Published ahead of print on May 13, 2003, doi:10.1164/rccm.200210-1164OC
American Journal of Respiratory and Critical Care Medicine Vol 168. pp. 476-480, (2003)
© 2003 American Thoracic Society
Pneumococcal Septic Shock Is Associated with the Interleukin-101082 Gene Promoter Polymorphism
Bernhard M. Schaaf,
Florian Boehmke,
Hamed Esnaashari,
Ulrike Seitzer,
Henning Kothe,
Matthias Maass,
Peter Zabel and
Klaus Dalhoff
Department of Medicine III and Institute of Medical Microbiology and Hygiene, University of Schleswig Holstein, Campus Lübeck, Lübeck; and Medical Clinic and Department of Immunology and Cell Biology, Research Center Borstel, Borstel, Germany
Correspondence and requests for reprints should be addressed to Klaus Dalhoff, M.D., Medizinische Klinik III, Medizinische Universität zu Lübeck, Ratzeburger Allee 160, 23538 Lübeck, Germany. E-mail: klaus.dalhoff{at}medinf.mu-luebeck.de
 |
ABSTRACT
|
|---|
Polymorphisms in the tumor necrosis factor and interleukin-10 genes, linked to cytokine inducibility, may influence the inflammatory response to infection. We studied the biallelic interleukin-101082 promoter, the tumor necrosis factor- -308 promoter, and the lymphotoxin- polymorphisms with regard to the development of septic shock in pneumococcal infection. Sixty-nine patients with pneumococcal disease (61 patients with community-acquired pneumonia, 5 patients with meningitis, and 3 patients with pneumonia and meningitis) and 50 age-matched control subjects were included. The polymorphisms were determined by the polymerase chain reaction. In patients with pneumococcal disease, the lipopolysaccharide-stimulated tumor necrosis factor and interleukin-10 release from whole blood were measured by ELISA. Sepsis severity was documented according to standard criteria. No significant genotypic differences were seen between patients and control subjects. Thirteen of 69 patients with pneumococcal disease developed septic shock. Interleukin-10 allele G homozygous patients had the highest risk for septic shock (odds ratio of 6.1; 95% confidence interval, 1.427.2; corrected p = 0.024). The stimulated interleukin-10 release was highest in interleukin-10 G homozygous patients (p = 0.04). In conclusion, interleukin-10 polymorphism, associated with high interleukin-10 inducibility, might influence the outcome of pneumococcal infection via induced immunosuppression and impaired bacterial clearance.
Key Words: tumor necrosis factor- polymorphism lymphotoxin- polymorphism genetic predisposition
Streptococcus pneumoniae is the most common causative agent of community-acquired pneumonia (1). The majority of patients recover uneventfully; however, despite modern antimicrobial chemotherapy, the fatality rate of severe infection remains high. The morbidity and mortality are related to septic complications and septic shock (2). In the last decade, the prognostic role of the cytokine response in sepsis has been investigated. Tumor necrosis factor- (TNF- ) is a central mediator of the inflammatory response and yields prognostic value in septic patients, whereas the contribution of antiinflammatory cytokines, such as interleukin (IL)-10, to an adverse outcome is controversial (3, 4).
IL-10 is able to counterbalance the potentially harmful inflammatory effects of TNF- and other proinflammatory molecules (5). However, it has recently been proposed that IL-10 excess is able to induce immunosuppression in bacterial sepsis (6) and increases mortality by impairing bacterial clearance in pneumococcal pneumonia (7). Large interindividual differences in the degree of TNF- and IL-10 inducibility have been observed. Single nucleotide polymorphisms, especially the biallelic TNF- -308 gene promoter, the lymphotoxin- (LT- ), and the IL-101082 gene promoter polymorphism, have been associated with different cytokine production (810).
Epidemiologic family studies have shown a genetic predisposition for infection-related mortality (11). Susceptibility for invasive pneumococcal disease has been associated with the mannose binding lectin gene, but no genetic linkage has been found for sepsis severity (12). Several authors showed increased IL-10 blood levels in patients with severe sepsis or septic shock (3, 1315), but an influence of IL-10 polymorphisms on the severity of sepsis has not been evaluated. In community-acquired pneumonia, the risk for septic shock has been associated with the LT- polymorphism (16).
A better understanding of factors that determine the individual immune response to infection seems to be crucial. We hypothesized that patients with genetic predisposition for increased IL-10 inducibility, as determined by the IL-101082 polymorphism, may have a higher risk of severe pneumococcal infection leading to septic shock. In addition, we examined the influence of a genetic predisposition for TNF- inducibility, the main counterpart of IL-10, determined by the previously mentioned polymorphisms. Some of the results of this study have been previously reported in abstract form (17, 18).
 |
METHODS
|
|---|
Patients
From December 1998 until May 2002, 69 hospitalized patients with culture-proven, community-acquired, invasive pneumococcal infection were investigated in a prospective manner. Patients with defined immunodeficiencies (hematologic or solid neoplasia, glucocorticoid or cytotoxic therapy, human immunodeficiency virus infection, or immunoglobulin deficiency) were excluded from the study. All patients were of white origin. Diagnosis of pneumococcal infection was made by cultural recovery of S. pneumoniae from blood (n = 39), cerebrospinal fluid (n = 3), bronchoalveolar lavage with 104 cfu/ml or more (n = 8), sputum or tracheal secretions (more than 25 polymorphonuclear leukocytes and less than 10 squamous cells per high-power field, n = 11), pleural fluid (n = 3), bronchoalveolar lavage and blood (n = 2), or cerebrospinal fluid and blood (n = 3). Sixty-one patients had pneumonia. Five patients had meningitis, and three patients had pneumonia and meningitis. The diagnosis of pneumonia was based on clinical symptoms, a new or progressive infiltrate on chest X-ray, and laboratory signs of infection. The diagnosis of meningitis was based on a typical clinical presentation and a marked neutrophilic pleocytosis in the cerebrospinal fluid. Comorbidities, laboratory parameters of inflammation, septic complications, and mortality were prospectively assessed. Septic complications included empyema, septic metastases, acute renal failure, disseminated intravascular coagulopathy, and respiratory insufficiency. The clinical status, including the sepsis severity, the acute physiology score, and the acute physiologic and chronic health evaluation score, was documented at Day 1. Demographic and clinical data are shown in Table 1
.
View this table:
[in this window]
[in a new window]
|
TABLE 1. Demographic data, sepsis severity, acute physiology score, acute physiologic and chronic health evaluation score and mortality of 69 patients with pneumococcal disease
|
|
Informed written consent was obtained from all patients or close relatives. The study protocol was approved by the local ethics committee at the University of Lübeck.
Sepsis Definition
The classification of sepsis severity (nonsepsis, sepsis, severe sepsis, and septic shock) was made according to the definition given by the American College of Chest Physicians Society of Critical Care Medicine Consensus Conference 1992, adapted by Bone and colleagues (19). To meet the criteria of septic shock, a documented systolic blood pressure of less than 90 mm Hg for at least 30 minutes in the absence of other causes of shock and at least 4 hours of inotropic support after adequate fluid replacement were required. Sepsis stratification was done in the first 24 hours. All patients were reevaluated at Day 2 and remained in their clinical category.
Control Group
Fifty unrelated age- and sex-matched patients, all of white origin, admitted for elective hip or knee surgery without signs of inflammatory disease served as a control group.
Gene Polymorphism Analysis
Analysis was done as published previously (9, 20, 21) and is described in more detail in the online supplement. Genomic DNA from ethylenediaminetetraacetic acid blood samples was amplified by polymerase chain reaction and was monitored by agarose gel electrophoresis: TNF- -308 promoter (20): primer 5'-AGGCAATAGGTTTTGAGGGCCAT-3', 5'-TCCTCCCTGCTCCGATTCCG-3', cycling conditions, 38 cycles of 1 minute at 94°C, 1 minute at 60°C, 1.5 minutes (+2 seconds per cycle) at 72°C, product 107 bp. LT- (9): primer 5'-CCGTGCTTCGTGCTTTGGACTA-3', 5'-AGAGGGGTGGATGCTTGGGTTC-3', cycling conditions analogous to TNF but annealing at 70°C, product 782 bp. Restriction with NcoI produced for TNF- fragments of 87 and 20 bp (TNF allele G) and 107 bp (TNF allele A) and for LT- fragments of 586 and 196 bp (LT allele G) and 782 bp (LT allele A). IL-101082: The amplification refractory mutation system polymerase chain reaction was used (21). For each sample, two parallel reactions were performed. The primer pair generic/IL-10 A amplified the IL-10 allele A; generic/IL-10 G amplified the IL-10 allele G. A human growth hormone sequence was used as an internal control.
Primers used were as follows: IL-10 primer: generic primer antisense 5' CAGTGCCAACTGAGAATTTGG 3', IL-10 primer A sense 5'-ACTACTAAGGCTTCTTTGGGAA-3'; IL-10 primer G sense 5'- CTACTAAGGCTTCTTTGGGAG-3', products 258 bp.
The control primer was antisense 5'-GCCTTCCCAACCATTCCCTTA-3', sense 5'-TCACGGATTTCTGTTGTGTTTC-3', product 429 bp.
The cycling condition was 10 cycles for 1 minute at 95°C, 50 seconds at 65°C and 50 seconds at 72°C, followed by 20 cycles for 1 minute at 95°C, 50 seconds at 59°C, and 50 seconds at 72°C.
Whole Blood Cytokine Stimulation Assay
Whole blood was taken for determination of lipopolysaccharide (LPS)-stimulated TNF and IL-10 release in 58 of 69 patients with pneumococcal disease at the end of the hospital stay, when the C-reactive protein level was below 5 mg/L. This time point was chosen to prevent an influence of the acute inflammatory episode on cytokine stimulation. Blood samples were incubated and analyzed as described previously (22). In brief, 1:10 diluted heparinized blood was stimulated with 1 µg/mL of LPS from Escherichia coli serotype 026:B6 (Sigma, St. Louis, MO). Samples and controls without LPS were incubated at 37°C for 24 hours. TNF- and IL-10 were measured in the cell free supernatant by commercially available ELISA kits (Laboserv, Giessen, Germany, and Biosource, Camarillo, CA).
Statistical Analysis
Fisher's exact test (two-tailed) was used to test for the association of septic shock and genotype IL-10 GG versus AG/AA, genotype TNF- AA versus AG/GG, and genotype LT- AA versus AG/GG. The CochraneArmitage test was used for trend of categoric variables. Because of the multiple comparisons made, p values were corrected by multiplying the number of tests performed (Bonferroni procedure), namely three genotype polymorphisms.
Because a deviation from HardyWeinberg equilibrium, evaluated by comparing observed and expected genotype frequencies with an exact goodness of fit test, was observed in the patients with septic shock at the IL-10 genotype (p = 0.02), allele frequencies were not used for statistical analysis of septic shock. Continuous variables were compared by the Mann-Whitney U test (values are given in mean and standard error). Correlations were tested with Spearman's rank correlation; p values of less than 0.05 were considered significant (23). All statistical calculations were performed using StatXact version 5.0 (Cytel Software Corporation, Cambridge, MA).
 |
RESULTS
|
|---|
Cytokine Genotype Distribution in Healthy Control Subjects versus Patients
No difference in the distribution of TNF- , LT- , and IL-10 genotype was seen between patients (IL-10: AA 36%, AG 41%, GG 23%; allele frequency A/G: 0.56/0.44; TNF- : AA 3%, AG 26%, GG 71%; A/G: 0.17/0.83; LT- : AA 39%, AG 51%; GG 10%; A/G: 0.65/0.35) and control subjects (IL-10: AA 40%, AG 34%, GG26%; A/G: 0.57/0.43; TNF- : AA 8%, AG 26%, GG 66%; A/G: 0.21/0.79; LT- : AA 48%, AG 44%, GG 4%; A/G: 0.74/0.26). In addition, no difference was seen in comparison to published control subjects (24, 25). The complete data are shown in Table E1 in the online supplement.
Sepsis Severity and Clinical Course of Pneumococcal Infection in Association to Genotype IL-101082 Gene Polymorphism
Patients homozygous for allele IL-101082 G (IL-10 GG) had a significantly increased risk to develop severe pneumococcal disease: 54% of patients with septic shock were IL-10 GG compared with 16% of patients without septic shock (Figure 1)
. The odds ratio for IL-10 GG was significantly increased in patients with septic shock (Fisher's exact: odds ratio, 6.1; 95% confidence interval, 1.4 27.2; corrected p = 0.024). The CochraneArmitage trend test showed an increasing odds ratio for genotype IL-10 GG association to sepsis severity (corrected p = 0.027; Table 2) . IL-10 GG patients had a higher mean acute physiologic and chronic health evaluation score (17.3 ± 5.1 vs. 13.8 ± 7.3, p = 0.045), more complications (one complication or more: 62.5% vs. 43.2%, p = 0.037), and a trend for increased mortality (18.8% vs. 3.8%, p = 0.076).

View larger version (40K):
[in this window]
[in a new window]
|
Figure 1. IL-101082 genotype distribution in control patients (CP) versus patients with pneumococcal disease (PP, p = NS) and pneumoccocal disease patients with septic shock (SS) versus no septic shock (nSS). *Corrected p = 0.024 for IL-10 GG (Fisher's exact test). (Dark gray bars) IL-10 AA. (Light gray bars) IL-10 AG. (White bars) IL-10 GG.
|
|
View this table:
[in this window]
[in a new window]
|
TABLE 2. Association between genotype INTERLEUKIN-101082 gg and sepsis severity tested with the cochranearmitage trend test
|
|
TNF Gene Polymorphism
No association was found between the TNF- allele A or LT- allele A homozygous genotypes and sepsis severity, acute physiologic and chronic health evaluation, mortality, or complications (Table E2 in the online supplement). However, because of the low number of TNF- allele A homozygous patients, we cannot exclude associations of the TNF- -308 genotype to the severity of pneumococcal infection.
Functional Relevance of IL-10 G, TNF- A, and LT- A Homozygous Genotypes
IL-10 GG patients with pneumococcal infection are IL-10 "high responders" with regard to the LPS-stimulated cytokine release from whole blood (IL-10 GG vs. non IL-10 GG, 628 ± 92 vs. 431 ± 49 pg/ml; p = 0.04) (Figure 2)
. We did not see an influence of the LT- AA genotype on LPS-induced TNF- levels (data not shown). Because only two patients were TNF- A homozygous, we are not able to give a statistical analysis for this genotype. There was no correlation between IL-10 levels and TNF- levels after whole blood stimulation (r = 0.22, Figure E1 in the online supplement).

View larger version (10K):
[in this window]
[in a new window]
|
Figure 2. Lipopolysaccharide-stimulated whole-blood IL-10 concentrations (levels indicate mean) in 58 patients with pneumococcal disease according to IL-101082 genotype. IL-10 concentrations in IL-10 GG patients versus IL-10 A/G or IL-10 A/A patients (p = 0.04).
|
|
Cytokine Phenotype in Association to Septic Shock
Septic shock patients had higher LPS-induced TNF- levels compared with patients without septic shock (2,560 ± 464 vs. 1,383 ± 182 pg/ml, p = 0.014). IL-10 levels were not increased in patients with septic shock, but three of seven IL-10 GG patients with septic shock died before testing.
 |
DISCUSSION
|
|---|
Our study reveals an association between patients homozygous for the IL-101082 allele G and sepsis severity in pneumococcal infection, with the strongest effect being on the development of septic shock. In addition, more evidence for an influence on the clinical course of infection is provided by the fact that, with a higher acute physiologic and chronic health evaluation score, more septic complications and a trend to a higher mortality were associated with the IL-10 GG genotype. The increased LPS-induced IL-10 production in IL-10 G homozygous patients indicates that the predisposition for severe pneumococcal disease is due to an enhanced IL-10 release in response to microbial stimuli. In contrast, we were not able to show an association between the TNF genotypes and sepsis severity, despite increased LPS-induced TNF- production in patients with septic shock. In case of TNF- , this may be due to the low number of TNF- homozygous patients in the study.
The genetic component for IL-10 release on LPS stimulation is thought to determine between 50% (26) and 75% (27) of the IL-10 production. Several single nucleotide polymorphisms in the 5' promoter region of the IL-10 gene mapped to chromosome 1 have been identified (28). In our study, we focused on the IL-101082 polymorphism because former studies showed a relevant influence of the IL-101082 allele G for increased IL-10 production. Stimulated mononuclear cells from patients homozygous for IL-10 G have a higher transcriptional activity and secrete higher levels of IL-10 (10, 29). Our data demonstrating increased IL-10 inducibility in a clinically relevant patient population underline the role of genotype IL-10 G for the IL-10 "high secretor" phenotype.
The innate immune response to severe bacterial infections is orchestrated by the proinflammatory cytokines TNF, IL-1, IL-6, and IL-8 (19, 30). An antiinflammatory reaction involving IL-10 parallels the excessive production and may induce a state of immunosuppression in patients with sepsis (19). There is considerable evidence in the literature that IL-10 can either improve or worsen health status depending on the model evaluated. Mice lacking any IL-10 response due to an inherited deficiency have higher lethality due to septic shock, possibly because of uninhibited proinflammatory reactions (4). In contrast, treatment with exogenous IL-10 in a model of pneumococcal pneumonia led to an impaired host defense (7). IL-10 influences the immune response via downregulation of proinflammatory cytokine release and inhibition of class II major histocompatibility complex expression, resulting in impaired bacterial clearance (31). Reduced antimicrobial activity of macrophages infected by intracellular bacteria caused by persistent release of IL-10 may contribute to immune dysfunction in septic shock (32, 33). In addition, IL-10 influences adaptive immunity in sepsis via downregulation of monocyte HLA-DR expression due to intracellular sequestration (34). Taken together, these data indicate that IL-10 is necessary to counterbalance proinflammatory reactions, but IL-10 overexpression might increase mortality due to unresolved infection.
Increased morbidity and mortality in patients with high IL-10 levels were observed in different bacterial infections: Pneumonia severity (35) and mortality risk of febrile patients admitted to the emergency room were elevated in patients with high IL-10 plasma levels (36). During septic shock, serum levels of IL-10 are increased and are associated with higher mortality (30, 31, 35, 37, 38). Westendorp and colleagues found an increased risk of fatal outcome of meningococcal disease in families known to be IL-10 high responders (27). Genotype analysis showed an association of the combined genotypes of Fc receptor and IL-101082 to severe meningococcal disease (39). Interestingly Girndt and colleagues demonstrated a trend toward higher mortality caused by infectious complications in IL-10 allele G homozygous dialysis patients (40). Regarding mycobacterial infection, a recent study did not observe an association of the IL-101082 genotype to the incidence of Mycobacterium tuberculosis infection (41). In our cohort, we did not see an increased incidence of pneumococcal infection; however, patients with genetic predisposition for high IL-10 release showed a linear increasing risk for more severe pneumococcal disease, with the highest risk for septic shock. In the phenotypic assay, IL-10 G homozygous patients were IL-10 "high responders." Enhanced IL-10 inducibility is possibly the reason for reduced bacterial clearance followed by septic complications.
A genetic predisposition for a TNF- "high secretor" phenotype is suspected to be associated with a higher risk caused by infectious diseases, as higher TNF- serum levels and higher mortality caused by surgical septic shock are seen in patients with homozygous LT- allele A (9, 42). In community-acquired pneumonia, LT- AA homozygote patients were 2.5 times more likely to develop septic shock compared with non-AA homozygotes (16). Conflicting results have been reported for the influence of the TNF- -308 promoter polymorphism on sepsis outcome (43, 44). We found in patients with pneumococcal disease an association of the TNF- "high secretor" phenotype to septic shock. However, we were not able to associate the LT- or TNF- polymorphism to septic shock or TNF- "high secretor" phenotype. These discrepancies may be explained in part by the different study design. In contrast to previous authors who evaluated patients with community-acquired pneumonia or severe sepsis irrespective of microbial etiology (9, 16), in our cohort, all patients were infected with S. pneumoniae. Because of the low number of TNF- allele A homozygous patients, we cannot exclude associations of the TNF- -308 genotype to the severity of pneumococcal infection.
Modulation of TNF- or IL-10 activity in sepsis patients has been the subject of multiple studies. Individual genetic differences in IL-10 and TNF- inducibility and the timing of therapeutic interventions may have a complex influence on disease outcome (45). Neutralization of TNF- in pneumococcal pneumonia in mice and in patients with septic shock resulted in an increased mortality (46, 47). Exogenous IL-10 administration in experimental sepsis in mice decreased TNF- levels 90% but failed to decrease mortality or morbidity (48). In experimental models of pneumonia in mice caused by S. pneumoniae, administration of IL-10 resulted in early dissemination of S. pneumoniae into the blood with increased bacterial load compared with control animals (49). Interestingly, the addition of IL-10 to antibiotic therapy attenuated proinflammatory alterations and improved survival (49). In our study, septic shock was associated with IL-10 "high secretor" genotype and TNF- "high secretor" phenotype. Increased TNF production in these patients may be followed by IL-10 overexpression leading to immunosuppression. In this context, genetic analysis might provide novel insights into patient susceptibility to disease, a better assessment of prognostic risk factors and predictability of individual responsiveness to drugs.
In summary, the IL-101082 G genotype associated with increased IL-10 release seems to be a risk factor for septic shock in pneumococcal infection. Our data support the concept that a strong antiinflammatory response during severe bacterial infection could be harmful by causing immunosuppression. Larger studies are warranted to elucidate whether the IL-10 genotype is of prognostic value in pneumococcal disease.
 |
Acknowledgments
|
|---|
The authors acknowledge the clinical cooperation of T.H. Hütteroth, Lübeck, G. Hintze, Bad Oldesloe, H-P Schrenk, Bad Segeberg, R. Thielecke, Lübeck-Travemünde; the expert and dedicated technical assistance of S. Ross, M. Kernbach, U. Wegener, and B. Gogol; and helpful discussions with H. Lode, Berlin.
 |
FOOTNOTES
|
|---|
This article has an online supplement, which is accessible from this issue's table of contents online at www.atsjournals.org
Received in original form October 11, 2002;
accepted in final form May 4, 2003
 |
REFERENCES
|
|---|
- Marrie TJ. Community-acquired pneumonia in the elderly. Clin Infect Dis 2000;4:10661078.
- Georges H, Leroy O, Vandenbussche C, Guery B, Alfandari S, Tronchon L, Beaucaire G. Epidemiological features and prognosis of severe community-acquired pneumococcal pneumonia. Intensive Care Med 1999;25:198206.[CrossRef][Medline]
- Rodriguez-Gaspar M, Santolaria F, Jarque-Lopez A, Gonzalez-Reimers E, Milena A, de la Vega MJ, Rodriguez-Rodriguez E, Gomez-Sirvent JL. Prognostic value of cytokines in SIRS general medical patients. Cytokine 2001;15:232236.[CrossRef][Medline]
- Latifi SQ, O'Riordan MA, Levine AD. Interleukin-10 controls the onset of irreversible septic shock. Infect Immun 2002;70:44414446.[Abstract/Free Full Text]
- van der Poll T, Marchant A, van Deventer SJ. The role of interleukin-10 in the pathogenesis of bacterial infection. Clin Microbiol Infect 1997;3:605607.[Medline]
- Steinhauser ML, Hogaboam CM, Kunkel SL, Lukacs NW, Strieter RM, Standiford TJ. IL-10 is a major mediator of sepsis-induced impairment in lung antibacterial host defense. J Immunol 1999;162:392399.[Abstract/Free Full Text]
- van der Poll T, Marchant A, Keogh CV, Goldman M, Lowry SF. Interleukin-10 impairs host defense in murine pneumococcal pneumonia. J Infect Dis 1996;174:9941000.[Medline]
- Louis E, Franchimont D, Piron A, Gevaert Y, Schaaf-Lafontaine N, Roland S, Mahieu P, Malaise M, De Groote D, Louis R, et al. Tumour necrosis factor (TNF) gene polymorphism influences TNF-alpha production in lipopolysaccharide (LPS)-stimulated whole blood cell culture in healthy humans. Clin Exp Immunol 1998;113:401406.[CrossRef][Medline]
- Stuber F, Petersen M, Bokelmann F, Schade U. A genomic polymorphism within the tumor necrosis factor locus influences plasma tumor necrosis factor-alpha concentrations and outcome of patients with severe sepsis. Crit Care Med 1996;24:381384.[CrossRef][Medline]
- Turner DM, Williams DM, Sankaran D, Lazarus M, Sinnott PJ, Hutchinson IV. An investigation of polymorphism in the interleukin-10 gene promoter. Eur J Immunogenet 1997;24:18.[Medline]
- Sorensen TI, Nielsen GG, Andersen PK, Teasdale TW. Genetic and environmental influences on premature death in adult adoptees. N Engl J Med 1988;318:727732.[Abstract]
- Roy S, Knox K, Segal S, Griffiths D, Moore CE, Welsh KI, Smarason A, Day NP, McPheat WL, Crook DW, et al. MBL genotype and risk of invasive pneumococcal disease: a case-control study. Lancet 2002;359:15691573.[CrossRef][Medline]
- Friedman G, Jankowski S, Marchant A, Goldman M, Kahn RJ, Vincent JL. Blood interleukin 10 levels parallel the severity of septic shock. J Crit Care 1997;12:183187.[CrossRef][Medline]
- Gomez-Jimenez J, Martin MC, Sauri R, Segura RM, Esteban F, Ruiz JC, Nuvials X, Boveda JL, Peracaula R, Salgado A. Interleukin-10 and the monocyte/macrophage-induced inflammatory response in septic shock. J Infect Dis 1995;171:472475.[Medline]
- Derkx B, Marchant A, Goldman M, Bijlmer R, van Deventer S. High levels of interleukin-10 during the initial phase of fulminant meningococcal septic shock. J Infect Dis 1995;171:229232.[Medline]
- Waterer GW, Quasney MW, Cantor RM, Wunderink RG. Septic shock and respiratory failure in community-acquired pneumonia have different TNF polymorphism associations. Am J Respir Crit Care Med 2001;163:15991604.[Abstract/Free Full Text]
- Schaaf B, Böhmke F, Esnaashari H, Rupp J, Maass M, Zabel P, Dalhoff K. IL 10 polymorphism in pneumococcal infection: association with septic shock [abstract]. San Diego: 42nd Interscience Conference on Antimicrobial Agents and Chemotherapy; 2002;B-953, p. 48.
- Schaaf B, Esnaashari H, Seitzer U, Zabel P, Maass M, Katus H, Dalhoff K. Does TNF alpha gene polymorphism predispose for severe pneumococcal infection? [abstract] Eur Respir J 2000;16:513s.
- Bone RC, Grodzin CJ, Balk RA. Sepsis: a new hypothesis for pathogenesis of the disease process. Chest 1997;112:235243.[Free Full Text]
- Wilson AG, di Giovine FS, Blakemore AIF, Duff GW. Single base polymorphism in the human tumour necrosis factor alpha gene detectable by NcoI restriction of PCR product. Hum Mol Genet 1992;1:353.[Free Full Text]
- Perrey C, Turner SJ, Pravica V, Howell WM, Hutchinson IV. ARMS-PCR methodologies to determine IL-10, TNF-alpha, TNF-beta and TGF-beta 1 gene polymorphisms. Transpl Immunol 1999;7:127128.[CrossRef][Medline]
- Dalhoff K, Hansen F, Dromann D, Schaaf B, Aries SP, Braun J. Inhibition of neutrophil apoptosis and modulation of the inflammatory response by granulocyte colony-stimulating factor in healthy and ethanol-treated human volunteers. J Infect Dis 1998;178:891895.[Medline]
- Westfall PH, Young SS. Resampling-based multiple testing. New York: John Wiley; 1993.
- Reynard MP, Turner D, Navarrete CV. Allele frequencies of polymorphisms of the tumour necrosis factor-alpha, interleukin-10, interferon-gamma and interleukin-2 genes in a North European Caucasoid group from the UK. Eur J Immunogenet 2000;27:241249.[CrossRef][Medline]
- Seitzer U, Swider C, Stuber F, Suchnicki K, Lange A, Richter E, Zabel P, Muller-Quernheim J, Flad HD, Gerdes J. Tumour necrosis factor alpha promoter gene polymorphism in sarcoidosis. Cytokine 1997;9:787790.[CrossRef][Medline]
- Reuss E, Fimmers R, Kruger A, Becker C, Rittner C, Hohler T. Differential regulation of interleukin-10 production by genetic and environmental factors: a twin study. Genes Immun 2002;3:407413.[CrossRef][Medline]
- Westendorp RG, Langermans JA, Huizinga TW, Elouali AH, Verweij CL, Boomsma DI, Vandenbroucke JP, Vandenbrouke JP. Genetic influence on cytokine production and fatal meningococcal disease. Lancet 1997;349:170173.[CrossRef][Medline]
- Gibson AW, Edberg JC, Wu J, Westendorp RG, Huizinga TW, Kimberly RP. Novel single nucleotide polymorphisms in the distal IL-10 promoter affect IL-10 production and enhance the risk of systemic lupus erythematosus. J Immunol 2001;166:39153922.[Abstract/Free Full Text]
- Miura Y, Thoburn CJ, Bright EC, Chen W, Nakao S, Hess AD. Cytokine and chemokine profiles in autologous graft-versus-host disease (GVHD): interleukin 10 and interferon gamma may be critical mediators for the development of autologous GVHD. Blood 2002;100:26502658.[Abstract/Free Full Text]
- Simpson SQ, Singh R, Bice DE. Heat-killed pneumococci and pneumococcal capsular polysaccharides stimulate tumor necrosis factor-alpha production by murine macrophages. Am J Respir Cell Mol Biol 1994;10:284289.[Abstract]
- Zanotti S, Kumar A, Kumar A. Cytokine modulation in sepsis and septic shock. Expert Opin Investig Drugs 2002;11:10611075.[CrossRef][Medline]
- Bogdan C, Nathan C. Modulation of macrophage function by transforming growth factor beta, interleukin-4, and interleukin-10. Ann N Y Acad Sci 1993;685:713739.[Medline]
- Sfeir T, Saha DC, Astiz M, Rackow EC. Role of interleukin-10 in monocyte hyporesponsiveness associated with septic shock. Crit Care Med 2001;29:129133.[CrossRef][Medline]
- Fumeaux T, Pugin J. Role of interleukin-10 in the intracellular sequestration of human leukocyte antigen-DR in monocytes during septic shock. Am J Respir Crit Care Med 2002;166:14751482.[Abstract/Free Full Text]
- Glynn P, Coakley R, Kilgallen I, Murphy N, O'Neill S. Circulating interleukin 6 and interleukin 10 in community acquired pneumonia. Thorax 1999;54:5155.[Abstract/Free Full Text]
- van Dissel JT, van Langevelde P, Westendorp RG, Kwappenberg K, Frolich M. Anti-inflammatory cytokine profile and mortality in febrile patients. Lancet 1998;351:950953.[Medline]
- Gogos CA, Drosou E, Bassaris HP, Skoutelis A. Pro- versus antiinflammatory cytokine profile in patients with severe sepsis: a marker for prognosis and future therapeutic options. J Infect Dis 2000;181:176180.[CrossRef][Medline]
- Marchant A, Deviere J, Byl B, De Groote D, Vincent JL, Goldman M. Interleukin-10 production during septicaemia. Lancet 1994;343:707708.[CrossRef][Medline]
- van der Pol WL, Huizinga TW, Vidarsson G, van der Linden MW, Jansen MD, Keijsers V, de Straat FG, Westerdaal NA, de Winkel JG, Westendorp RG. Relevance of Fcgamma receptor and interleukin-10 polymorphisms for meningococcal disease. J Infect Dis 2001;184:15481555.[CrossRef][Medline]
- Girndt M, Kaul H, Sester U, Ulrich C, Sester M, Georg T, Kohler H. Anti-inflammatory interleukin-10 genotype protects dialysis patients from cardiovascular events. Kidney Int 2002;62:949955.[CrossRef][Medline]
- Lopez-Maderuelo D, Arnalich F, Serantes R, Gonzalez A, Codoceo R, Madero R, Vazquez JJ, Montiel C. Interferon gamma and interleukin-10 gene polymorphisms in pulmonary tuberculosis. Am J Respir Crit Care Med 2003;167:970975.[Abstract/Free Full Text]
- Appoloni O, Dupont E, Vandercruys M, Andriens M, Duchateau J, Vincent JL. Association of tumor necrosis factor-2 allele with plasma tumor necrosis factor-alpha levels and mortality from septic shock. Am J Med 2001;110:486488.[CrossRef][Medline]
- Mira JP, Cariou A, Grall F, Delclaux C, Losser MR, Heshmati F, Cheval C, Monchi M, Teboul JL, Riche F, et al. Association of TNF2, a TNF-alpha promoter polymorphism, with septic shock susceptibility and mortality: a multicenter study. JAMA 1999;282:561568.[Abstract/Free Full Text]
- Tang GJ, Huang SL, Yien HW, Chen WS, Chi CW, Wu CW, Lui WY, Chiu JH, Lee TY. Tumor necrosis factor gene polymorphism and septic shock in surgical infection. Crit Care Med 2000;28:27332736.[CrossRef][Medline]
- Kalechman Y, Gafter U, Gal R, Rushkin G, Yan D, Albeck M, Sredni B. Anti-IL-10 therapeutic strategy using the immunomodulator AS101 in protecting mice from sepsis-induced death: dependence on timing of immunomodulating intervention. J Immunol 2002;169:384392.[Abstract/Free Full Text]
- van der Poll T, Keogh CV, Buurman WA, Lowry SF. Passive immunization against tumor necrosis factor-alpha impairs host defense during pneumococcal pneumonia in mice. Am J Respir Crit Care Med 1997;155:603608.[Abstract]
- Fisher CJ Jr, Agosti JM, Opal SM, Lowry SF, Balk RA, Sadoff JC, Abraham E, Schein RM, Benjamin E. Treatment of septic shock with the tumor necrosis factor receptor:Fc fusion protein: the Soluble TNF Receptor Sepsis Study Group. N Engl J Med 1996;334:16971702.[Abstract/Free Full Text]
- Remick DG, Garg SJ, Newcomb DE, Wollenberg G, Huie TK, Bolgos GL. Exogenous interleukin-10 fails to decrease the mortality or morbidity of sepsis. Crit Care Med 1998;26:895904.[CrossRef][Medline]
- Wang E, Simard M, Ouellet N, Bergeron Y, Beauchamp D, Bergeron MG. Modulation of cytokines and chemokines, limited pulmonary vascular bed permeability, and prevention of septicemia and death with ceftriaxone and interleukin-10 in pneumococcal pneumonia. J Infect Dis 2000;182:12551259.[CrossRef][Medline]
This article has been cited by other articles:

|
 |

|
 |
 
R Menendez, R Martinez, S Reyes, J Mensa, X Filella, M A Marcos, A Martinez, C Esquinas, P Ramirez, and A Torres
Biomarkers improve mortality prediction by prognostic scales in community-acquired pneumonia
Thorax,
July 1, 2009;
64(7):
587 - 591.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. C. Deans, B. H. Tan, J. A Ross, M. Rose-Zerilli, S. J Wigmore, W M. Howell, R. F Grimble, and K. C. Fearon
Cancer cachexia is associated with the IL10 -1082 gene promoter polymorphism in patients with gastroesophageal malignancy
Am. J. Clinical Nutrition,
April 1, 2009;
89(4):
1164 - 1172.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Flores, H. L. DuPont, S. A. Lee, J. Belkind-Gerson, M. Paredes, J. A. Mohamed, L. Y. Armitige, D.-C. Guo, and P. C. Okhuysen
Influence of Host Interleukin-10 Polymorphisms on Development of Traveler's Diarrhea Due to Heat-Labile Enterotoxin-Producing Escherichia coli in Travelers from the United States Who Are Visiting Mexico
Clin. Vaccine Immunol.,
August 1, 2008;
15(8):
1194 - 1198.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. Hjuler, G. Poulsen, J. Wohlfahrt, M. Kaltoft, R. J. Biggar, and M. Melbye
Genetic Susceptibility to Severe Infection in Families with Invasive Pneumococcal Disease
Am. J. Epidemiol.,
April 1, 2008;
167(7):
814 - 819.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. Menendez and A. Torres
Treatment Failure in Community-Acquired Pneumonia
Chest,
October 1, 2007;
132(4):
1348 - 1355.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
P. V. Giannoudis, M. van Griensven, E. Tsiridis, and H. C. Pape
The genetic predisposition to adverse outcome after trauma
J Bone Joint Surg Br,
October 1, 2007;
89-B(10):
1273 - 1279.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
B. Schaaf, J. Kruse, J. Rupp, R. R. Reinert, D. Droemann, P. Zabel, S. Ewig, and K. Dalhoff
Sepsis severity predicts outcome in community-acquired pneumococcal pneumonia
Eur. Respir. J.,
September 1, 2007;
30(3):
517 - 524.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
P.-A. Krayenbuehl, F. E. Maly, M. Hersberger, P. Wiesli, A. Himmelmann, K. Eid, P. Greminger, W. Vetter, and G. Schulthess
Tumor Necrosis Factor-{alpha} -308G>A Allelic Variant Modulates Iron Accumulation in Patients with Hereditary Hemochromatosis
Clin. Chem.,
August 1, 2006;
52(8):
1552 - 1558.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. N. Gong, B. T. Thompson, P. L. Williams, W. Zhou, M. Z. Wang, L. Pothier, and D. C. Christiani
Interleukin-10 polymorphism in position -1082 and acute respiratory distress syndrome.
Eur. Respir. J.,
April 1, 2006;
27(4):
674 - 681.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Wattanathum, S. Manocha, H. Groshaus, J. A. Russell, and K. R. Walley
Interleukin-10 Haplotype Associated With Increased Mortality in Critically Ill Patients With Sepsis From Pneumonia But Not in Patients With Extrapulmonary Sepsis
Chest,
September 1, 2005;
128(3):
1690 - 1698.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. Alberti, C. Brun-Buisson, S. Chevret, M. Antonelli, S. V. Goodman, C. Martin, R. Moreno, A. R. Ochagavia, M. Palazzo, K. Werdan, et al.
Systemic Inflammatory Response and Progression to Severe Sepsis in Critically Ill Infected Patients
Am. J. Respir. Crit. Care Med.,
March 1, 2005;
171(5):
461 - 468.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. M. Sutherland, K. R. Walley, S. Manocha, and J. A. Russell
The Association of Interleukin 6 Haplotype Clades With Mortality in Critically Ill Adults
Arch Intern Med,
January 10, 2005;
165(1):
75 - 82.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. A. Fox, S. K. Shernan, and S. C. Body
Predictive Genomics of Adverse Events After Cardiac Surgery
Seminars in Cardiothoracic and Vascular Anesthesia,
December 1, 2004;
8(4):
297 - 315.
[Abstract]
[PDF]
|
 |
|

|
 |

|
 |
 
J.A. Preston, K.W. Beagley, P.G. Gibson, and P.M. Hansbro
Genetic background affects susceptibility in nonfatal pneumococcal bronchopneumonia
Eur. Respir. J.,
February 1, 2004;
23(2):
224 - 231.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. J. Tobin
Critical Care Medicine in AJRCCM 2003
Am. J. Respir. Crit. Care Med.,
January 15, 2004;
169(2):
239 - 253.
[Full Text]
[PDF]
|
 |
|
Copyright © 2003 American Thoracic Society
|