help button home button
AJRCCM
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by GASTON, B.
Right arrow Articles by GOLDBERG, J. B.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by GASTON, B.
Right arrow Articles by GOLDBERG, J. B.
Am. J. Respir. Crit. Care Med., Volume 165, Number 3, February 2002, 387-390

Nitrogen Redox Balance in the Cystic Fibrosis Airway
Effects of Antipseudomonal Therapy

BENJAMIN GASTON, FELIX RATJEN, JOHN W. VAUGHAN, NEIL R. MALHOTRA, ROBERT G. CANADY, ASHLEY H. SNYDER, JOHN F. HUNT, SEBASTIAN GAERTIG, and JOANNA B. GOLDBERG

Departments of Pediatric Pulmonary Medicine and Microbiology, University of Virginia School of Medicine, Charlottesville, Virginia; and Department of Pediatric Pulmonary Medicine, Children's Hospital, Essen, Germany


    ABSTRACT
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES

Denitrifying bacteria metabolize nitrogen oxides through assimilatory and dissimilatory pathways. These redox reactions may affect lung physiology. We hypothesized that airway colonization with denitrifying bacteria could alter nitrogen balance in the cystic fibrosis (CF) airway. We measured airway nitrogen redox species before and after antimicrobial therapy for Pseudomonas aeruginosa in patients with CF. We also studied ammonium (NH4+) and nitric oxide (NO) metabolism in clinical strains of P. aeruginosa in vitro and in CF sputum ex vivo. Ammonium concentrations in both sputum and tracheal aspirates decreased with therapy. Nitric oxide reductase (NOR) was present in clinical strains of P. aeruginosa, which both produced NH4+ and consumed NO. Further, NO consumption by CF sputum was inhibited by tobramycin ex vivo. We conclude that treatment of pseudomonal lung infections is associated with decreased NH4+ concentrations in the CF airways. In epithelial cells, NH4+ inhibits chloride transport, and nitrogen oxides inhibit amiloride-sensitive sodium transport and augment chloride transport. We speculate that normalization of airway nitrogen redox balance could contribute to the beneficial effects of antipseudomonal therapy on lung function in CF.

    INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES

Keywords: ammonia; nitric oxide; cystic fibrosis; Pseudomonas aeruginosa

Nitrogen oxide concentrations in the cystic fibrosis (CF) airways reflect in part the activity of nitric oxide synthase (NOS) isoforms, particularly the neuronal (NOS 1) and inducible (NOS 2) isoforms (1, 2). However, processes unrelated to NOS activity may modulate nitrogen oxide concentrations in CF. For example, superoxide (O2-) produced during neutrophil activation reacts with and consumes nitric oxide (NO), forming peroxynitrite (ONOO-) and nitrate (NO3-) (3). Indeed, this NO consumption is believed to account in part for low expired NO values (4, 5) observed in patients with advanced CF.

There is also a unique ecology in the CF airway between prokaryotic and eukaryotic cells. We hypothesized that the presence of prokaryotic species could affect the balance between oxidized and reduced forms of nitrogen. Indeed, growth is favored in the CF airway of denitrifying species, which carry out a series of reductions that can globally be represented as (6): NO3- right-arrow NO2- right-arrow NO right-arrow N2O right-arrow NH3. Central to this pathway is the enzyme, nitric oxide reductase (NOR), which reduces NO. We studied the effect of treating airway infections in patients with CF-who were colonized exclusively with Pseudomonas aeruginosa-on expired NO concentration and on the concentration of the product of assimilatory nitrogen reduction, ammonium (NH4+). Our observations suggest that there is a unique and previously unrecognized nitrogen redox exchange between prokaryotic and eukaryotic cells in the CF airway that may have pathophysiological implications.

    METHODS
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES

Subjects

Patients with CF were recruited if they met criteria outlined in Table 1. Airway nitrogen balance was studied by analyzing sputum at the initiation of, and again at least 4 d into, antimicrobial therapy specific for P. aeruginosa. In addition, tracheal aspirate concentrations of NH4+ were measured in patients before and after lung transplantation. Finally, sputum was collected from patients with CF who met study criteria (Table 1) in every respect except that they were not experiencing an exacerbation, and NH4+ concentrations were compared with those from patients with neurogenic respiratory failure. This study was reviewed and approved by the human investigation committees of both institutions.

                              
View this table:
[in this window]
[in a new window]
 

TABLE 1

 STUDY ENTRY CRITERIA FOR PATIENTS WITH CYSTIC FIBROSIS

Expired NO

American Thoracic Society recommendations were used for measurement of fractional concentration of exhaled nitric oxide (FENO) (7); online measurements were performed in Essen and offline measurements in Virginia (7). Online FENO was measured at end-tidal CO2 using an expiratory flow rate of 50 ml/s. Offline measurements were made using a vital capacity reservoir without discarding the tracheobronchial ("dead space") gas of interest (7). We have shown that these two methods produce results that are linearly related (10).

Sputum Processing

Sputum samples were decanted of saliva and frozen (-80° C) within 10 min of collection. After thawing, they were treated in deoxyribonuclease (DNase) (0.05% final concentration, 25° C) and subjected to centrifugation (252 g; 15 min).

Chemical Methods

Initially, NH4+ was measured spectrophotometrically as described (11); dilution (generally 1:1) was at times required because concentrations were high. In the pretreatment and posttreatment phases, an analate addition method was used. There, an NH4+ electrode in conjunction with a reference electrode (Model 93-18 and Model 90-02 [Ag/AgCl]; Orion Research, Inc., Beverly, MA) were submerged in a standard solution (10-3 MNH4Cl), and the baseline output (mV) was recorded. Samples were added to the standard solution and the NH4+ concentration determined from change in potential after the addition. There was good agreement between the spectrophotometric and analate methods (r2 = 0.98). NO from head space was measured in airtight syringes by chemiluminescence (NOA 280; Sievers, Boulder, CO).

Microbiology

Bacteria in L-broth (P. aeruginosa) or Columbia broth (Staphylococcus aureus) (108 · ml-1) were incubated anaerobically for 12 h (37° C). Clinical isolates of P. aeruginosa were compared with laboratory strain PAO1. Cultures were sealed in glass chambers from which medium (NH4+) and head space (NO) were assayed after exposure to 50 nmol of acidified NaNO2 in a floating chamber. Identical assays were performed on sputum samples before and after 24-h incubation with 10 µg · ml-1 tobramycin (Pathogenesis, Seattle, WA) or phosphate-buffered saline (PBS).

Polymerase Chain Reaction for NO Reductase (nor)

Primers were constructed for the cytochrome B and C domains of P. aeruginosa nor (Gen Bank number D38133) as follows: norC-F: 5' GGAACATATATTTCGGCGGG 3'; norC-R: 5' CCTGGCCCTCGCTGAGATGG 3'; norB-F: 5' GCCTACTACCTGGTGCCGG 3'; norB-R2: 5' CAGGGTATGCATGAAGCCCCA 3'. Fragments were amplified by polymerase chain reaction (PCR) according to the following program: 5 cycles: 97° C 0:15, 5° C 0:30, 72° C 1:30; 25 cycles: 97° C 0:15, 59.1° C 0:30, 72° C 0:30, 72° C 6:00; final: 4° C. DNA was visualized after 1.2% agarose gel electrophoresis with ethidium bromide.

Statistics

Measurements before and after treatment were compared by paired t test. Multiple means were compared using analysis of variance (ANOVA) or, if data were nonparametric, by ANOVA on ranks. Data are presented as mean ± SE. A value of p < 0.05 was considered significant.

    RESULTS
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES

Airway NH4+ concentrations were higher in patients with stable CF colonized with P. aeruginosa, but not experiencing an exacerbation (1.6 ± 0.13 mM [n = 18]), than in patients with neurogenic respiratory failure (0.46 ± 0.13 mM [n = 13]; p < 0.001) (Figure 1).


View larger version (17K):
[in this window]
[in a new window]
 
Figure 1.   Sputum NH4+ concentrations were higher in patients with CF colonized with P. aeruginosa who were not experiencing respiratory exacerbation (white bar; n = 13) than in children with neurogenic respiratory failure (hatched bar; n = 8; p < 0.001).

Sputum NH4+ concentrations declined with antipseudomonal therapy from 10.0 ± 0.97 to 7.3 ± 0.76 (n = 7; p = 0.002). Concentrations also declined in endotracheally intubated patients with CF who underwent lung transplantation (from 6.6 ± 4.1 to 1 ± 0.74 [n = 3]) (Figure 2), arguing against salivary contamination as the principal cause of the fall.


View larger version (10K):
[in this window]
[in a new window]
 
Figure 2.   Total sputum NH4+ concentration in sputum declined during antipseudomonal therapy. (A) Change in sputum NH4+ concentrations with antibiotic therapy (p < 0.002, n = 7). (B) Tracheal aspirate sputum concentrations of NH4+ declined in three additional P. aeruginosa-colonized patients immediately before and after lung transplantation.

These observations are consistent with in vitro evidence for denitrification by P. aeruginosa. There was an accumulation rate for NH4+ after incubation of 108 organisms · ml-1 with NaNO2 of 830 ± 15 nmol · min-1 for P. aeruginosa, greater than L-broth alone (53 ± 7 nmol · min-1), an equal density of S. aureus (210 ± 34 nmol · min-1), or Columbia medium alone (91 ± 7.8 nmol min-1) (n = 3 each, p < 0.001) (Figure 3).


View larger version (20K):
[in this window]
[in a new window]
 
Figure 3.   Ammonium was produced by P. aeruginosa in vitro. Culture medium (L-broth) from P. aeruginosa (dotted bar) had higher NH4+ production than L-broth alone (black bar), culture medium (Columbia) containing an equal density of S. aureus (white bar), or Columbia medium alone (hatched bar), (n = 3 each; p < 0.001, ANOVA).

Expired NO increased modestly in our patients after antipseudomonal therapy as assayed using online (from 3.4 to 5.0 parts per billion [ppb]; p < 0.05; n = 6) and offline (from 6.2 to 8.5 ppb; p < 0.005; n = 9) methods (Figure 4). This represented a total of 15 pairs of measurements on 14 patients (19 ± 2.1 yr, 7 male).


View larger version (15K):
[in this window]
[in a new window]
 
Figure 4.   NO increased with treatment of P. aeruginosa colonizing the CF airways. Expired NO measured by both online (A) and offline (B) techniques increased with antipseudomonal therapy in patients with CF (p < 0.05, n = 8 for online measurements; p < 0.005, n = 9 for offline measurements).

Clinical P. aeruginosa consumed head space NO in vitro more rapidly than in medium alone (0.76 ± 0.28 versus 0% min-1 in medium; p < 0.005) but not as rapidly as strain PAO1 (3.5 ± 0.07% min-1; p < 0.05) (n = 3 to 4 each); (Figure 5). Tobramycin treatment of P. aeruginosa-colonized CF sputum ex vivo resulted in a lower head space NO concentrations- relative to simultaneously exposed PBS-than untreated controls (head space NO = 0.79 ± 0.08% that of PBS for native sputum versus 0.98 ± 0.13% for tobramycin-treated sputum; n = 7 pairs each; p < 0.05). Consistent with these biochemical observations, the nor gene was present in clinical P. aeruginosa and in the laboratory strain PAO1, as evidenced by PCR amplification of fragments corresponding to norCF-norCR (332 base pairs [bp]), norBF-norBR (768 bp), and norCF- norBR (1,402 bp) (Figure 5).


View larger version (37K):
[in this window]
[in a new window]
 


View larger version (43K):
[in this window]
[in a new window]
 
Figure 5.   Presence of nor gene, and its activity in P. aeruginosa. (A) PCR confirmation of presence genes encoding of cytochrome B (norB) and C (norC) domains of Nor. (B) Head space NO consumption in vitro was measured for P. aeruginosa. Bacteria were grown in L-broth at a concentration of 108 ml-1. After 12 h of incubation (37° C), they were transferred to airtight chambers and exposed to 50 nmol acidified NaNO2 in a floating chamber. Serial head space measurements were made by chemiluminescence and compared with baseline values. Clinical P. aeruginosa consumed NO more rapidly than medium alone (0.76 ± 0.28% min-1 versus 0% min-1 for medium alone), but not as rapidly as laboratory strain PA01 (3.53 ± 0.07% min-1; p = 0.01).

    DISCUSSION
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES

We have shown that (1) high concentrations of NH4+ present in CF sputum decrease with antipseudomonal therapy in vivo and accumulate with P. aeruginosa growth in vitro; (2) expired NO concentrations increase modestly in patients colonized exclusively with P. aeruginosa during treatment with antipseudomonal medications; (3) head space NO is consumed by P. aeruginosa in vitro; and (4) NO consumption by CF sputum can be inhibited by antimicrobial treatment ex vivo, consistent with biochemical and molecular evidence for nor expression in P. aeruginosa. These findings demonstrate a unique nitrogen ecosystem in the CF airway and suggest the possibility that treatment of P. aeruginosa may have a previously unsuspected beneficial effect on airway physiology through its effect on nitrogen redox balance.

The presence of high concentrations of the reductive end-product NH4+ in the CF airway has not previously been reported. In the intestinal epithelium, NH4+ can inhibit chloride transport (12). NO enhances chloride transport and inhibits amiloride-sensitive sodium transport in epithelial cells in vitro (13, 14). Therefore, high NO values and low NH4+ values could be desirable to augment chloride transport and inhibit sodium transport in the CF epithelium, and it is of interest that the presence of P. aeruginosa opposes these benefits. Although the decreases in NH4+ that we observed with therapy were modest in many patients, if treatment of P. aeruginosa shifts the airway equilibrium from reduced to oxidized forms of nitrogen, it may represent a mechanism by which antipseudomonal therapy could modestly improve epithelial salt transport abnormalities characteristic of CF in some patients. Additionally, breath condensate NH4+ concentrations have recently been studied as a marker for acute worsening of asthmatic airway epithelial inflammation and glutaminase activity (15). Our data show that similar interpretation of samples from the CF airway, where prokaryotic NH4+ production likely overwhelms that of eukaryotic enzymes, may not be warranted. NH4+ values in the sputum of patients with an exacerbation were higher than in those not experiencing an exacerbation, perhaps actually serving as a marker for heavy colonization with P. aeruginosa (as opposed to inflammatory state). More work will be required to define the pathophysiological and diagnostic implications of relatively high concentrations of NH4+ in CF sputum.

Traditional denitrification is not the only potential pathway to NH4+ in the CF airway. Glutaminase is expressed and active in the human airway epithelium, but its activity is inhibited in conditions characteristic of the CF airway (T helper cell, type 1 [Th1] cytokine stimulation) (15). Glutathione-dependent formaldehyde dehydrogenase (GD-FDH) converts endogenous airway S-nitrosoglutathione (GSNO) (16, 17) to NH4+ in vitro in human airway epithelial cells (A549) and rat macrophages (RAW 264.7 cells) (18). This pathway may be relevant in light of recent observations that GSNO levels are low in the CF airway (17). Further, Escherichia coli also express GD-FDH (18), which appears to be highly conserved. Therefore, loss of prokaryotic GD-FDH activity-like that of NOR- may contribute to the apparent shift in the CF airway nitrogen redox balance from reduced to oxidized forms with antimicrobial therapy. NH4+ is also formed in the mouth (19). Oral colonization could contribute to NH4+ values in sputum. However, there was a robust fall in both sputum and endotracheal tube NH4+ levels with both medical and surgical therapy, suggesting that pulmonary P. aeruginosa contributed to NH4+ concentrations in both groups.

Interactions between organisms colonizing the airways and eukaryotic sources of nitrogen oxides may need to be considered when interpreting expired NO concentration in the clinical setting. Expired NO concentrations increased modestly with specific antibiotic therapy in patients with CF colonized with P. aeruginosa. The direction of this change was distinct from that seen with antiinflammatory (glucocorticoid) therapy in patients with asthma (7, 20). Because there is evidence that expired NO values are affected by NOS activity (20, 21), interpretation of nitrosopnea has been focused on the role of NOS isoforms. Our data suggest that NO consumption by nor in denitrifying organisms in the CF lung may attenuate expired NO values. Indeed, antimicrobial therapy also decreased head space NO consumption by P. aeruginosa in sputum ex vivo, supporting biochemical and molecular evidence that P. aeruginosa, as previously reported, consumes NO in vitro (6, 22). This observation is also consistent with previous data showing that concentrations of NO2- and NO3--also consumed by denitrifying organisms-increase in CF sputum with antimicrobial therapy (23). However, others have not found a significant change in expired NO with antimicrobial therapy (24), perhaps because the study population was not exclusively colonized with antibiotic-sensitive P. aeruginosa. That is, we may see a relatively uniform (within sample techniques) response of NO to treatment because we have chosen a homogenous population who require treatment exclusively for sensitive P. aeruginosa. Certainly, determinants of airway nitrogen oxide concentrations may be many, and reports regarding expired NO in CF vary substantially (7). Whether NO, NO2-, NO3- or other species are the most biologically relevant nitrogen oxide in the airway, and whether small differences could be physiologically relevant, remains the subject of controversy.

Denitrifying organisms could attenuate expired NO concentrations in patients with other conditions. For example, nitrosopnea may be affected in patients with asthma colonized with Aspergillus-another denitrifying organism-and in patients with nosocomial or opportunistic pneumonias (6).

In summary, our evidence suggests that denitrification by P. aeruginosa may be relevant to concentrations of nitrogen redox species in the CF airways in vivo. It will likely be important to remember these prokaryotic/eukaryotic interactions if various members of the nitrogen redox family, from NH4+ to NO3-, are measured as markers of airway disease severity. In addition, we suggest that CF airways disease could be adversely affected by a shift from oxidized to reduced forms of nitrogen catalyzed by enzymes like NOR in the P. aeruginosa denitrification pathway.

    Footnotes

Correspondence and requests for reprints should be addressed to Benjamin Gaston, M.D., Department of Pediatric Respiratory Medicine, University of Virginia Health System, Box 800386, Charlottesville, VA 22908. E-mail: bmg3g{at}virginia.edu

(Received in original form June 1, 2001 and accepted in revised form October 30, 2001).

Supported by: NIH Grants HL 59337 and HL 69170 (B.G.); NIH Asthma Center Grant 5-24434 (B.G., J.H.); Cystic Fibrosis Foundation Grant 95G0 (B.G.); UVA Children's Medical Center Grant (B.G.); American Lung Association Research Grant RG-110-N (B.G.); and the Henry B. Wallace Foundation (B.G.).
    References
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES

1. Meng Q, Springall D, Bishop A, Morgan K, Evans T, Habib S, Gruenert D, Gyi K, Hodson M, Yacoub M, Polak M. Lack of inducible nitric oxide synthase in bronchial epithelium: a possible mechanism of susceptibility to infection in cystic fibrosis. J Pathol 1998; 184: 323-331 [Medline].

2. Grasemann H, Knauer N, Eijmes J, Drazen J, Ratjen F. Airway NO levels in CF patients are related to a polymorphism in the neuronal NO synthase (NOSI) gene. Am J Respir Crit Care Med 2000; 162: 2172-2176 [Abstract/Free Full Text].

3. Jones KL, Bryan TW, Jinkins PA, Simpson KL, Grisham MB, Owens MW, Milligan SA, Markewitz BA, Robbins RA. Superoxide released from neutrophils causes a reduction in nitric oxide gas. Am J Physiol 1998; 275: L1120-L1126 [Abstract/Free Full Text].

4. Dotsch J, Demirakca S, Terbrack H, Huls G, Rascher W, Kuhl P. Airway nitric oxide in asthmatic children and patients with cystic fibrosis. Eur Respir J 1996; 9: 2537-2540 [Abstract].

5. Gaston B, Massaro A, Drazen J, Chee CBE, Wohl MEB, Stamler JS. Expired nitric oxide levels are elevated in patients with asthma. In: Moncada S, Feelisch M, Busse R, Hibbs EA, editors. Biology of nitric oxide. Vol. 3. London: Portland Press; 1994. p. 497-499.

6. Zumft WG. Cell biology and molecular basis of denitrification. Microbiol Molec Biol Rev 1997; 61: 533-616 . [Abstract]

7. American Thoracic Society. Recommendations for standardized procedures for the online and offline measurement of exhaled lower respiratory nitric oxide and nasal nitric oxide in adults and children. Am J Respir Crit Care Med 1999;160:2104-2117.

8. Nelson B, Sears S, Woods J, Ling CY, Hunt J, Clapper LM, Gaston B. Expired nitric oxide as a marker for childhood asthma. J Pediatr 1997; 130: 423-427 [Medline].

9. Massaro A, Mehta S, Lilly C, Kobzik L, Reilly JJ, Drazen JM. Elevated nitric oxide concentrations in isolated lower airway gas of asthmatic subjects. Am J Respir Crit Care Med 1996; 153: 1510-1514 [Abstract].

10. Canady R, Platts-Mills T, Murphy A, Johannesen R, Gaston B. Vital capacity reservoir and online measurement of childhood nitrosopnea are linearly related. Clinical implications. Am J Respir Crit Care Med 1999; 159: 311-314 [Abstract/Free Full Text].

11. Neeley WE, Phillipson J. Automated enzymatic method for determining ammonia in plasma with 14 day reagent stability. Clin Chem 1968; 34: 1968 .

12. Prasad M, Smith JA, Resnick A, Awtreys CS, Hrnjez BJ, Matthews JB. Ammonia inhibits cAMP-regulated intestinal C1- transport: asymmetric effects of apical and basolateral exposure and implications for epithelial barrier function. J Clin Invest 1995; 96: 2142-2151 .

13. Jain L, Chen X, Brown LA, Eaton DC. Nitric oxide inhibits lung sodium transport through a cGMP-mediated inhibition of epithelial cation channels. Am J Physiol 1998; 274: 475-484 .

14. Kamonsinska B, Radomski MW, Duszyk M, Radomski A, Man SF. Nitric oxide activates chloride currents in human lung epithelial cells. Am J Physiol 1997; 272: 1098-1104 .

15. Hunt J, Erwin E, Palmer L, Vaughan J, Malhotra N, Platts-Mills TAE, Gaston B. Expression and activity of pH-regulatory glutaminase in the human airway epithelium. Am J Respir Crit Care Med 2002; 165: 101-107 [Abstract/Free Full Text].

16. Gaston B, Reilly J, Drazen JM, Fackler J, Ramdev P, Arnelle D, Mullins ME, Sugarbaker DJ, Chee C, Singel DJ, et al . . Endogenous nitrogen oxides and bronchodilator S-nitrosothiols in human airways. Proc Natl Acad Sci USA 1993; 90: 10957-10961 [Abstract/Free Full Text].

17. Grasemann H, Gaston B, Fang K, Paul K, Ratjen F. Decreased levels of nitrosothiols in the lower airways of patients with cystic fibrosis and normal pulmonary function. J Pediatr 1999; 135: 770-772 [Medline].

18. Liu L, Hausladen A, Zeng M, Que L, Heitman J, Stamler J. A metabolic enzyme for S-nitrosothiol conserved from bacterial to humans. Nature 2001; 410: 490-494 [Medline].

19. Huizenga J, Vissink A, Juipers E, Gips C. Helicobacter pylori and ammonia concentrations of whole, parotid and submandibular/sublingual saliva. Clin Oral Invest 1999; 3: 84-87 . [Medline]

20. Baraldi E, Azzolin NM, Zanconato S, Dario C, Zacchello F. Corticosteroids decrease exhaled nitric oxide in children with acute asthma. J Pediatr 1997; 131: 381-385 [Medline].

21. Yates D, Kharitonov S, Thomas P, Barnes PJ. Endogenous nitric oxide is decreased in asthmatic patients by an inhibitor of inducible nitric oxide synthase. Am J Respir Crit Care Med 1996; 154: 247-250 [Abstract].

22. Watmough NJ, Butland G, Cheesman MR, Moir JW, Richardson DJ, Spiro S. Nitric oxide in bacteria: synthesis and consumption. Biochim Biophys Acta 1999; 1411: 456-474 [Medline].

23. Grasemann H, Ioannidis I, Tomkiewicz RP, de Groot H, Rubkin BK, Ratjen F. Nitric oxide metabolites in cystic fibrosis lung disease. Arch Dis Child 1998; 78: 49-53 [Abstract/Free Full Text].

24. Jöbsis Q, Raatgeep H, Schellekens S, Kresbergen A, Hop W, de Jongste J. Hydrogen peroxide and nitric oxide in exhaled air of children with cystic fibrosis during antibiotic treatment. Eur Respir J 2000; 16: 95-100 [Abstract].





This article has been cited by other articles:


Home page
Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
K.-H. Han, K. Mekala, V. Babida, H.-Y. Kim, M. E. Handlogten, J. W. Verlander, and I. D. Weiner
Expression of the gas-transporting proteins, Rh B glycoprotein and Rh C glycoprotein, in the murine lung
Am J Physiol Lung Cell Mol Physiol, July 1, 2009; 297(1): L153 - L163.
[Abstract] [Full Text] [PDF]


Home page
J. Bacteriol.Home page
K. L. Palmer, L. M. Aye, and M. Whiteley
Nutritional Cues Control Pseudomonas aeruginosa Multicellular Behavior in Cystic Fibrosis Sputum
J. Bacteriol., November 15, 2007; 189(22): 8079 - 8087.
[Abstract] [Full Text] [PDF]


Home page
ChestHome page
C. Keen, A.-C. Olin, A. Edentoft, E. Gronowitz, and B. Strandvik
Airway Nitric Oxide in Patients With Cystic Fibrosis Is Associated With Pancreatic Function, Pseudomonas Infection, and Polyunsaturated Fatty Acids
Chest, June 1, 2007; 131(6): 1857 - 1864.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Respir. Crit. Care Med.Home page
ATS Workshop Proceedings: Exhaled Nitric Oxide and Nitric Oxide Oxidative Metabolism in Exhaled Breath Condensate: Executive Summary.
Am. J. Respir. Crit. Care Med., April 1, 2006; 173(7): 811 - 813.
[Full Text] [PDF]


Home page
Proc Am Thorac SocHome page
ATS Workshop Proceedings: Exhaled Nitric Oxide and Nitric Oxide Oxidative Metabolism in Exhaled Breath Condensate.
Proceedings of the ATS, January 1, 2006; 3(2): 131 - 145.
[Full Text] [PDF]


Home page
Am. J. Respir. Crit. Care Med.Home page
H. Grasemann, R. Schwiertz, S. Matthiesen, K. Racke, and F. Ratjen
Increased Arginase Activity in Cystic Fibrosis Airways
Am. J. Respir. Crit. Care Med., December 15, 2005; 172(12): 1523 - 1528.
[Abstract] [Full Text] [PDF]


Home page
Eur Respir JHome page
P. G. Middleton, T. J. Kidd, and B. Williams
Combination aerosol therapy to treat Burkholderia cepacia complex
Eur. Respir. J., August 1, 2005; 26(2): 305 - 308.
[Abstract] [Full Text] [PDF]


Home page
ThoraxHome page
D W Reid, J C Ojoo, S A Mulrennan, J A Kastelik, A H Morice, and A E Redington
Bacterial denitrification, nitric oxide and airway pH in CF
Thorax, July 1, 2005; 60(7): 614 - 614.
[Full Text] [PDF]


Home page
Eur Respir JHome page
H. Grasemann, C. Grasemann, F. Kurtz, G. Tietze-Schillings, U. Vester, and F. Ratjen
Oral L-arginine supplementation in cystic fibrosis patients: a placebo-controlled study
Eur. Respir. J., January 1, 2005; 25(1): 62 - 68.
[Abstract] [Full Text] [PDF]


Home page
ThoraxHome page
J F Hunt
Informative complexity of exhaled nitrogen oxide chemistry
Thorax, January 1, 2005; 60(1): 2 - 3.
[Full Text] [PDF]


Home page
ANN INTERN MEDHome page
J. V. Peter and J. L. Moran
Noninvasive Ventilation in Exacerbations of Chronic Obstructive Pulmonary Disease: Implications of Different Meta-Analytic Strategies
Ann Intern Med, September 7, 2004; 141(5): W-78 - W-79.
[Full Text] [PDF]


Home page
Physiol. Rev.Home page
F. L. M. Ricciardolo, P. J. Sterk, B. Gaston, and G. Folkerts
Nitric Oxide in Health and Disease of the Respiratory System
Physiol Rev, July 1, 2004; 84(3): 731 - 765.
[Abstract] [Full Text] [PDF]


Home page
J. Bacteriol.Home page
A. M. Firoved, S. R. Wood, W. Ornatowski, V. Deretic, and G. S. Timmins
Microarray Analysis and Functional Characterization of the Nitrosative Stress Response in Nonmucoid and Mucoid Pseudomonas aeruginosa
J. Bacteriol., June 15, 2004; 186(12): 4046 - 4050.
[Abstract] [Full Text] [PDF]


Home page
J. Appl. Physiol.Home page
H.-W. Shin, C. M. Rose-Gottron, D. M. Cooper, R. L. Newcomb, and S. C. George
Airway diffusing capacity of nitric oxide and steroid therapy in asthma
J Appl Physiol, January 1, 2004; 96(1): 65 - 75.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Respir. Crit. Care Med.Home page
R. M. Effros, B. Gaston, A. Mutti, and M. Corradi
Saving the Breath Condensate Approach
Am. J. Respir. Crit. Care Med., November 1, 2003; 168(9): 1129 - 1132.
[Full Text]


Home page
Eur Respir JHome page
J. Hunt
The black box of lung redox
Eur. Respir. J., September 1, 2003; 22(3): 401 - 402.
[Full Text] [PDF]


Home page
ANN INTERN MEDHome page
S. P. Keenan, T. Sinuff, D. J. Cook, and N. S. Hill
Which Patients with Acute Exacerbation of Chronic Obstructive Pulmonary Disease Benefit from Noninvasive Positive-Pressure Ventilation? A Systematic Review of the Literature
Ann Intern Med, June 3, 2003; 138(11): 861 - 870.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Respir. Crit. Care Med.Home page
B. Gaston
Breath Condensate Analysis: Perhaps Worth Studying, After All
Am. J. Respir. Crit. Care Med., February 1, 2003; 167(3): 292 - 293.
[Full Text] [PDF]


Home page
Am. J. Respir. Crit. Care Med.Home page
M. J. Tobin
Pediatrics, Surfactant, and Cystic Fibrosis in AJRCCM 2002
Am. J. Respir. Crit. Care Med., February 1, 2003; 167(3): 333 - 344.
[Full Text] [PDF]


Home page
Am. J. Respir. Crit. Care Med.Home page
H. Grasemann, K. S. van's Gravesande, R. Buscher, N. Knauer, E. S. Silverman, L. J. Palmer, J. M. Drazen, and F. Ratjen
Endothelial Nitric Oxide Synthase Variants in Cystic Fibrosis Lung Disease
Am. J. Respir. Crit. Care Med., February 1, 2003; 167(3): 390 - 394.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Respir. Crit. Care Med.Home page
R. M. Effros, B. M. Gaston, and J. F. Hunt
Do low exhaled condensate nh4+ concentrations in asthma reflect reduced pulmonary production?
Am. J. Respir. Crit. Care Med., January 1, 2003; 167(1): 91 - 92.
[Full Text]


Home page
Am. J. Respir. Crit. Care Med.Home page
B. Gaston and J. F. Hunt
How Acidopneic Is My Patient? A New Question in the Pulmonary Laboratory
Am. J. Respir. Crit. Care Med., May 15, 2002; 165(10): 1349 - 1350.
[Full Text] [PDF]


Home page
Am. J. Respir. Crit. Care Med.Home page
A. H. Snyder, M. E. McPherson, J. F. Hunt, M. Johnson, J. S. Stamler, and B. Gaston
Acute Effects of Aerosolized S-Nitrosoglutathione in Cystic Fibrosis
Am. J. Respir. Crit. Care Med., April 1, 2002; 165(7): 922 - 926.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by GASTON, B.
Right arrow Articles by GOLDBERG, J. B.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by GASTON, B.
Right arrow Articles by GOLDBERG, J. B.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Proc. Am. Thorac. Soc. Am. J. Respir. Cell Mol. Biol.
Copyright © 2002 American Thoracic Society