by the heme-heme oxygenase system in microvessel endothelial cells. J Pharmacol Exp Ther 2002;300:188–194.[Abstract/Free Full Text]
  32. Li Volti G, Seta F, Schwartzman ML, Nasjletti A, Abraham NG. Heme oxygenase attenuates angiotensin II-mediated increase in cyclooxygenase-2 activity in human femoral endothelial cells. Hypertension 2003;41:715–719.[Abstract/Free Full Text]
  33. Ferris CD, Jaffrey SR, Sawa A, Takahashi M, Brady SD, Barrow RK, Tysoe SA, Wolosker H, Baranano DE, Dore S, et al. Haem oxygenase-1 prevents cell death by regulating cellular iron. Nat Cell Biol 1999;1:152–157.[CrossRef][Medline]
  34. Vile GF, Tyrell RM. Oxidative stress resulting from ultraviolet irradiation of human skin fibroblasts leads to a heme oxygenase-dependent increase in ferritin. J Biol Chem 1993;268:14678–14681.[Abstract/Free Full Text]
  35. Horvath I, Loukides S, Wodehouse T, Kharitonov SA, Cole PJ, Barnes PJ. Increased level of exhaled carbon monoxide in bronchiectasis: a new marker of oxidative stress. Thorax 1998;53:867–870.[Abstract/Free Full Text]
  36. Paredi P, Shah PL, Montuschi P, Sullivan P, Hodson ME, Kharitonov SA, Barnes PJ. Increased carbon monoxide in exhaled air of patients with cystic fibrosis. Thorax 1999;54:917–920.[Abstract/Free Full Text]
  37. Paredi P, Kharitonov SA, Leak D, Shah PL, Cramer D, Hodson ME, Barnes PJ. Exhaled ethane is elevated in cystic fibrosis and correlates with carbon monoxide levels and airway obstruction. Am J Respir Crit Care Med 2000;161:1247–1251.[Abstract/Free Full Text]
  38. Otterbein LE, Kolls JK, Mantell LL, Cook JL, Alam J, Choi AM. Exogenous administration of heme oxygenase-1 by gene transfer provides protection against hyperoxia-induced lung injury. J Clin Invest 1999;103:1047–1054.[Medline]
  39. Konstan MW, Hoppel CL, Chai BL, Davis PB. Ibuprofen in children with cystic fibrosis: pharmacokinetics and adverse effects. J Pediatr 1991;118:956–964.[CrossRef][Medline]
  40. Akamatsu Y, Haga M, Tyagi S, Yamashita K, Graca-Souza AV, Ollinger R, Czismadia E, May GA, Ifedigbo E, Otterbein LE, et al. Heme oxygenase-1-derived carbon monoxide protects hearts from transplant-associated ischemia reperfusion injury. FASEB J 2004;18:771–772.[Abstract/Free Full Text]
  41. Visner GA, Lu F, Zhou H, Latham C, Agarwal A, Zander DS. Graft protective effects of heme oxygenase 1 in mouse tracheal transplant-related obliterative bronchiolitis. Transplantation 2003;76:650–656.[CrossRef][Medline]
  42. Tsuburai T, Kaneko T, Nagashima Y, Ueda A, Tagawa A, Shinohara T, Ishigatsubo Y. Pseudomonas aeruginosa-induced neutrophilic lung inflammation is attenuated by adenovirus-mediated transfer of the heme oxygenase 1 cDNA in mice. Hum Gene Ther 2004;15:273–285.[CrossRef][Medline]
  43. Witko-sarsat V, Delacourt C, Rabier D, Bardet J, Nguyen AT, Descamps-latscha B. Neutrophil-derived long-lived oxidants in cystic fibrosis sputum. Am J Respir Crit Care Med 1995;152:1910–1916.[Abstract]
  44. Regelmann WE, Siefferman CM, Herron JM, Elliott GR, Clawson CC, Gray BH. Sputum peroxidase activity correlates with the severity of lung disease in cystic fibrosis. Pediatr Pulmonol 1995;19:1–9.[Medline]
  45. Van Der Vliet A, Nguyen MN, Shigenaga MK, Eiserich JP, Marelich GP, Cross CE. Myeloperoxidase and protein oxidation in cystic fibrosis. Am J Physiol 2000;279:L537–L546.
  46. Meneghini R. Iron homeostasis, oxidative stress, and DNA damage. Free Radic Biol Med 1997;23:783–792.[CrossRef][Medline]
  47. Pond MN, Morton AM, Conway SP. Functional iron deficiency in adults with cystic fibrosis. Respir Med 1996;90:409–413.[CrossRef][Medline]
  48. Stites SW, Walters B, O'Brien-Ladner AR, Bailey K, Wesselius LJ. Increased iron and ferritin content of sputum from patients with cystic fibrosis or chronic bronchitis. Chest 1998;114:814–819.[Abstract/Free Full Text]
  49. Stites SW, Plautz MW, Bailey K, O'brien-ladner AR, Wesselius LJ. Increased concentrations of iron and isoferritins in the lower respiratory tract of patients with stable cystic fibrosis. Am J Respir Crit Care Med 1999;160:796–801.[Abstract/Free Full Text]
  50. Pinero DJ, Hu J, Cook BM, Scaduto RC, Connor JR. Interleukin-1beta increases binding of the iron regulatory protein and the synthesis of ferritin by increasing the labile iron pool. Biochim Biophys Acta 2000;1497:279–288.[Medline]
  51. Tsuji Y, Ayaki H, Whitman SP, Morrow CS, Torti SV, Torti FM. Coordinate transcriptional and translational regulation of ferritin in response to oxidative stress. Mol Cell Biol 2000;20:5818–5827.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
Eur Respir JHome page
Q. Ye, Y. Dalavanga, N. Poulakis, S. U. Sixt, J. Guzman, and U. Costabel
Decreased expression of haem oxygenase-1 by alveolar macrophages in idiopathic pulmonary fibrosis
Eur. Respir. J., May 1, 2008; 31(5): 1030 - 1036.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Pathol.Home page
Z.-W. Xia, L.-Q. Xu, W.-W. Zhong, J.-J. Wei, N.-L. Li, J. Shao, Y.-Z. Li, S.-C. Yu, and Z.-L. Zhang
Heme Oxygenase-1 Attenuates Ovalbumin-Induced Airway Inflammation by Up-Regulation of Foxp3 T-Regulatory Cells, Interleukin-10, and Membrane-Bound Transforming Growth Factor- 1
Am. J. Pathol., December 1, 2007; 171(6): 1904 - 1914.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Respir. Cell Mol. Bio.Home page
L. E. Fredenburgh, M. A. Perrella, and S. A. Mitsialis
The Role of Heme Oxygenase-1 in Pulmonary Disease
Am. J. Respir. Cell Mol. Biol., February 1, 2007; 36(2): 158 - 165.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Respir. Crit. Care Med.Home page
T. Sato, M. Takeno, K. Honma, H. Yamauchi, Y. Saito, T. Sasaki, H. Morikubo, Y. Nagashima, S. Takagi, K. Yamanaka, et al.
Heme Oxygenase-1, a Potential Biomarker of Chronic Silicosis, Attenuates Silica-induced Lung Injury
Am. J. Respir. Crit. Care Med., October 15, 2006; 174(8): 906 - 914.
[Abstract] [Full Text] [PDF]


Home page
J. Thorac. Cardiovasc. Surg.Home page
H. Liu, P. Drew, Y. Cheng, and G. A. Visner
Pirfenidone inhibits inflammatory responses and ameliorates allograft injury in a rat lung transplant model
J. Thorac. Cardiovasc. Surg., September 1, 2005; 130(3): 852 - 858.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Respir. Crit. Care Med.Home page
A. Bush, F. Accurso, W. MacNee, S. C. Lazarus, and E. Abraham
Cystic Fibrosis, Pediatrics, Control of Breathing, Pulmonary Physiology and Anatomy, and Surfactant Biology in AJRCCM in 2004
Am. J. Respir. Crit. Care Med., March 15, 2005; 171(6): 545 - 553.
[Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
200311-1607OCv1
170/6/633    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Zhou, H.
Right arrow Articles by Visner, G. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Zhou, H.
Right arrow Articles by Visner, G. A.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Proc. Am. Thorac. Soc. Am. J. Respir. Cell Mol. Biol.
Copyright © 2004 American Thoracic Society