help button home button
AJRCCM
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

Published ahead of print on December 30, 2003, doi:10.1164/rccm.200305-714OC
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Online Supplement
Right arrow All Versions of this Article:
200305-714OCv1
169/5/610    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Warren, R. M.
Right arrow Articles by van Helden, P. D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Warren, R. M.
Right arrow Articles by van Helden, P. D.
American Journal of Respiratory and Critical Care Medicine Vol 169. pp. 610-614, (2004)
© 2004 American Thoracic Society

Patients with Active Tuberculosis often Have Different Strains in the Same Sputum Specimen

Robin M. Warren, Thomas C. Victor, Elizabeth M. Streicher, Madalene Richardson, Nulda Beyers, Nicolaas C. Gey van Pittius and Paul D. van Helden

Medical Research Council Centre for Molecular and Cellular Biology, Department of Medical Biochemistry, and Centre for Tuberculosis Research and Education, Department of Child Health and Paediatrics, Faculty of Health Sciences, Stellenbosch University, Tygerberg, South Africa

Correspondence and requests for reprints should be addressed to Robin M. Warren, M.D., MRC Centre for Molecular and Cellular Biology, Department of Medical Biochemistry, Stellenbosch University, P.O. Box 19063, Tygerberg, South Africa 7505. E-mail: rw1{at}sun.ac.za


    ABSTRACT
 TOP
 ABSTRACT
 METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
It is generally accepted that tuberculosis results from a single infection with a single Mycobacterium tuberculosis strain. Such infections are thought to confer protective immunity against exogenous reinfection. In this study, a novel polymerase chain reaction method was developed to specifically identify M. tuberculosis strains belonging to the Beijing and non-Beijing evolutionary lineages in sputum specimens collected from tuberculosis patients resident in an epidemiologic field site in Cape Town, South Africa. The sensitivity and specificity of the polymerase chain reaction–based strain classification method were 100% (95% confidence interval, 85–100%) when compared with DNA fingerprinting and spacer oligotyping (spoligotyping). Application of this method showed that 19% of all patients were simultaneously infected with Beijing and non-Beijing strains, and 57% of patients infected with a Beijing strain were also infected with a non-Beijing strain. Multiple infections were more frequent in retreatment cases (23%) as compared with new cases (17%), but were not associated with sex, age, or smear grading. These results suggest that multiple infections are frequent, implying high reinfection rates and the absence of efficient protective immunity conferred by the initial infection. This finding could influence our understanding of the epidemiology of disease in high-incidence regions and our understanding for vaccine development.

Key Words: multiple infection • Mycobacterium tuberculosis • reinfection

Active tuberculosis is thought to develop as a continuation of the primary infection (primary tuberculosis), or after endogenous reactivation of the primary infection or exogenous reinfection with a second Mycobacterium tuberculosis strain (1). Understanding the relative contribution of each of these mechanisms will have important implications for prevention of the development of new cases (2), evaluation of new drugs (3), interpretation of molecular epidemiologic data (4), as well as for the design and evaluation of protective and therapeutic vaccines (3, 5).

The relative quantification of exogenous reinfection and endogenous reactivation depends on our ability to accurately differentiate between strains of M. tuberculosis. The development of an internationally standardized DNA fingerprinting method (6) has enabled the genotypic classification of M. tuberculosis strains with a high level of sensitivity and specificity. Using this methodology, molecular epidemiologic studies have shown the presence of a single strain in most cultures collected from patients with tuberculosis (7, 8), thereby suggesting that disease is caused by a single strain (infection). In contrast, we and others have shown that both human immunodeficiency virus (HIV)–negative and HIV-positive individuals can be infected with more than one strain (1) during the same episode (multiple infection) (4, 810), (2) in different lesions (multiple infection) (11, 12), or (3) during successive episodes (reinfection) (3, 9, 1315). However, multiple infections are rarely found when using the DNA fingerprinting method (7, 8) and therefore their significance remains unknown.

This study aimed to determine the extent of multiple M. tuberculosis infection in sputum specimens collected from new and retreatment tuberculosis cases, resident in a community with a high incidence of disease (16), using a polymerase chain reaction (PCR) method based on comparative genomic data. The results are discussed in the context of the bacterial population structure within the human host and how multiple infection could influence the interpretation of molecular epidemiologic data. These findings could have important implications for the future design of antituberculosis vaccines, as well as vaccine and drug trials. This work has been presented at the Keystone Symposium, Taos (2003) (30) and in Prague (2003) (31).


    METHODS
 TOP
 ABSTRACT
 METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Patients and Specimens
During the period March 2000–June 2002, pretreatment sputum specimens were collected only from adult patients (>= 15 years of age) diagnosed with smear-positive tuberculosis (17). All patients were resident in an epidemiologic field site in Cape Town, South Africa (16). Patient demographics including sex, age, and previous history of tuberculosis were recorded at diagnosis and stored in a database. HIV testing was not routinely done, although a recent survey of 366 new adult smear-positive tuberculosis patients at the field site showed that 10% were HIV coinfected. This study was approved by the Ethics Committee of Stellenbosch University (Tygerberg, South Africa).

Classification of M. tuberculosis Isolates
Sputum specimens were cultured in BACTEC medium (BD, Franklin Lakes, NJ) and crude DNA preparations were obtained after boiling (see online supplement for culture and DNA preparation method).

To identify a strain belonging to the Beijing evolutionary lineage, the DNA was subjected to PCR amplification using HotStar Taq polymerase (Qiagen, Hilden, Germany) and overlapping primer sets complementary to the 3' end of the IS6110 element and Rv2820 (primer set 1, TTCAACCATCGCCGCCTCTAC and CACCCTCTACTCTGCGCTTTG; primer set 2, ACCGAGCTGATCAAACCCG and ATGGCACGGCCGACCTGAATGAACC) (see online supplement for PCR amplification conditions and fractionation of products). A positive amplification product of 393 base pairs (bp) and 239 bp, respectively, indicated the presence of an IS6110 insertion in Rv2820 that is unique to the Beijing evolutionary lineage (18) (Figure 1 and Figures 2A and 2B) .



View larger version (13K):
[in this window]
[in a new window]
 
Figure 1. Schematic diagram of the region flanking the direct repeat (DR) region in H37Rv, non-Beijing and Beijing strains. Large arrows indicate open reading frames according to the annotation of Cole and coworkers (29). The IS6110 insertion in the DR region is indicated by a square box (note: IS6110 is inverted in the Beijing strain family). The region specifically deleted in all Beijing strains is indicated by dotted lines (18, 19). Primer positions (sets 1, 2, 3, and 4) are indicated by small arrows.

 


View larger version (87K):
[in this window]
[in a new window]
 
Figure 2. Fractionation of polymerase chain reaction (PCR) amplification products. (A) PCR amplification with primer set 1. (B) PCR amplification with primer set 2. (C) PCR amplification with primer set 3. (D) PCR amplification with primer set 4. DNA was visualized after staining with ethidium bromide. Lanes 1 to 3, clinical specimens; lane 4, H2O; lane M, 100-bp marker.

 
To determine the presence of M. tuberculosis strains other than those belonging to the Beijing evolutionary lineage, the DNA was PCR amplified with overlapping primer sets complementary to Rv2819 (primer set 3, GATCGCTTGTTCTCAGTGCAG and CGAAGGAGTACCACGTGGAG; primer set 4, GGTGCGAGATTGAGGTTCCC and TCTACCTGCAGTCGCTTGTGC). A positive amplification product of 569 and 308 bp, respectively, indicated the presence of M. tuberculosis strain(s) belonging to non-Beijing evolutionary lineages, as the region spanning the genes Rv2816 to Rv2819 (including part of Rv2820) is deleted in all Beijing strains (18, 19) (Figure 1 and Figures 2C and 2D).

The sensitivity and specificity of amplification for the different primer sets was determined by PCR amplification of DNA templates from genetically distinct M. tuberculosis strains characterized by IS6110 DNA fingerprinting (6) and spacer oligotyping (spoligotyping) (20). In addition, DNA templates from different mycobacterial species were subjected to PCR amplification to further determine the specificity of the primer sets.

Smear-positive sputum specimens that showed positive amplification products only with primer sets 1 and 2 were classified as single Beijing infections (Figure 2, lane 2). Similarly, specimens that showed amplification products only with primer sets 3 and 4 were classified as single non-Beijing infections (Figure 2, lane 3). Specimens that showed positive amplification products with primer sets 1, 2, 3, and 4, were classified as multiple infections (Figure 2, lane 1). Specimens that showed discordant amplification were assigned as cross-contamination and excluded from the study.

To assess the extent of possible laboratory cross-contamination, control sputum specimens were concurrently collected from individuals who were smear and culture negative and who were resident in the same community. These specimens were incubated in BACTEC medium for 7 days and crude DNA preparations were obtained after boiling (see online supplement). In addition, aliquots of BACTEC medium were coprocessed as a second group of negative controls (see online supplement).

Spoligotyping
Spoligotyping was done according to the internationally standardized method (20).

Statistical Methods
The Fisher exact test was used to identify differences between patient demographics, as well as the frequency of multiple infections in new and retreatment cases of tuberculosis. Reproducibility of the PCR classification was calculated according to the Cohen kappa method. Sensitivity and specificity was calculated with Prism software (GraphPad, San Diego, CA).


    RESULTS
 TOP
 ABSTRACT
 METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Description of Patients
During the period March 2000 to June 2002, 407 adults (>= 15 years of age) resident within the epidemiologic field site (16) were diagnosed with smear-positive tuberculosis. The average age of these patients was 36.3 years and included 249 (61.2%) male patients and 158 (38.8%) female patients. According to the National Tuberculosis Control Program in line with the Directly Observed Therapy Short-course strategy, diagnosis of tuberculosis is made by sputum smear microscopy in new cases, and by smear microscopy and culture in retreatment cases. We endeavored to recover these sputum specimens from the National Health Laboratory after routine processing; however, some sputum specimens were not identified and were not available for research purposes. Pretreatment sputum specimens were available for analysis from 200 of the 407 patients. Their average age was 35.7 years and included 132 (66%) males and 68 (34%) females. This group of patients did not differ according to the demographic measures of age, sex, and previous history of tuberculosis when compared with patients for whom a sputum specimen was not available.

Validation of the PCR Method
To determine the sensitivity and specificity of the PCR amplification method as outlined in Figure 1, DNA from 59 M. tuberculosis cultures was subjected to amplification with primer sets 1, 2, 3, and 4. Primer sets 1 and 2 produced products on amplification of DNA templates (n = 30) only from strains with a characteristic Beijing IS6110 banding pattern (21) and spoligotype (22). Conversely, primer sets 3 and 4 produced products on amplification of DNA templates (n = 29) only from strains with a non-Beijing genotype. The sensitivity and specificity of each primer set were 100% (95% confidence interval, 85–100%) when compared with the gold standard of the IS6110 DNA fingerprint (21) and spoligotype (22). The specificity of amplification was further demonstrated by the absence of amplification products when DNA templates from Mycobacterium avium, Mycobacterium abscessus, Mycobacterium kansasii, Mycobacterium malmoense, Mycobacterium perigrinum, Mycobacterium smegmatis, and Mycobacterium xenopi, were amplified.

Detection of Multiple Infections
The PCR method was then applied to determine the presence of either Beijing or non-Beijing strains in the sputum specimens of the 200 included patients. PCR amplification of DNA prepared from short-term BACTEC cultures generated products in 192 of the specimens. The absence of amplification in eight specimens could be due either to the DNA concentration being below the limit of detection or to the presence of PCR inhibitors. PCR amplification was highly consistent and the Cohen kappa value for primer sets 1 and 2 and for primer sets 3 and 4 was calculated to be 0.977 and 0.944, respectively. To avoid an overestimation of multiple infection, patient specimens that showed discordant results (n = 6) were excluded as possible cross-contamination.

Using primer sets 1 and 2, specimens from 61 of the 186 (32.8%) patients showed positive amplification products, demonstrating infections with strain(s) belonging to the Beijing evolutionary lineage (Figures 2A and 2B). PCR amplification using primer sets 3 and 4 demonstrated positive amplification products in 160 (86%) of the patient specimens (Figures 2C and 2D). Comparison between the results obtained with primer sets 1 and 2 and primer sets 3 and 4, showed that 35 (19%) of the specimens were positive for all the primer sets, demonstrating multiple M. tuberculosis infection (Table 1) . This represents multiple infection in 57% of patients infected with strains belonging to the Beijing lineage. The remaining 26 patient specimens (14%) were positive for amplification with primer sets 1 and 2 only, demonstrating single infection with strains belonging to the Beijing lineage.


View this table:
[in this window]
[in a new window]
 
TABLE 1. Stratification of patients according to polymerase chain reaction-based classification of mycobacterium tuberculosis strains present in their sputum culture

 
Of the 35 specimens assigned as multiple infection by PCR amplification, 9 (26%) showed the presence of both Beijing and non-Beijing spoligotype patterns, confirming multiple infection. Eleven (31%) of these specimens showed only a Beijing spoligotype and 15 (43%) showed only a non-Bejing spoligotype. Of the 26 specimens that showed a single Beijing infection by PCR amplification, all were confirmed by spoligotyping and no underlying non-Beijing spoligotypes were observed. All of the 125 specimens assigned as non-Beijing infections by PCR amplification showed non-Beijing spoligotypes and no underlying Beijing spoligotype could be detected.

The demographics of the 35 patients coinfected with strains belonging to the Beijing and non-Beijing lineages were similar to that of the 151 patients assigned as having single infections (Table 1). Multiple infections were more frequently observed in retreatment cases (23%) as compared with new cases (17%); however, this trend was not significant (Fisher exact odds ratio, 1.4; 95% confidence interval, 0.7–3.1). No significant association could be demonstrated between multiple infection and sex, age, or smear grading (Table 1).

Detection of Laboratory Cross-contamination
To establish whether laboratory cross-contamination contributed to the classification of multiple infections, control samples were analyzed by PCR amplification to identify the presence of M. tuberculosis DNA. These control groups included (1) decontaminated sputum specimens, collected from individuals who were shown to be smear and culture negative, and (2) BACTEC medium. Both control groups were coprocessed during all manipulations in the laminar flow hood as well as during PCR amplification. PCR amplification of the smear- and culture-negative group with primer sets 1, 2, 3, and 4 identified 6 of 160 positive specimens. This suggests that the extent of possible cross-contamination in sputum specimens was 3.8%, which is similar to that previously reported (3). No detectable laboratory cross-contamination was observed by PCR amplification of the coprocessed negative-control BACTEC medium (n = 37). Of the 125 water control samples included in the study, all were PCR negative, demonstrating the absence of reagent contamination.


    DISCUSSION
 TOP
 ABSTRACT
 METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Over the past decade, molecular genotyping methods have highlighted extensive genotypic heterogeneity among clinical isolates of M. tuberculosis, making accurate classification of the different disease-causing strains a complex science (6). Many of these chromosomal polymorphisms have been analyzed, including strain-specific IS6110 insertion polymorphisms (23, 24) and chromosomal deletions (2527), to identify possible correlates between genotype and phenotype. In this study we have used these genetic data to describe a method to classify clinical isolates according to the presence or absence of chromosomal markers unique to defined evolutionary lineages. Using this method, it was possible to investigate the epidemiologic phenomenon of multiple infections in sputum cultures originating from new and retreatment tuberculosis cases resident in an epidemiologic field site in Cape Town, South Africa (16).

This study demonstrates that 19% of the patients included in the study were simultaneously infected with strain(s) belonging to the Beijing and non-Beijing evolutionary lineages. However, among patients infected with a Beijing strain, 57% were also infected with a strain(s) belonging to the non-Beijing evolutionary lineage. This PCR-based estimate of multiple infection was substantially higher than the 4.8% detected by spoligotyping (this study) and the 2.3% reported using DNA fingerprinting (8).

Extensive evaluation of a series of control samples showed that laboratory cross-contamination is an unlikely explanation for the high frequency of multiple infections, although we acknowledge that the observed level of cross-contamination may lead to an overestimate of multiple infection. However, our estimate is also limited by the inability of the method to identify multiple infections with different Beijing strains or different non-Beijing strains. Therefore we conclude that this study represents a conservative estimate of the frequency of multiple infections in the study setting. We acknowledge that the frequency of multiple infection may be vastly different in different settings, as well as in patients with either extrapulmonary or smear-negative tuberculosis. The high number of multiple infection cases seen in this setting is unlikely to be due to HIV-induced immune deficiency given the low prevalence of HIV and tuberculosis coinfection in the study setting. However, in the absence of HIV testing of all patients, we cannot exclude HIV as a mechanism enabling multiple infection. In addition, we cannot exclude other factors that may alter the immunity of the patients, such as alcoholism and malnutrition.

The occurrence of multiple infections in 17% of the new tuberculosis cases implies that reinfection in the study setting is extremely high. These multiple infections may occur when both infecting strains present to a "naive" immune response and thereby escape killing (11). An alternative possibility is that of "superinfection." In such cases, we speculate that an ongoing tuberculosis infection may significantly divert the immune response, thereby increasing the overall susceptibility to reinfection. Alternatively, reinfection occurring some time after the initial infection may initiate disease progression and the endogenous reactivation of the primary infection (12). The latter will imply that the primary infection is unable to confer protection against a secondary infection. A similar conclusion was drawn from mouse model experiments after repeated infection with different M. tuberculosis strains (28).

The higher proportion of multiple infections in retreatment cases supports previous observations of the importance of reinfection in recurrent tuberculosis (3, 14). However, interpretation of restriction fragment-length polymorphism data in the previous studies depended on the assumption that a patient is infected only with a single strain during each episode of disease. The identification of multiple infections in both new and retreatment cases implies that reinfection studies need to be reevaluated with methodologies that can accurately determine the strain population structure present during each episode. Such studies will allow for a more accurate quantification of the sterilization efficacy of current and new antituberculosis therapies.

From the data presented in this study it is not possible to predict the order in which the different infections occurred. Therefore, it would be unwise to assume that the reinfecting strain will always be overrepresented during disease progression. As described above, reinfection may reactivate a latent infection, which in turn may then be responsible for disease progression. If this scenario is true, it will have important consequences for the interpretation of molecular epidemiologic data, as it is possible that such cases will present with strains that are different from their source cases even though contact existed (4). Alternatively, multiply infected source cases may infect contacts with an underlying strain (not detected by IS6110 DNA fingerprinting), thereby making the inference of contact difficult when using only restriction fragment-length polymorphism data.

This study demonstrates that multiple infections are present in patients with active tuberculosis in a high-incidence setting. Most importantly, the initial infection is unable to provide protection against a subsequent infection in this population. This result will have important implications for the understanding of protective immunity and the development and testing of new vaccines and drugs for use in communities where the burden of disease is high. Furthermore, this study highlights the importance of preventing transmission to reduce the risk of exposure and reexposure of all people to active sources of tuberculosis.


    Acknowledgments
 
The authors thank the National Health Laboratory Service regional laboratory for providing access to specimens, and Mrs. L. Pretorius and Mrs. A. Huysamen for excellent technical support and preparation of specimens. The authors also thank Dr. I. Toms (Department of Health, City of Cape Town) and are indebted to the residents of the epidemiologic field site.


    FOOTNOTES
 
Supported by the GlaxoSmithKline Action TB Program and the IAEA.

This article has an online supplement, which is accessible from this issue's table of contents online at www.atsjournals.org

Conflict of Interest Statement: R.M.W. has no declared conflict of interest; T.C.V. has no declared conflict of interest; E.M.S. has no declared conflict of interest; M.R. has been employed by GlaxoSmithKline, with a monthly salary, from January 1994 and during this period of employment the techniques and methodology and background knowledge used for her contribution to this paper was developed, but it does not hold direct financial benefit to herself or her institution and she has received sponsorship from GSK as well as from the IUATLD and CDC to attend conferences where aspects of the research projects in which she is involved were presented, again without any specific gain to herself or her institution; N.B. received 111,150 pounds in 2000 and 150,000 pounds per year for 2001–2003 from GlaxoSmithKline Action TB Program as research grants for developing and maintaining an epidemiological field site and for doing a study aimed at identifying surrogate markers for response to treatment in TB patients; N.C.G.v.F. has no declared conflict of interest; P.D.v.P. has received a research grant from Glaxo-SmithKline for TB research.

Received in original form May 30, 2003; accepted in final form December 19, 2003


    REFERENCES
 TOP
 ABSTRACT
 METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Balasubramanian V, Wiegeshaus EH, Taylor BT, Smith DW. Pathogenesis of tuberculosis: pathway to apical localization. Tuber Lung Dis 1994;75:168–178.[CrossRef][Medline]
  2. Mallory KF, Churchyard GJ, Kleinschmidt I, De Cock KM, Corbett EL. The impact of HIV infection on recurrence of tuberculosis in South African gold miners. Int J Tuberc Lung Dis 2000;4:455–462.[Medline]
  3. van Rie A, Warren R, Richardson M, Victor TC, Gie RP, Enarson DA, Beyers N, van Helden PD. Exogenous reinfection as a cause of recurrent tuberculosis after curative treatment. N Engl J Med 1999;341:1174–1179.[Abstract/Free Full Text]
  4. Braden CR, Morlock GP, Woodley CL, Johnson KR, Colombel AC, Cave MD, Yang ZH, Valway SE, Onorato IM, Crawford JT. Simultaneous infection with multiple strains of Mycobacterium tuberculosis. Clin Infect Dis 2001;33:E42–E47.
  5. Fine PE, Small PM. Exogenous reinfection in tuberculosis. N Engl J Med 1999;341:1226–1227.[Free Full Text]
  6. van Embden JD, Cave MD, Crawford JT, Dale JW, Eisenach KD, Gicquel B, Hermans P, Martin C, McAdam R, Shinnick TM. Strain identification of Mycobacterium tuberculosis by DNA fingerprinting: recommendations for a standardized methodology. J Clin Microbiol 1993;31:406–409.[Abstract/Free Full Text]
  7. de Boer AS, Kremer K, Borgdorff MW, de Haas PE, Heersma HF, van Soolingen D. Genetic heterogeneity in Mycobacterium tuberculosis isolates reflected in IS6110 restriction fragment length polymorphism patterns as low-intensity bands. J Clin Microbiol 2000;38:4478–4484.[Abstract/Free Full Text]
  8. Richardson M, Carroll NM, Engelke E, van der Spuy GD, Salker F, Munch Z, Gie RP, Warren RM, Beyers N, van Helden PD. Multiple Mycobacterium tuberculosis strains in early cultures from patients in a high-incidence community setting. J Clin Microbiol 2002;40:2750–2754.[Abstract/Free Full Text]
  9. Chaves F, Dronda F, Alonso-Sanz M, Noriega AR. Evidence of exogenous reinfection and mixed infection with more than one strain of Mycobacterium tuberculosis among Spanish HIV-infected inmates. AIDS 1999;13:615–620.[CrossRef][Medline]
  10. Niemann S, Richter E, Rusch-Gerdes S, Schlaak M, Greinert U. Double infection with a resistant and a multidrug-resistant strain of Mycobacterium tuberculosis. Emerg Infect Dis 2000;6:548–551.[Medline]
  11. Bates JH, Stead WW, Rado TA. Phage type of tubercle bacilli isolated from patients with two or more sites of organ involvement. Am Rev Respir Dis 1976;114:353–358.[Medline]
  12. du Plessis DG, Warren R, Richardson M, Joubert JJ, van Helden PD. Demonstration of reinfection and reactivation in HIV-negative autopsied cases of secondary tuberculosis: multilesional genotyping of Mycobacterium tuberculosis utilizing IS6110 and other repetitive element-based DNA fingerprinting. Tuberculosis (Edinb) 2001;81:211–220.
  13. Small PM, Shafer RW, Hopewell PC, Singh SP, Murphy MJ, Desmond E, Sierra MF, Schoolnik GK. Exogenous reinfection with multidrug-resistant Mycobacterium tuberculosis in patients with advanced HIV infection. N Engl J Med 1993;328:1137–1144.[Abstract/Free Full Text]
  14. Caminero JA, Pena MJ, Campos-Herrero MI, Rodriguez JC, Afonso O, Martin C, Pavon JM, Torres MJ, Burgos M, Cabrera P, et al. Exogenous reinfection with tuberculosis on a European island with a moderate incidence of disease. Am J Respir Crit Care Med 2001;163:717–720.[Abstract/Free Full Text]
  15. Kruuner A, Pehme L, Ghebremichael S, Koivula T, Hoffner SE, Mikelsaar M. Use of molecular techniques to distinguish between treatment failure and exogenous reinfection with Mycobacterium tuberculosis. Clin Infect Dis 2002;35:146–155.[CrossRef][Medline]
  16. Beyers N, Gie RP, Zietsman HL, Kunneke M, Hauman J, Tatley M, Donald PR. The use of a geographical information system (GIS) to evaluate the distribution of tuberculosis in a high-incidence community. S Afr Med J 1996;86:40–144.[Medline]
  17. Maher D, Chaulet P, Spinaci S, Harries A. Treatment of tuberculosis: guidelines for national programs, 2nd ed. Geneva, Switzerland: World Health Organization; 1997.
  18. Warren RM, Streicher EM, Sampson SL, van der Spuy GD, Richardson M, Nguyen D, Behr MA, Victor TC, van Helden PD. Microevolution of the direct repeat region of Mycobacterium tuberculosis: implications for interpretation of spoligotyping data. J Clin Microbiol 2002;40:4457–4465.[Abstract/Free Full Text]
  19. van Rie A, Warren RM, Beyers N, Gie RP, Classen CN, Richardson M, Sampson SL, Victor TC, van Helden PD. Transmission of a multidrug-resistant Mycobacterium tuberculosis strain resembling "strain W" among noninstitutionalized, human immunodeficiency virus-seronegative patients. J Infect Dis 1999;180:1608–1615.[CrossRef][Medline]
  20. Kamerbeek J, Schouls L, Kolk A, van Agterveld M, van Soolingen D, Kuijper S, Bunschoten A, Molhuizen H, Shaw R, Goyal M, et al. Simultaneous detection and strain differentiation of Mycobacterium tuberculosis for diagnosis and epidemiology. J Clin Microbiol 1997;35:907–914.[Abstract]
  21. Richardson M, van Lill SW, van der Spuy GD, Munch Z, Booysen CN, Beyers N, van Helden PD, Warren RM. Historic and recent events contribute to the disease dynamics of Beijing-like Mycobacterium tuberculosis isolates in a high incidence region. Int J Tuberc Lung Dis 2002;6:1001–1011.[Medline]
  22. Bifani PJ, Mathema B, Kurepina NE, Kreiswirth BN. Global dissemination of the Mycobacterium tuberculosis W-Beijing family strains. Trends Microbiol 2002;10:45–52.[CrossRef][Medline]
  23. Beggs ML, Eisenach KD, Cave MD. Mapping of IS6110 insertion sites in two epidemic strains of Mycobacterium tuberculosis. J Clin Microbiol 2000;38:2923–2928.[Abstract/Free Full Text]
  24. Sampson S, Warren R, Richardson M, van der Spuy G, van Helden P. IS6110 insertions in Mycobacterium tuberculosis: predominantly into coding regions. J Clin Microbiol 2001;39:3423–3424.[Free Full Text]
  25. Fang Z, Doig C, Kenna DT, Smittipat N, Palittapongarnpim P, Watt B, Forbes KJ. IS6110-mediated deletions of wild-type chromosomes of Mycobacterium tuberculosis. J Bacteriol 1999;181:1014–1020.[Abstract/Free Full Text]
  26. Ho TB, Robertson BD, Taylor GM, Shaw RJ, Young DB. Comparison of Mycobacterium tuberculosis genomes reveals frequent deletions in a 20 kb variable region in clinical isolates. Yeast 2000;17:272–282.[CrossRef][Medline]
  27. Warren RM, Sampson SL, Richardson M, van der Spuy GD, Lombard CJ, Victor TC, van Helden PD. Mapping of IS6110 flanking regions in clinical isolates of M. tuberculosis demonstrates genome plasticity. Mol Microbiol 2000;37:1405–1416.[CrossRef][Medline]
  28. Repique CJ, Li A, Collins FM, Morris SL. DNA immunization in a mouse model of latent tuberculosis: effect of DNA vaccination on reactivation of disease and on reinfection with a secondary challenge. Infect Immun 2002;70:3318–3323.[Abstract/Free Full Text]
  29. Cole ST, Brosch R, Parkhill J, Garnier T, Churcher C, Harris D, Gordon SV, Eiglmeier K, Gas S, Barry CE III, et al. Deciphering the biology of Mycobacterium tuberculosis from the complete genome sequence. Nature 1998;393:537–544.[CrossRef][Medline]
  30. Warren RM, Uys P, Victor T, Gey van Pittius NC, Richardson M, Streicher E, Jordaan A, Beyers N, Van Helden PD. Multiple infection is common in a high incidence area: what does it imply? Presented at Keystone Symposium on tuberculosis: integrating host and pathogen biology, Taos, NM, 2003.
  31. Warren RM, Victor TC, Streicher EM, Richardson M, Beyers N, Gey van Pittius NC, van Helden PD. Patients with active tuberculosis often have different strains in the same sputum sample. Presented at Third Meeting of Concerted Action Project: new generation genetic markers and techniques for the epidemiology of tuberculosis, Prague, Czech Republic, 2003.



This article has been cited by other articles:


Home page
Infect. Immun.Home page
T. Einarsdottir, E. Lockhart, and J. L. Flynn
Cytotoxicity and Secretion of Gamma Interferon Are Carried Out by Distinct CD8 T Cells during Mycobacterium tuberculosis Infection
Infect. Immun., October 1, 2009; 77(10): 4621 - 4630.
[Abstract] [Full Text] [PDF]


Home page
NEJMHome page
D. Wilson, R. M. Hurtado, and S. Digumarthy
Case 18-2009 -- A 24-Year-Old Woman with AIDS and Tuberculosis with Progressive Cough, Dyspnea, and Wasting
N. Engl. J. Med., June 4, 2009; 360(23): 2456 - 2464.
[Full Text] [PDF]


Home page
J. Clin. Microbiol.Home page
R. Stavrum, M. Mphahlele, K. Ovreas, T. Muthivhi, P. B. Fourie, K. Weyer, and H. M. S. Grewal
High Diversity of Mycobacterium tuberculosis Genotypes in South Africa and Preponderance of Mixed Infections among ST53 Isolates
J. Clin. Microbiol., June 1, 2009; 47(6): 1848 - 1856.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Microbiol.Home page
B. J. Marais, A. C. Hesseling, H. S. Schaaf, R. P. Gie, P. D. van Helden, and R. M. Warren
Mycobacterium tuberculosis Transmission Is Not Related to Household Genotype in a Setting of High Endemicity
J. Clin. Microbiol., May 1, 2009; 47(5): 1338 - 1343.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Microbiol.Home page
P. W. Uys, R. Warren, P. D. van Helden, M. Murray, and T. C. Victor
Potential of Rapid Diagnosis for Controlling Drug-Susceptible and Drug-Resistant Tuberculosis in Communities Where Mycobacterium tuberculosis Infections Are Highly Prevalent
J. Clin. Microbiol., May 1, 2009; 47(5): 1484 - 1490.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Respir. Crit. Care Med.Home page
C. R. Sander, A. A. Pathan, N. E. R. Beveridge, I. Poulton, A. Minassian, N. Alder, J. Van Wijgerden, A. V. S. Hill, F. V. Gleeson, R. J. O. Davies, et al.
Safety and Immunogenicity of a New Tuberculosis Vaccine, MVA85A, in Mycobacterium tuberculosis-infected Individuals
Am. J. Respir. Crit. Care Med., April 15, 2009; 179(8): 724 - 733.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Roentgenol.Home page
B. J. Marais, S. K. Parker, S. Verver, A. van Rie, and R. M. Warren
Primary and Postprimary or Reactivation Tuberculosis: Time to Revise Confusing Terminology?
Am. J. Roentgenol., April 1, 2009; 192(4): W198 - W198.
[Full Text] [PDF]


Home page
Am. J. Roentgenol.Home page
Y. J. Jeong, W.-J. Koh, and K. S. Lee
Reply
Am. J. Roentgenol., April 1, 2009; 192(4): W199 - W200.
[Full Text] [PDF]


Home page
J. Immunol.Home page
K. Bhatt, A. Uzelac, S. Mathur, A. McBride, J. Potian, and P. Salgame
B7 Costimulation Is Critical for Host Control of Chronic Mycobacterium tuberculosis Infection
J. Immunol., March 15, 2009; 182(6): 3793 - 3800.
[Abstract] [Full Text] [PDF]


Home page
Eur Respir JHome page
S. Hofmann-Thiel, J. van Ingen, K. Feldmann, L. Turaev, G. T. Uzakova, G. Murmusaeva, D. van Soolingen, and H. Hoffmann
Mechanisms of heteroresistance to isoniazid and rifampin of Mycobacterium tuberculosis in Tashkent, Uzbekistan
Eur. Respir. J., February 1, 2009; 33(2): 368 - 374.
[Abstract] [Full Text] [PDF]


Home page
J R Soc InterfaceHome page
P. W Uys, P. D van Helden, and J. W Hargrove
Tuberculosis reinfection rate as a proportion of total infection rate correlates with the logarithm of the incidence rate: a mathematical model
J R Soc Interface, January 6, 2009; 6(30): 11 - 15.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
T. Cohen, C. Colijn, and M. Murray
Modeling the effects of strain diversity and mechanisms of strain competition on the potential performance of new tuberculosis vaccines
PNAS, October 21, 2008; 105(42): 16302 - 16307.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Microbiol.Home page
K. G. P. Hoek, N. C. Gey van Pittius, H. Moolman-Smook, K. Carelse-Tofa, A. Jordaan, G. D. van der Spuy, E. Streicher, T. C. Victor, P. D. van Helden, and R. M. Warren
Fluorometric Assay for Testing Rifampin Susceptibility of Mycobacterium tuberculosis Complex
J. Clin. Microbiol., April 1, 2008; 46(4): 1369 - 1373.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Microbiol.Home page
L. C. O. Lazzarini, R. C. Huard, N. L. Boechat, H. M. Gomes, M. C. Oelemann, N. Kurepina, E. Shashkina, F. C. Q. Mello, A. L. Gibson, M. J. Virginio, et al.
Discovery of a Novel Mycobacterium tuberculosis Lineage That Is a Major Cause of Tuberculosis in Rio de Janeiro, Brazil
J. Clin. Microbiol., December 1, 2007; 45(12): 3891 - 3902.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Microbiol.Home page
I. Mokrousov, W. W. Jiao, V. Valcheva, A. Vyazovaya, T. Otten, H. M. Ly, N. N. Lan, E. Limeschenko, N. Markova, B. Vyshnevskiy, et al.
Rapid Detection of the Mycobacterium tuberculosis Beijing Genotype and Its Ancient and Modern Sublineages by IS6110-Based Inverse PCR.
J. Clin. Microbiol., August 1, 2006; 44(8): 2851 - 2856.
[Abstract] [Full Text] [PDF]


Home page
Clin. Microbiol. Rev.Home page
D. F. Warner and V. Mizrahi
Tuberculosis Chemotherapy: the Influence of Bacillary Stress and Damage Response Pathways on Drug Efficacy
Clin. Microbiol. Rev., July 1, 2006; 19(3): 558 - 570.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
T. Cohen, M. Lipsitch, R. P. Walensky, and M. Murray
Beneficial and perverse effects of isoniazid preventive therapy for latent tuberculosis infection in HIV-tuberculosis coinfected populations
PNAS, May 2, 2006; 103(18): 7042 - 7047.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Respir. Crit. Care Med.Home page
W. W. Yew and C. C. Leung
Update in tuberculosis 2005.
Am. J. Respir. Crit. Care Med., March 1, 2006; 173(5): 491 - 498.
[Full Text] [PDF]


Home page
J. Clin. Microbiol.Home page
D. Hillemann, R. Warren, T. Kubica, S. Rusch-Gerdes, and S. Niemann
Rapid Detection of Mycobacterium tuberculosis Beijing Genotype Strains by Real-Time PCR
J. Clin. Microbiol., February 1, 2006; 44(2): 302 - 306.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Microbiol.Home page
D. Garcia de Viedma, N. Alonso Rodriguez, S. Andres, M. J. Ruiz Serrano, and E. Bouza
Characterization of Clonal Complexity in Tuberculosis by Mycobacterial Interspersed Repetitive Unit-Variable-Number Tandem Repeat Typing
J. Clin. Microbiol., November 1, 2005; 43(11): 5660 - 5664.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Respir. Crit. Care Med.Home page
M. A. Behr
Polyclonal Tuberculosis and the Emergence of Drug Resistance
Am. J. Respir. Crit. Care Med., September 1, 2005; 172(5): 521 - 522.
[Full Text] [PDF]


Home page
Am. J. Respir. Crit. Care Med.Home page
A. van Rie, T. C. Victor, M. Richardson, R. Johnson, G. D. van der Spuy, E. J. Murray, N. Beyers, N. C. G. van Pittius, P. D. van Helden, and R. M. Warren
Reinfection and Mixed Infection Cause Changing Mycobacterium tuberculosis Drug-Resistance Patterns
Am. J. Respir. Crit. Care Med., September 1, 2005; 172(5): 636 - 642.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Respir. Crit. Care Med.Home page
S. Verver, R. M. Warren, N. Beyers, M. Richardson, G. D. van der Spuy, M. W. Borgdorff, D. A. Enarson, M. A. Behr, and P. D. van Helden
Rate of Reinfection Tuberculosis after Successful Treatment Is Higher than Rate of New Tuberculosis
Am. J. Respir. Crit. Care Med., June 15, 2005; 171(12): 1430 - 1435.
[Abstract] [Full Text] [PDF]


Home page
Antimicrob. Agents Chemother.Home page
M. T. McCammon, J. S. Gillette, D. P. Thomas, S. V. Ramaswamy, E. A. Graviss, B. N. Kreiswirth, J. Vijg, and T. N. Quitugua
Detection of rpoB Mutations Associated with Rifampin Resistance in Mycobacterium tuberculosis Using Denaturing Gradient Gel Electrophoresis
Antimicrob. Agents Chemother., June 1, 2005; 49(6): 2200 - 2209.
[Abstract] [Full Text] [PDF]


Home page
MicrobiologyHome page
C. Pheiffer, J. C. Betts, H. R. Flynn, P. T. Lukey, and P. van Helden
Protein expression by a Beijing strain differs from that of another clinical isolate and Mycobacterium tuberculosis H37Rv
Microbiology, April 1, 2005; 151(4): 1139 - 1150.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Respir. Crit. Care Med.Home page
B. Nemery, W. W. Yew, R. Albert, C. Brun-Buisson, W. MacNee, F. J. Martinez, D. C. Angus, and E. Abraham
Tuberculosis, Nontuberculous Lung Infection, Pleural Disorders, Pulmonary Function, Respiratory Muscles, Occupational Lung Disease, Pulmonary Infections, and Social Issues in AJRCCM in 2004
Am. J. Respir. Crit. Care Med., March 15, 2005; 171(6): 554 - 562.
[Full Text] [PDF]


Home page
J. Clin. Microbiol.Home page
I. C. Shamputa, L. Rigouts, L. A. Eyongeta, N. A. El Aila, A. van Deun, A. H. Salim, E. Willery, C. Locht, P. Supply, and F. Portaels
Genotypic and Phenotypic Heterogeneity among Mycobacterium tuberculosis Isolates from Pulmonary Tuberculosis Patients
J. Clin. Microbiol., December 1, 2004; 42(12): 5528 - 5536.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
J. L. Flint, J. C. Kowalski, P. K. Karnati, and K. M. Derbyshire
The RD1 virulence locus of Mycobacterium tuberculosis regulates DNA transfer in Mycobacterium smegmatis
PNAS, August 24, 2004; 101(34): 12598 - 12603.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Microbiol.Home page
D. Garcia de Viedma, M. Marin, M. J. Ruiz, and E. Bouza
Analysis of Clonal Composition of Mycobacterium tuberculosis Isolates in Primary Infections in Children
J. Clin. Microbiol., August 1, 2004; 42(8): 3415 - 3418.
[Abstract] [Full Text] [PDF]


Home page
JWatch Infect. DiseasesHome page
Infection with Multiple Strains of Mycobacterium tuberculosis
Journal Watch Infectious Diseases, March 29, 2004; 2004(329): 9 - 9.
[Full Text]


Home page
Am. J. Respir. Crit. Care Med.Home page
M. A. Behr
Tuberculosis due to Multiple Strains: A Concern for the Patient? A Concern for Tuberculosis Control?
Am. J. Respir. Crit. Care Med., March 1, 2004; 169(5): 554 - 555.
[Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Online Supplement
Right arrow All Versions of this Article:
200305-714OCv1
169/5/610    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Warren, R. M.
Right arrow Articles by van Helden, P. D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Warren, R. M.
Right arrow Articles by van Helden, P. D.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Proc. Am. Thorac. Soc. Am. J. Respir. Cell Mol. Biol.
Copyright © 2004 American Thoracic Society