Type III Receptor
Gene Transfection Inhibits Fibrous Airway Obliteration
in a Rat Model of Bronchiolitis Obliterans
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| |
ABSTRACT |
|---|
|
|
|---|
Post-transplant bronchiolitis obliterans (BO) is characterized by fibroproliferation and fibrous obliteration of distal airways in chronically rejected lungs. In this study, using a rat heterotopic allogeneic
tracheal transplant model of BO, we evaluated the expression of
transforming growth factor-
(TGF
) during the development of airway fibrous obliteration. Immunohistochemical analysis revealed TGF
staining in infiltrating mononuclear cells at Days 2 and 7, and
in the fibrous tissues until Day 21. Soluble TGF
receptor type III
(TGFBIIIR), by blocking TGF
binding to its membrane receptors,
functions as a TGF
antagonist. To study the role of TGF
in the development of BO, adenoviral-mediated soluble TGFBIIIR gene transfection (5 × 109 particles) was performed topically at the site of
transplant on Day 5 after transplantation, which leads to inhibition
of fibrous airway obliteration. In contrast, empty vector gene delivered through intramuscular injection, or given locally at Days 0 or 10 after tracheal transplantation had no significant effect. These results
suggest that TGF
expressed in the allografts play a pivotal role in
the pathogenesis of BO. Soluble TGFBIIIR may competitively inhibit
TGF
activity locally. Adenoviral-mediated soluble TGFBIIIR gene
transfection should be further explored as a potential therapeutic modality for BO and other conditions involving chronic fibrosis.
| |
INTRODUCTION |
|---|
|
|
|---|
Keywords: lung transplantation; gene therapy; fibrosis; chronic dysfunction
Lung transplantation is an established therapeutic modality for patients with end-stage lung disease. The early postoperative survival is excellent, with operative mortality in the range of 10%. However, more than 50% of patients who survive more than 1 yr after transplantation will develop fibrous obliteration of the small airways, or bronchiolitis obliterans (BO) (1), which is characterized by progressive shortness of breath and lung dysfunction that relentlessly progresses to death. This is the major factor that currently limits the long-term success of human lung transplantation.
BO is manifested as progressive fibroproliferation of small
airways and thought to be a consequence of pathologic repair
processes after graft injury. Transforming growth factor-
(TGF
),
a potent immunosuppressive cytokine, promotes fibrosis by enhancing the production and deposition of extracellular matrix
components. Several studies have demonstrated overexpression of TGF
mRNA or increased production of TGF
in the
lungs of patients with chronic rejection after transplantation.
For example, the gene expression of TGF
in alveolar cells
demonstrated marked peaks that preceded the diagnosis of rejection by several months (2). El-Gamel and colleagues (3)
found that TGF
1 was heavily expressed in lung sections with
fibrosis, and this expression correlated positively with the grade
of fibrosis in lung transplants. TGF
expression was greater in
patients with BO in comparison to patients without BO. Positive staining of TGF
preceded the histologic confirmation of
BO by 6 to 18 mo (4). Similar observations have also been reported from other organ transplantation. For example, overexpression of TGF
isoforms was found in patients with chronic
rejection after kidney transplantation (5); TGF
1-expressing macrophages were found in fibrotic tissues from chronically rejected human liver allografts (6), and TGF
staining in cardiac
allografts was higher in patients with more severe graft vasculopathy (7). These results imply that TGF
plays an important
role in the process of organ rejection by mediating the fibrotic
process. It has been suggested that strategies to inhibit the actions of TGF
might improve the function and survival of lung
(3, 4), cardiac (7), and other allografts.
TGF
signals through a heteromeric complex of protein kinase receptors (types I and II receptors) that has a limited
ability to bind ligand, which can be overcome by the action of
betaglycan (TGF
type III receptor), a membrane-anchored
TGF
-binding protein (8). Membrane betaglycan presents
TGF
directly to the type II signaling receptor, a transmembrane serine/threonine kinase, forming a high affinity ternary
complex. Therefore, it enhances cell responsiveness to TGF
,
and eliminates marked biologic differences between TGF
isoforms (8). The extracellular region of betaglycan can be
shed by cells. It has been shown that recombinant soluble betaglycan acts as a potent inhibitor of TGF
binding to membrane receptors, and thus it blocks TGF
action (9). In the
present study, gene encoding the extracellular domain of betaglycan was constructed into an adenoviral-mediated transfection vector, to test whether soluble TGF
type III receptor
(TGFBIIIR) functioning as a TGF
antagonist could competitively inhibit the function of TGF
in mediating allograft-induced fibrous airway obliteration.
A heterotopic tracheal transplant murine model developed by
Hertz and colleagues (10) has been used to study the role of platelet-derived growth factor and basic fibroblast growth factor in the
pathogenesis of BO (11, 12). Similarly, we have developed a rat
heterotopic tracheal transplant model in which tracheal allografts
develop a peak of lymphocytic infiltration on Day 7, followed by
lumenal fibrous obliteration (13). Using this model we have demonstrated upregulation of mRNAs of Th1 cytokines and chemokines in allografts (14). Using adenovirus-mediated gene transfection of interleukin (IL)-10, or recombinant IL-10, we were able to
prevent the development of fibrous airway obliteration in the tracheal allografts (15). We have also shown that an antibody against
RANTES, a C-C chemokine that downregulates the presence of
CD4+ cells and their function, also inhibits airway obliteration
(16). Furthermore, the angiotensin system also plays a prominent
role in the pathogenesis of fibrosis by activating TGF
expression (17). Using an angiotensin-converting enzyme inhibitor, we were able to inhibit allograft transplant-induced fibrous airway obliteration (18). Therefore, in the present study, this model system was used to further investigate the role of TGF
in the pathogenesis of BO, by targeting the action of TGF
directly using adenoviral-mediated soluble TGFBIIIR gene transfer.
| |
METHODS |
|---|
|
|
|---|
Animals and Tracheal Transplant Operation
Male Brown-Norway and Lewis rats weighing 200 to 300 g were purchased from Harlan Sprague Dawley Inc. (Indianapolis, IN) and Charles River Canada Inc. (St. Constant, Quebec, Canada), respectively. Animal care was provided according to NIH guidelines and approved by the Toronto General Hospital Research Institute Animal Care Committee.
Heterotopic tracheal transplantation was carried out as previously described (13, 15, 16, 18). Briefly, entire trachea of Brown-Norway rat was excised, divided into two equal-sized segments, and then placed into a subcutaneous pouch made in the back of the recipient (Lewis rats). Grafts were removed on the designated days. The middle third of the tracheal segment was fixed with 10% buffered formalin for histologic examination and immunohistochemistry studies.
TGF
Immunohistochemistry
Frozen graft specimens were collected on Days 2, 7, 14, and 21 after
transplantation, and processed as described previously (16). Briefly, 5-µm
sections were placed on poly-L-lysin-coated slides, air-dried, and fixed
with acetone. After blocking with Protein Block Serum-Free solution,
the sections were incubated with polyclonal rabbit anti-TGF
IgG
(Santa Cruz Biotechnology, Santa Cruz, CA) at 1:100 for 30 min. The
secondary antibody and alkaline phosphatase conjugation steps and
color reaction were performed as previously described (16). Negative
control rats were incubated with PBS containing 0.1 % bovine serum albumin without the primary antibody, or with isotype-specific rabbit IgG.
Generation of Recombinant Adenovirus Ad2 TGFBIIIR
The TGFBIIIR gene was amplified from clone #7411 (19) using primers: 5'TGFB-3R-II GTAGAGCTCCACCATGACTTCCCATTAT GTGATTGCCAT and TGFBIII-3'GTGTCTAGACTAGTCCAGACC ATGGAAAATTGGTGG with Vent DNA polymerase (New England Biolabs, Beverly, MA). PCR products were fractionated on a 1% agarose gel, and a 2.2-kb product was purified, digested with Ecll36II-Xba I, and cloned into the Ecor V-Xba I sites of the pAdQUICK shuttle vector pSV2-ICEU I. Recombinant adenovirus was generated as previously described (Figure 1) (20). The transgene expression was confirmed by testing supernatants of 293 cells (ATCC, Rockville, MD) infected with Ad2TGFBIIIR with Western blotting, probed with goat antihuman TGFBIIIR antibody (R&D Systems, Minneapolis, MN).
|
Experimental Groups for Gene Transfection Studies
In the first series of experiments, adenovirus-mediated soluble TGFBIIIR gene vector (5 × 109 particles) was administered topically at the site of allograft at Days 0, 5, and 10 postoperatively. An untreated control group was included for comparison. In the second series of experiments, adenovirus containing soluble TGFBIIIR gene or empty vector (5 × 109 particles) was administered either topically or by intramuscular injection on Day 5. Five study groups were designed: untreated control (CO), topical soluble TGFBIIIR gene (TG), topical empty vector (TV), intramuscular soluble TGFBIIIR gene (IMG), and intramuscular empty vector (IMV). All grafts were removed on Day 21 for histologic examination.
Morphometric Analysis
The formalin-preserved middle portion of the tracheal segment was cut to 4-µm sections for hematoxylin-eosin staining. Computerized morphometry (21) was performed in a blinded fashion as previously described (16, 18).
Statistical Analysis
Data are expressed as mean ± standard deviation of the means. Kruskal-Wallis one-way analysis of variance on ranks was used to analyze the differences between groups, because normality test was failed. All pairwise multiple comparisons were performed using the Student-Newman-Keuls test (16, 18). Data are considered statistically significant if p values are less than 0.05.
| |
RESULTS |
|---|
|
|
|---|
Expression of TGF
in Rat Tracheal Allografts
The development of transplant-induced fibrous airway obliteration in the rat tracheal transplant model of BO has been
previously characterized in detail (13). The fibrous airway obliteration that develops in allografts demonstrates a triphasic time
course: an initial ischemic phase, followed by a marked cellular infiltrate phase with complete epithelial loss, and finally a
fibrous obliterative phase of the allograft airway lumen (13).
We have recently demonstrated that many of the infiltrating
cells are CD4+ mononuclear cells (16). Using a murine tracheal model of BO, Neuringer and coworkers (22) have found
other lymphocytes and macrophages in the allotracheas at early
time points after transplantation. In the present study, the expression and distribution of TGF
protein in allografted tracheal tissue was examined by immunohistochemistry staining
at these three phases. As shown in Figure 2, the number of infiltrating mononuclear cells increased from Day 2 to Day 7, and these cells stained strongly with anti-TGF
antibody (Figures 2A and 2B). At Day 14, the airway lumen was filled with
fibrotic tissue, and few TGF
-positive cells could be found
(Figure 2C). At Day 21, no TGF
-positive staining cells were
found, but the fibrotic tissue was still positively stained (Figure 2D).
|
Influence of Gene Transfer Time on Antifibrotic Effect
We have previously shown that delivery of an anti-inflammatory and immunosuppressive cytokine, IL-10, locally through an osmotic mini-pump, inhibited the fibrous airway obliteration in this rat tracheal transplant model. However, this protective effect was seen only when the delivery of recombinant IL-10 was started at Day 5, but not at Day 0, of allograft transplantation (15). The angiotensin system plays an important role in the pathogenesis of fibrotic diseases. In another of our studies, when allograft rats were treated with captopril, an angiotensin converting enzyme inhibitor, the inhibitory effect on airway obliteration was observed when the drug delivery was started 5 d before transplantation, or on postoperative Day 1, but not if started on postoperative Day 5 (18). Therefore, to test the effect of adenoviral-mediated gene transfer of soluble TGFBIIIR on fibrous airway obliteration, adenovirus (5 × 109 particles) was initially administered by topical injection at three different time points (Day 0, Day 5, or Day 10 after allograft transplantation). Airway obliteration was inhibited when the adenovirus was injected on Day 5 postoperation (Figure 3). The inhibitory effect did not reach statistical significance (p = 0.06), which is likely due to the small sample sizes.
|
Influence of Gene Transfer Route on Antifibrotic Effect
To determine the specificity of the adenoviral-mediated soluble TGFBIIIR on the prevention of fibrous airway obliteration, adenovirus containing an empty vector was used as a negative control. We have previously shown that adenoviral-mediated IL-10 gene delivery through intramuscular injection effectively inhibited fibrous airway obliteration (15). To determine whether intramuscular injection of soluble TGFBIIIR gene could have similar inhibitory effects on airway obliteration, both empty vector and vector containing soluble TGFBIIIR gene were injected at Day 5 after allograft transplantation either topically, at the site of tracheal transplantation, or intramuscularly. Interestingly, only topical gene transfection of soluble TGFBIIIR preserved lumenal patency on Day 21, whereas all other groups showed almost complete fibrous lumenal obliteration (Figure 4). On examination of tracheal structure, however, although topical gene transfer prevented fibrous obliteration in the airway lumen, loss of the entire epithelial lining (which was the same in all groups) was not prevented by the gene transfer. In addition, minor degrees of fibroproliferation were observed in the subepithelial space, replacing the normal architecture in that location (Figure 5).
|
|
| |
DISCUSSION |
|---|
|
|
|---|
Soluble TGFBIIIR Gene Transfer Inhibits Allograft-induced Fibrous Airway Obliteration
In the present study, we have demonstrated that adenoviral-mediated topical gene transfer of soluble TGFBIIIR significantly inhibits the development of allograft-induced fibrous
airway obliteration in a rat tracheal transplant model of BO.
This observation supports the hypothesis that clinically observed overexpression of TGF
plays an important role in the
development of airway fibrosis that further contributes to the
chronic dysfunction of the grafted lung after transplantation.
It also provides the first direct evidence that the therapeutic
approaches designed to block the effect of TGF
may be useful to inhibit chronic graft fibrosis. The strong anti-TGF
staining of infiltrating mononuclear cells suggest that these cells could
be one of the major sources of TGF
. The staining in the fibrous
tissue indicates that secreted TGF
binds to matrix proteins.
The observation that the inhibitory effect of adenoviral-mediated delivery of soluble TGFBIIIR on fibrous airway obliteration depends on the time and location of gene delivery is very interesting and important. As we described previously in this model, at
the end of the first week after graft transplantation, there is a peak of lymphocytic infiltration (13). The increased number of
TGF
-positive infiltrating cells seen at Day 7 in the present study
suggests that this could also be the peak of TGF
, which is produced from these cells and could be responsible for the subsequent development of fibroproliferation and fibrous deposition in
the airway lumen. We have previously noted that adenoviral- mediated gene transfer takes 24 to 48 h to reach the peak of transgene expression (15, 23, 24). Therefore, adenovirus vector delivered on Day 5 may have a peak of transgene expression around
Day 7, which coincides with the peak of the infiltrating cells, leading to effective inhibition of graft fibrosis induced by TGF
.
In contrast to our previous work on adenoviral-mediated
IL-10 gene transfer (15), in the present study we found that
only topical injection of adenoviral vector containing soluble
TGFBIIIR is effective in preventing lumenal obliteration.
This suggests that although both soluble TGFBIIIR and IL-10
can inhibit allograft-induced fibrous obliteration, soluble
TGFBIIIR functions locally to competitively block the effect
of TGF
on its target cells. IL-10, as an immunosuppressive cytokine, may be released from the location of gene transfer
to function at remote organs; it may also function through circulatory lymphocytes to affect the entire immune response towards the allograft. The topical effect of soluble TGFBIIIR
could be a specific advantage for clinical purposes. After lung
transplantation, this protein or its gene could be delivered locally through the trachea to prevent the development of BO in
the airway while minimizing its impact systemically. Thus, the
amount of the agent required could be less and the potential
for systemic side effects could be reduced.
Inhibition versus Overexpression of TGF
after
Lung Transplantation
In the literature there are reports of beneficial effects of overexpression of TGF
in organ transplantation. For example, in
a murine heterotopic cardiac transplant model, TGF
gene
transfer prolonged allograft survival with inhibition of donor-specific cytotoxic T cell and IL-2 producing helper T cell functions in graft-infiltrating cells (25). Endobronchial administration of naked plasmid DNA encoding TGF
1 was shown to
reduce early lung allograft rejection in a rat model (26). This
implies that TGF
downregulates the cell-mediated immune
response during acute rejection. It is well known that the TGF
family of proteins is a set of pleiotropic-secreted signaling molecules with unique and potent immunoregulatory properties
(27, 28). However, the application of TGF
as a potential molecular therapy should be considered with caution. Isaka and
colleagues (29) have shown that the introduction of TGF
gene alone into the kidney induced glomerulosclerosis by affecting extracellular matrix accumulation. Using replication-deficient adenovirus vectors to transfer the cDNA of TGF
1
to rat lung, Sime and colleagues (30) have demonstrated that
transient overexpression of active TGF
1 results in prolonged and severe interstitial and pleural fibrosis, which is characterized by extensive deposition of the extracellular matrix proteins: collagen, fibronectin, and elastin, and by emergence of
cells with the myofibroblast phenotype. Therefore, although
early overexpression of TGF
in transplanted organs may
ameliorate acute rejection and inflammation
and thus may
be beneficial
uncontrolled prolonged expression of TGF
in
the targeted organs may be detrimental.
Potential Application of Adenoviral-mediated Anti-TGF
Gene Therapy
In addition to the adenoviral-mediated gene transfer of soluble
TGFBIIIR used in the present study, several related adenoviral-mediated vectors have also been described in the literature,
which could be potentially used as TGF
inhibitors. For example, a chimeric cDNA encoding an extracellular domain of the
TGF
type II receptor fused to the IgG Fc domain inhibited the
action of TGF
and suppressed extracellular matrix accumulation in a rat model of experimental glomerulonephritis (31). Adenoviral gene transfer vector of a dominant-negative mutant of
TGF
type II receptor (32), and an adenovirus-gene transfer vector of decorin (33), which is another TGF
-binding proteoglycan,
have also been developed. With these tools, the role of TGF
in
allograft-induced fibrous airway obliteration and other types of
chronic organ dysfunction can be further investigated.
A major advantage of adenoviral-mediated gene transfer is
its higher efficiency when compared with other gene-delivering modalities. However, in vivo gene transfer using adenoviral vectors as a therapeutic modality has been limited by the
host immune response that induces inflammation, limits the
amount and duration of transgene expression, and prevents
effective retransfection. All transplant patients are routinely
administered immunosuppressive therapy. We have recently
shown that transplantation immunosuppression attenuates the
post-transfection host immune response to adenoviral-mediated gene transfection and thereby increases and prolongs transgene expression (24). This approach also makes effective re-transfection of adenoviral vectors possible (23). Thus, clinical
application of gene therapy in the setting of transplantation is
certainly feasible. Although soluble TGF
IIIR did not completely prevent fibrous airway obliteration in this study, it was
effective in inhibiting the process. The duration and extent of
such inhibition, particularly when combined with immunosuppressive medication, will be addressed in future studies.
| |
Footnotes |
|---|
Correspondence and requests for reprints should be addressed to Dr. Mingyao Liu, Associate Professor of Surgery, Thoracic Surgery Research Laboratory, Toronto General Hospital, Room 1-816, 200 Elizabeth Street, Toronto, ON, M5G 2C4 Canada. E-mail: mingyao.liu{at}utoronto.ca
(Received in original form February 26, 2001 and accepted in revised form August 21, 2001).
Dr. Liu is a scholar of the Canadian Institutes of Health Research and recipient of a Premier's Research Excellence Award from the Ontario Government.Acknowledgments: The writers thank J. Mates for his technical assistance with the animals.
Supported by the National Sanitarium Association of Canada, the Canadian Cystic Fibrosis Foundation, and the Canadian Institutes of Health Research (MT-13270, MOP-42546, and MOP-77559).
| |
References |
|---|
|
|
|---|
1. Hosenpud JD, Bennet LE, Keck BM, Fiol B, Boucek MM, Novick RJ. The Registry of the International Society for Heart and Lung Transplantation: Fifteenth Official Report-1998. J Heart Lung Transplant 1998; 17: 656-668 [Medline].
2. Charpin J, Valcke J, Kettaneh L, Epardeau B, Stern M, Israel-Biet D. Peaks of transforming growth factor-beta mRNA in alveolar cells of lung transplants as an early marker of chronic rejection. Transplantation 1998; 65: 752-755 [Medline].
3.
El-Gamel A,
Awad M,
Sim E,
Hasleton P,
Yonan N,
Egan J,
Deiraniya A,
Hutchinson I.
Transforming growth factor-beta1 and lung allograft
fibrosis.
Eur J Cardiothorac Surg
1998;
13:
424-430
4. El-Gamel A, Sim E, Hasleton P, Hutchinson J, Yonan N, Egan J, Campbell C, Rahman A, Sheldon S, Deiraniya A, Hutchinson I. Transforming growth factor beta (TGF-beta) and obliterative bronchiolitis following pulmonary transplantation. J Heart Lung Transplant 1999; 18: 828-837 [Medline].
5. Shihab F, Yamamoto T, Nast C, Cohen A, Noble N, Gold L, Border W. Transforming growth factor-beta and matrix protein expression in acute and chronic rejection of human renal allografts. J Am Soc Nephrol 1995; 6: 286-294 [Abstract].
6. Demirci G, Nashan B, Pichlmayr R. Fibrosis in chronic rejection of human liver allografts: expression patterns of transforming growth factor-TGFbeta1 and TGF-beta3. Transplantation 1996; 62: 1776-1783 [Medline].
7.
Aziz T,
Hasleton P,
Hann A,
Yonan N,
Deiraniya A,
Hutchinson I.
Transforming growth factor beta in relation to cardiac allograft vasculopathy
after heart transplantation.
J Thorac Cardiovasc Surg
2000;
119:
700-708
8. Lopez-Casillas F, Wrana J, Massague J. Betaglycan presents ligand to the TGF-beta signaling receptor. Cell 1993; 73: 1435-1444 [Medline].
9.
Lopez-Casillas F,
Payne H,
Andres J,
Massague J.
Betaglycan can act as a
dual modulator of TGF-beta access to signaling receptors: mapping of
ligand binding and GAG attachment sites.
J Cell Biol
1994;
124:
557-568
10. Hertz MI, Jessurun J, King MB, Savik K, Murray JJ. Reproduction of the obliterative bronchiolitis lesion after heterotopic transplantation of mouse airways. Am J Pathol 1993; 142: 1945-1951 [Abstract].
11.
Hertz MI,
Henke CA,
Nakhleh RE,
Harmon KR,
Marinelli WA,
Fox JMK,
Kubo SH,
Shumway SJ,
Bolman RM III,,
Bitterman PB.
Obliterative bronchiolitis after lung transplantation: a fibroproliferative
disorder associated with platelet-derived growth factor.
Proc Natl
Acad Sci USA
1992;
89:
10385-10389
12. Al-Dossari GA, Jessurun J, Bolman III RM, Kshettry VR, King MB, Murray JJ, Hertz MI. Pathogenesis of obliterative bronchiolitis: possible roles of platelet-derived growth factor and basic fibroblast growth factor. Transplantation 1995;59:143-145.
13. Boehler A, Chamberlain D, Kesten S, Slutsky AS, Liu M, Keshavjee S. Lymphocytic airway infiltration as a precursor to fibrous obliteration in a rat model of bronchiolitis obliterans. Transplantation 1997; 64: 311-317 [Medline].
14.
Boehler A,
Bai XH,
Liu M,
Cassivi S,
Chamberlain D,
Slutsky AS,
Keshavjee S.
Upregulation of T-helper 1 cytokines and chemokine expression in post-transplant airway obliteration.
Am J Respir Crit Care
Med
1999;
159:
1910-1917
15. Boehler A, Chamberlain D, Xing Z, Slutsky AS, Jordana M, Gauldie J, Liu M, Keshavjee S. Adenovirus-mediated interleukin-10 gene transfer inhibits post-transplant fibrous airway obliteration in an animal model of bronchiolitis obliterans. Hum Gene Ther 1998; 9: 541-551 [Medline].
16.
Suga M,
Maclean AA,
Keshavjee S,
Fischer S,
Moreira JM,
Liu M.
RANTES plays an important role in the evolution of allograft transplant-induced fibrous airway obliteration.
Am J Respir Crit Care Med
2000;
162:
1940-1948
17.
Weber KT.
Extracellular matrix remodeling in heart failure: a role for de
novo angiotensin II generation.
Circulation
1997;
96:
4065-4082
18.
Maclean AA,
Liu M,
Fischer S,
Suga M,
Keshavjee S.
Targeting the angiotensin system in post-transplant airway obliteration: the antifibrotic effect of angiotensin-converting enzyme inhibition.
Am J
Respir Crit Care Med
2000;
162:
310-315
19. Wang XF, Lin HY, Ng-Eaton E, Downward J, Lodish HF, Weinberg RA. Expression cloning and characterization of the TGF-beta type III receptor. Cell 1991; 67: 797-805 [Medline].
20. Souza DW, Armentano D. Novel cloning method for recombinant adenovirus construction in Escherichia coli. Biotechniques 1999; 26: 502-508 [Medline].
21. Reichenspurner H, Soni V, Nitschke M, Berry GJ, Brazelton TR, Shorthouse R, Huang X, Reitz BA, Morris RE. Obliterative airway disease after heterotopic tracheal xenotransplantation. Pathogenesis and prevention using new immunosuppressive agents. Transplantation 1997; 64: 373-383 [Medline].
22.
Neuringer IP,
Mannon RB,
Coffman TM,
Parsons M,
Burns K,
Yankaskas JR,
Aris RM.
Immune cells in a mouse airway model of obliterative bronchiolitis.
Am J Respir Cell Mol Biol
1998;
19:
379-386
23.
Cassivi SD,
Liu M,
Boehler A,
Tanswell AK,
Slutsky AS,
Keshavjee S,
Todd S.
Transgene expression after adenovirus-mediated retransfection of rat lungs is increased and prolonged by transplant immunosuppression.
J Thorac Cardiovasc Surg
1999;
117:
1-7
24. Cassivi SD, Liu M, Boehler A, Pierre A, Tanswell AK, O'Brodovich H, Mullen JB, Slutsky AS, Keshavjee SH. Transplant immunosuppression increases and prolongs transgene expression following adenoviral-mediated transfection of rat lungs. J Heart Lung Transplant 2000; 19: 984-994 [Medline].
25. Qin L, Ding Y, Bromberg J. Gene transfer of transforming growth factor-beta 1 prolongs murine cardiac allograft survival by inhibiting cell-mediated immunity. Hum Gene Ther 1996; 7: 1981-1988 [Medline].
26.
D'Ovidio F,
Yano M,
Ritter J,
Mohanakumar T,
Patterson G.
Endobronchial transfection of naked TGF-beta1 cDNA attenuates acute
lung rejection.
Ann Thorac Surg
1999;
68:
1008-1013
27. Letterio J, Roberts A. TGF-beta: a critical modulator of immune cell function. Clin Immunol Immunopathol 1997; 84: 244-250 [Medline].
28. Letterio J, Roberts A. Regulation of immune responses by TGF-beta. Annu Rev Immunol 1998; 16: 137-161 [Medline].
29. Isaka Y, Fujiwara Y, Ueda N, Kaneda Y, Kamada T, Imai E. Glomerulosclerosis induced by in vivo transfection of transforming growth factor-beta or platelet-derived growth factor gene into the rat kidney. J Clin Invest 1994; 92: 2597-2601 .
30. Sime PJ, Xing Z, Graham FL, Csaky KG, Gauldie J. Adenovector-mediated gene transfer of active transforming growth factor-beta1 induces prolonged severe fibrosis in rat lung. J Clin Invest 1997; 100: 768-776 [Medline].
31. Isaka Y, Akagi Y, Ando Y, Tsujie M, Sudo T, Ohno N, Border W, Noble N, Kaneda Y, Hori M, Imai E. Gene therapy by transforming growth factor-beta receptor-IgG Fc chimera suppressed extracellular matrix accumulation in experimental glomerulonephritis. Kidney Int 1999; 55: 465-475 [Medline].
32. Zhao J, Sime PJ, Bringas P Jr,, Gauldie J, Warburton D. Epithelium-specific adenoviral transfer of a dominant-negative mutant TGF-beta type II receptor stimulates embryonic lung branching morphogenesis in culture and potentiates EGF and PDGF-AA. Mech Dev 1998; 72: 89-100 [Medline].
33.
Zhao J,
Sime PJ,
Bringas P Jr,,
Gauldie J,
Warburton D.
Adenovirus-mediated decorin gene transfer prevents TGF-beta-induced inhibition
of lung morphogenesis.
Am J Physiol
1999;
277:
L412-L422
This article has been cited by other articles:
![]() |
L A Borthwick, S M Parker, K A Brougham, G E Johnson, M R Gorowiec, C Ward, J L Lordan, P A Corris, J A Kirby, and A J Fisher Epithelial to mesenchymal transition (EMT) and airway remodelling after human lung transplantation Thorax, September 1, 2009; 64(9): 770 - 777. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. V. Verona, Y. Tang, T. K. Millstead, A. P. Hinck, J. K. Agyin, and L.-Z. Sun Expression, purification and characterization of BGERII: a novel pan-TGF{beta} inhibitor Protein Eng. Des. Sel., July 1, 2008; 21(7): 463 - 473. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. S. D. Weber, S. A. Madsen-Bouterse, G. J. M. Rosa, S. Sipkovsky, X. Ren, P. E. Almeida, R. Kruska, R. G. Halgren, J. L. Barrick, and J. L. Burton Analysis of the bovine neutrophil transcriptome during glucocorticoid treatment Physiol Genomics, December 13, 2006; 28(1): 97 - 112. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. N. Lama, H. Harada, L. N. Badri, A. Flint, C. M. Hogaboam, A. McKenzie, F. J. Martinez, G. B. Toews, B. B. Moore, and D. J. Pinsky Obligatory Role for Interleukin-13 in Obstructive Lesion Development in Airway Allografts Am. J. Pathol., July 1, 2006; 169(1): 47 - 60. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. J. Tobin Chronic Obstructive Pulmonary Disease, Pollution, Pulmonary Vascular Disease, Transplantation, Pleural Disease, and Lung Cancer in AJRCCM 2002 Am. J. Respir. Crit. Care Med., February 1, 2003; 167(3): 356 - 370. [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Proc. Am. Thorac. Soc. | Am. J. Respir. Cell Mol. Biol. |