INTRODUCTION

TOP ABSTRACT INTRODUCTION METHODS RESULTS DISCUSSION REFERENCES

Keywords: ammonia; nitric oxide; cystic fibrosis; Pseudomonas aeruginosa

Nitrogen oxide concentrations in the cystic fibrosis (CF) airways reflect in part the activity of nitric oxide synthase (NOS) isoforms, particularly the neuronal (NOS 1) and inducible (NOS 2) isoforms (1, 2). However, processes unrelated to NOS activity may modulate nitrogen oxide concentrations in CF. For example, superoxide (O₂) produced during neutrophil activation reacts with and consumes nitric oxide (NO), forming peroxynitrite (ONOO) and nitrate (NO₃) (3). Indeed, this NO consumption is believed to account in part for low expired NO values (4, 5) observed in patients with advanced CF.

There is also a unique ecology in the CF airway between prokaryotic and eukaryotic cells. We hypothesized that the presence of prokaryotic species could affect the balance between oxidized and reduced forms of nitrogen. Indeed, growth is favored in the CF airway of denitrifying species, which carry out a series of reductions that can globally be represented as (6): NO₃  NO₂  NO  N₂O  NH₃. Central to this pathway is the enzyme, nitric oxide reductase (NOR), which reduces NO. We studied the effect of treating airway infections in patients with CFwho were colonized exclusively with Pseudomonas aeruginosaon expired NO concentration and on the concentration of the product of assimilatory nitrogen reduction, ammonium (NH₄⁺). Our observations suggest that there is a unique and previously unrecognized nitrogen redox exchange between prokaryotic and eukaryotic cells in the CF airway that may have pathophysiological implications.

	METHODS

TOP ABSTRACT INTRODUCTION METHODS RESULTS DISCUSSION REFERENCES

Subjects

Patients with CF were recruited if they met criteria outlined in Table 1. Airway nitrogen balance was studied by analyzing sputum at the initiation of, and again at least 4 d into, antimicrobial therapy specific for P. aeruginosa. In addition, tracheal aspirate concentrations of NH₄⁺ were measured in patients before and after lung transplantation. Finally, sputum was collected from patients with CF who met study criteria (Table 1) in every respect except that they were not experiencing an exacerbation, and NH₄⁺ concentrations were compared with those from patients with neurogenic respiratory failure. This study was reviewed and approved by the human investigation committees of both institutions.

Expired NO

American Thoracic Society recommendations were used for measurement of fractional concentration of exhaled nitric oxide (F_ENO) (7); online measurements were performed in Essen and offline measurements in Virginia (7). Online F_ENO was measured at end-tidal CO₂ using an expiratory flow rate of 50 ml/s. Offline measurements were made using a vital capacity reservoir without discarding the tracheobronchial ("dead space") gas of interest (7). We have shown that these two methods produce results that are linearly related (10).

Sputum Processing

Sputum samples were decanted of saliva and frozen (80° C) within 10 min of collection. After thawing, they were treated in deoxyribonuclease (DNase) (0.05% final concentration, 25° C) and subjected to centrifugation (252 g; 15 min).

Chemical Methods

Initially, NH₄⁺ was measured spectrophotometrically as described (11); dilution (generally 1:1) was at times required because concentrations were high. In the pretreatment and posttreatment phases, an analate addition method was used. There, an NH₄⁺ electrode in conjunction with a reference electrode (Model 93-18 and Model 90-02 [Ag/AgCl]; Orion Research, Inc., Beverly, MA) were submerged in a standard solution (10³ MNH₄Cl), and the baseline output (mV) was recorded. Samples were added to the standard solution and the NH₄⁺ concentration determined from change in potential after the addition. There was good agreement between the spectrophotometric and analate methods (r² = 0.98). NO from head space was measured in airtight syringes by chemiluminescence (NOA 280; Sievers, Boulder, CO).

Microbiology

Bacteria in L-broth (P. aeruginosa) or Columbia broth (Staphylococcus aureus) (10⁸ · ml¹) were incubated anaerobically for 12 h (37° C). Clinical isolates of P. aeruginosa were compared with laboratory strain PAO1. Cultures were sealed in glass chambers from which medium (NH₄⁺) and head space (NO) were assayed after exposure to 50 nmol of acidified NaNO₂ in a floating chamber. Identical assays were performed on sputum samples before and after 24-h incubation with 10 µg · ml¹ tobramycin (Pathogenesis, Seattle, WA) or phosphate-buffered saline (PBS).

Polymerase Chain Reaction for NO Reductase (nor)

Primers were constructed for the cytochrome B and C domains of P. aeruginosa nor (Gen Bank number D38133) as follows: norC-F: 5' GGAACATATATTTCGGCGGG 3'; norC-R: 5' CCTGGCCCTCGCTGAGATGG 3'; norB-F: 5' GCCTACTACCTGGTGCCGG 3'; norB-R2: 5' CAGGGTATGCATGAAGCCCCA 3'. Fragments were amplified by polymerase chain reaction (PCR) according to the following program: 5 cycles: 97° C 0:15, 5° C 0:30, 72° C 1:30; 25 cycles: 97° C 0:15, 59.1° C 0:30, 72° C 0:30, 72° C 6:00; final: 4° C. DNA was visualized after 1.2% agarose gel electrophoresis with ethidium bromide.

Statistics

Measurements before and after treatment were compared by paired t test. Multiple means were compared using analysis of variance (ANOVA) or, if data were nonparametric, by ANOVA on ranks. Data are presented as mean ± SE. A value of p < 0.05 was considered significant.

	RESULTS

TOP ABSTRACT INTRODUCTION METHODS RESULTS DISCUSSION REFERENCES

Airway NH₄⁺ concentrations were higher in patients with stable CF colonized with P. aeruginosa, but not experiencing an exacerbation (1.6 ± 0.13 mM [n = 18]), than in patients with neurogenic respiratory failure (0.46 ± 0.13 mM [n = 13]; p < 0.001) (Figure 1).

View larger version (17K): [in this window] [in a new window]   Figure 1.   Sputum NH4+ concentrations were higher in patients with CF colonized with P. aeruginosa who were not experiencing respiratory exacerbation (white bar; n = 13) than in children with neurogenic respiratory failure (hatched bar; n = 8; p < 0.001).

Sputum NH₄⁺ concentrations declined with antipseudomonal therapy from 10.0 ± 0.97 to 7.3 ± 0.76 (n = 7; p = 0.002). Concentrations also declined in endotracheally intubated patients with CF who underwent lung transplantation (from 6.6 ± 4.1 to 1 ± 0.74 [n = 3]) (Figure 2), arguing against salivary contamination as the principal cause of the fall.

View larger version (10K): [in this window] [in a new window]   Figure 2.   Total sputum NH4+ concentration in sputum declined during antipseudomonal therapy. (A) Change in sputum NH4+ concentrations with antibiotic therapy (p < 0.002, n = 7). (B) Tracheal aspirate sputum concentrations of NH4+ declined in three additional P. aeruginosa-colonized patients immediately before and after lung transplantation.

These observations are consistent with in vitro evidence for denitrification by P. aeruginosa. There was an accumulation rate for NH₄⁺ after incubation of 10⁸ organisms · ml¹ with NaNO₂ of 830 ± 15 nmol · min¹ for P. aeruginosa, greater than L-broth alone (53 ± 7 nmol · min¹), an equal density of S. aureus (210 ± 34 nmol · min¹), or Columbia medium alone (91 ± 7.8 nmol min¹) (n = 3 each, p < 0.001) (Figure 3).

View larger version (20K): [in this window] [in a new window]   Figure 3.   Ammonium was produced by P. aeruginosa in vitro. Culture medium (L-broth) from P. aeruginosa (dotted bar) had higher NH4+ production than L-broth alone (black bar), culture medium (Columbia) containing an equal density of S. aureus (white bar), or Columbia medium alone (hatched bar), (n = 3 each; p < 0.001, ANOVA).

Expired NO increased modestly in our patients after antipseudomonal therapy as assayed using online (from 3.4 to 5.0 parts per billion [ppb]; p < 0.05; n = 6) and offline (from 6.2 to 8.5 ppb; p < 0.005; n = 9) methods (Figure 4). This represented a total of 15 pairs of measurements on 14 patients (19 ± 2.1 yr, 7 male).

View larger version (15K): [in this window] [in a new window]   Figure 4.   NO increased with treatment of P. aeruginosa colonizing the CF airways. Expired NO measured by both online (A) and offline (B) techniques increased with antipseudomonal therapy in patients with CF (p < 0.05, n = 8 for online measurements; p < 0.005, n = 9 for offline measurements).

Clinical P. aeruginosa consumed head space NO in vitro more rapidly than in medium alone (0.76 ± 0.28 versus 0% min¹ in medium; p < 0.005) but not as rapidly as strain PAO1 (3.5 ± 0.07% min¹; p < 0.05) (n = 3 to 4 each); (Figure 5). Tobramycin treatment of P. aeruginosa-colonized CF sputum ex vivo resulted in a lower head space NO concentrations relative to simultaneously exposed PBSthan untreated controls (head space NO = 0.79 ± 0.08% that of PBS for native sputum versus 0.98 ± 0.13% for tobramycin-treated sputum; n = 7 pairs each; p < 0.05). Consistent with these biochemical observations, the nor gene was present in clinical P. aeruginosa and in the laboratory strain PAO1, as evidenced by PCR amplification of fragments corresponding to norCF-norCR (332 base pairs [bp]), norBF-norBR (768 bp), and norCF- norBR (1,402 bp) (Figure 5).

View larger version (37K): [in this window] [in a new window]   View larger version (43K): [in this window] [in a new window]   Figure 5.   Presence of nor gene, and its activity in P. aeruginosa. (A) PCR confirmation of presence genes encoding of cytochrome B (norB) and C (norC) domains of Nor. (B) Head space NO consumption in vitro was measured for P. aeruginosa. Bacteria were grown in L-broth at a concentration of 108 ml1. After 12 h of incubation (37° C), they were transferred to airtight chambers and exposed to 50 nmol acidified NaNO2 in a floating chamber. Serial head space measurements were made by chemiluminescence and compared with baseline values. Clinical P. aeruginosa consumed NO more rapidly than medium alone (0.76 ± 0.28% min1 versus 0% min1 for medium alone), but not as rapidly as laboratory strain PA01 (3.53 ± 0.07% min1; p = 0.01).

	DISCUSSION

TOP ABSTRACT INTRODUCTION METHODS RESULTS DISCUSSION REFERENCES

We have shown that (1) high concentrations of NH₄⁺ present in CF sputum decrease with antipseudomonal therapy in vivo and accumulate with P. aeruginosa growth in vitro; (2) expired NO concentrations increase modestly in patients colonized exclusively with P. aeruginosa during treatment with antipseudomonal medications; (3) head space NO is consumed by P. aeruginosa in vitro; and (4) NO consumption by CF sputum can be inhibited by antimicrobial treatment ex vivo, consistent with biochemical and molecular evidence for nor expression in P. aeruginosa. These findings demonstrate a unique nitrogen ecosystem in the CF airway and suggest the possibility that treatment of P. aeruginosa may have a previously unsuspected beneficial effect on airway physiology through its effect on nitrogen redox balance.

The presence of high concentrations of the reductive end-product NH₄⁺ in the CF airway has not previously been reported. In the intestinal epithelium, NH₄⁺ can inhibit chloride transport (12). NO enhances chloride transport and inhibits amiloride-sensitive sodium transport in epithelial cells in vitro (13, 14). Therefore, high NO values and low NH₄⁺ values could be desirable to augment chloride transport and inhibit sodium transport in the CF epithelium, and it is of interest that the presence of P. aeruginosa opposes these benefits. Although the decreases in NH₄⁺ that we observed with therapy were modest in many patients, if treatment of P. aeruginosa shifts the airway equilibrium from reduced to oxidized forms of nitrogen, it may represent a mechanism by which antipseudomonal therapy could modestly improve epithelial salt transport abnormalities characteristic of CF in some patients. Additionally, breath condensate NH₄⁺ concentrations have recently been studied as a marker for acute worsening of asthmatic airway epithelial inflammation and glutaminase activity (15). Our data show that similar interpretation of samples from the CF airway, where prokaryotic NH₄⁺ production likely overwhelms that of eukaryotic enzymes, may not be warranted. NH₄⁺ values in the sputum of patients with an exacerbation were higher than in those not experiencing an exacerbation, perhaps actually serving as a marker for heavy colonization with P. aeruginosa (as opposed to inflammatory state). More work will be required to define the pathophysiological and diagnostic implications of relatively high concentrations of NH₄⁺ in CF sputum.

Traditional denitrification is not the only potential pathway to NH₄⁺ in the CF airway. Glutaminase is expressed and active in the human airway epithelium, but its activity is inhibited in conditions characteristic of the CF airway (T helper cell, type 1 [Th1] cytokine stimulation) (15). Glutathione-dependent formaldehyde dehydrogenase (GD-FDH) converts endogenous airway S-nitrosoglutathione (GSNO) (16, 17) to NH₄⁺ in vitro in human airway epithelial cells (A549) and rat macrophages (RAW 264.7 cells) (18). This pathway may be relevant in light of recent observations that GSNO levels are low in the CF airway (17). Further, Escherichia coli also express GD-FDH (18), which appears to be highly conserved. Therefore, loss of prokaryotic GD-FDH activitylike that of NOR may contribute to the apparent shift in the CF airway nitrogen redox balance from reduced to oxidized forms with antimicrobial therapy. NH₄⁺ is also formed in the mouth (19). Oral colonization could contribute to NH₄⁺ values in sputum. However, there was a robust fall in both sputum and endotracheal tube NH₄⁺ levels with both medical and surgical therapy, suggesting that pulmonary P. aeruginosa contributed to NH₄⁺ concentrations in both groups.

Interactions between organisms colonizing the airways and eukaryotic sources of nitrogen oxides may need to be considered when interpreting expired NO concentration in the clinical setting. Expired NO concentrations increased modestly with specific antibiotic therapy in patients with CF colonized with P. aeruginosa. The direction of this change was distinct from that seen with antiinflammatory (glucocorticoid) therapy in patients with asthma (7, 20). Because there is evidence that expired NO values are affected by NOS activity (20, 21), interpretation of nitrosopnea has been focused on the role of NOS isoforms. Our data suggest that NO consumption by nor in denitrifying organisms in the CF lung may attenuate expired NO values. Indeed, antimicrobial therapy also decreased head space NO consumption by P. aeruginosa in sputum ex vivo, supporting biochemical and molecular evidence that P. aeruginosa, as previously reported, consumes NO in vitro (6, 22). This observation is also consistent with previous data showing that concentrations of NO₂ and NO₃also consumed by denitrifying organismsincrease in CF sputum with antimicrobial therapy (23). However, others have not found a significant change in expired NO with antimicrobial therapy (24), perhaps because the study population was not exclusively colonized with antibiotic-sensitive P. aeruginosa. That is, we may see a relatively uniform (within sample techniques) response of NO to treatment because we have chosen a homogenous population who require treatment exclusively for sensitive P. aeruginosa. Certainly, determinants of airway nitrogen oxide concentrations may be many, and reports regarding expired NO in CF vary substantially (7). Whether NO, NO₂, NO₃ or other species are the most biologically relevant nitrogen oxide in the airway, and whether small differences could be physiologically relevant, remains the subject of controversy.

Denitrifying organisms could attenuate expired NO concentrations in patients with other conditions. For example, nitrosopnea may be affected in patients with asthma colonized with Aspergillusanother denitrifying organismand in patients with nosocomial or opportunistic pneumonias (6).

In summary, our evidence suggests that denitrification by P. aeruginosa may be relevant to concentrations of nitrogen redox species in the CF airways in vivo. It will likely be important to remember these prokaryotic/eukaryotic interactions if various members of the nitrogen redox family, from NH₄⁺ to NO₃, are measured as markers of airway disease severity. In addition, we suggest that CF airways disease could be adversely affected by a shift from oxidized to reduced forms of nitrogen catalyzed by enzymes like NOR in the P. aeruginosa denitrification pathway.