Modulates Cysteinyl Leukotriene
Receptor-1 Expression and Function in Human
Airway Myocytes
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| |
ABSTRACT |
|---|
|
|
|---|
Leukotrienes play a critical role in promoting bronchoconstriction
in asthma. The purpose of this study was to examine whether interferon (IFN)-
, a cytokine upregulated in asthmatic airways, modulates leukotriene (LT)D4 receptor expression and contractile responses in cultured human airway smooth muscle (HASM) cells. Treatment of HASM cells with IFN-
(10 to 1,000 U/ml) stimulated a dose-dependent increase in cell-surface expression of cysteinyl leukotriene receptor 1 (CysLT1) as determined by flow cytometry. CysLT1 messenger RNA (mRNA) levels were also significantly enhanced by IFN-
, as demonstrated by reverse transcription-polymerase chain reaction. To determine the functional relevance of
increased CysLT1 expression in HASM, cell stiffness responses to
LTD4 were measured with magnetic twisting cytometry. IFN-
(1,000 U/ml for 24 h) markedly increased LTD4-induced changes in
cell stiffness, from 4.6 ± 1 [mean ± SEM]% to 24.4 ± 3.7% (n = 8, p < 0.05). Montelukast, a CysLT1 antagonist, completely inhibited
LTD4-induced increases in cell stiffness. IFN-
had no effect on the
cell stiffness responses to bradykinin, another contractile agonist.
Collectively, these data suggest that IFN-
increases LTD4 responses in HASM cells by increasing cell-surface expression of
CysLT1. Our data suggest that increased levels of IFN-
in asthmatic
individuals may promote airway hyperresponsiveness and asthma exacerbations by directly modulating contractile responses of HASM.
| |
INTRODUCTION |
|---|
|
|
|---|
Keywords: airway remodeling; cytokines; smooth-muscle contraction; asthma; chronic obstructive lung disease
Current evidence suggests that the cysteinyl leukotrienes, especially leukotriene (LT) D4, play an important role in the bronchoconstriction of asthma. For example, new therapeutic agents that block the action of LTD4, either by inhibiting its synthesis or by abrogating its ability to bind to the cysteinyl leukotriene receptor (CysLT), are efficacious in the treatment of some individuals with asthma (1). The CysLT receptors, CysLT1 and CysLT2, are G protein-coupled receptors that mediate contraction of airway smooth muscle (ASM) in part by altering calcium homeostasis. Despite significant progress in characterizing the structure and the sequence of these receptors, little is known about the cellular and molecular mechanisms that alter CysLT receptor expression. Recently, Thivierge and colleagues (2) showed that interleukin (IL)-5 upregulates CysLT1 expression and enhances responsiveness to LTD4 in HL-60 cell lines. Whether cytokines can also modulate LTD4 expression on ASM is not known.
A common trigger for asthma exacerbations is viral infection (1). Even in nonasthmatic individuals, viral infections may induce airway hyperresponsiveness and cough that can persist
for weeks or months. The precise mechanisms by which viruses alter the function of ASM remain unknown. Typically,
viral syndromes are characterized by intense inflammatory responses in the airways, with marked leukocyte trafficking and
production of leukotrienes and T-helper (TH)-1-type cytokines such as interferon (IFN)-
(3). In young children with
acute episodes of virus-induced wheezing, levels of IFN-
and
cysteinyl leukotrienes are significantly increased in sputum
(3). More importantly, montelukast, a CysLT1 antagonist, induces a significant clinical improvement in children with persistent wheezing (4).
The purpose of the present study was to examine the hypothesis that IFN-
augments LTD4-mediated responses in
human airway smooth muscle (HASM) cells. This hypothesis
is supported by the observations that HASM cells can respond
to IFN-
(5, 6) and that other cytokines, such as tumor necrosis factor (TNF)-
, augment responses to other G-protein-
coupled receptors (7). To that end, we examined the effect of
IFN-
on CysLT1 expression in cultured HASM cells, using
flow cytometry and reverse transcription-polymerase chain
reaction (RT-PCR). We also examined the effect of IFN-
on
HASM cell stiffness responses to LTD4, using magnetic twisting cytometry. Previous studies have shown that stiffness can
be used as a proxy for force development in these cells (8).
| |
METHODS |
|---|
|
|
|---|
HASM Culture
HASM cell culture was performed as described previously (9).
Flow-Cytometric Measurement of Expression of CysLT Receptors
Expression of CysLT1 was analyzed through flow-cytometric analysis,
using goat antiserum to CysLT1 (10). Briefly, HASM cells treated
with IFN-
were incubated with isotype-matched serum or goat anti-serum to CysLT1 (1:200) for 2 h at 4° C, and were then incubated with
fluorescein isothiocyanate-conjugated antigoat antibody (1:100; Chemicon International, Temecula, CA) for 1 h at 4° C. CysLT1 expression
was recorded as the mean fluorescence intensity reading from an
EPICS XL flow cytometer (Coulter Corporation, Hialeah, FL).
RT-PCR Analysis of CysLT Receptors
RNA isolation was performed as described previously (11). The following specific primer pairs (designed through the use of GeneBank
sequence information from accession number NM_006639 for CysLT1
and accession number AF254664 for CysLT2) were used at 200 nM:
GCCATGACACTATTGATGACTTCCGC (CysLT1sense), and CGG
TCACGACCATGATCATTCCTATAGC (CysLT1 antisense); and
GGAACCAAATGGCACCTTCAGCAAT (CysLTR2 sense) and GCA
GTCTGTCTTTGCATAAACCCAC (CysLTR2 antisense). Primers
for smooth-muscle
-actin, glyceraldehyde-3-phosphate dehydrogenase (GAPDH), and intercellular adhesion molecule (ICAM)-1 were
as described previously (11). PCR reactions were run at 94° C for 30 s,
60° C for 45 s, and 72° C for 60 s for 30 cycles. Reaction products were
electrophoresed on 1% agarose gels.
Magnetic Twisting Cytometry
Magnetic twisting cytometry (MTC) was used to measure cytoskeletal
mechanics of HASM cells, as previously described (12). Confluent
HASM cells were serum-deprived for 24 h and then treated with IFN-
(1,000 U/ml). Twenty hours later, cells were plated on collagen I
(500 ng/cm2)-coated plastic bacteriology dishes (96-well Removawells;
Immulon 2; Dynatech Laboratories, Chantilly, VA). Cell stiffness
measurements were made with MTC at 2 to 6 h after plating, with alternation of untreated and treated cells from one well to another, so
that on each experimental day, from three to five wells of HASM cells were studied in each treatment group. To study responses to agonists, from two to four measurements of cell stiffness were made under baseline conditions and 1 min after the addition of LTD4 (10
7 M) or
bradykinin (10
6 M).
Statistical Analysis
All data were subjected to one-way or two-way analysis of variance (ANOVA) when experiments were of a factorial design, in order to compare differences between treatment means (expressed as mean ± SEM). After ANOVA, Fisher's method of protected least significant differences was used as a multiple comparison test. Comparison of two populations was made with Student's t test. The relationship between two variables was examined through linear regression analysis, and results of analyses were summarized as the regression equation, correlation (r2), and level of significance (p). Values of p < 0.05 were sufficient to reject the null hypothesis for all analyses.
Materials and Reagents
Tissue culture reagents were obtained from Sigma (St. Louis, MO),
with the exception of amphotericin-B and trypsin-ethylene diamine
tetraacetic acid solution, which were purchased from Gibco (Grand
Island, NY). Antibodies to CysLT1 and isotype-matched antibodies used for flow cytometry were obtained from Dr. Jilly Evans of Merck
& Co. (West Point, PA). LTD4 was obtained from Biomol (Plymouth Meeting, PA). IFN-
was bought from R&D Systems (Minneapolis, MN). All other chemicals used in the study were purchased from Sigma. Montelukast was a gift from Merck & Co.
| |
RESULTS |
|---|
|
|
|---|
IFN-
Increases CysLT1 Expression in HASM Cells
In order to quantitate cell-surface expression of CysLT1, we
performed flow cytometry, using antiserum to CysLT1 receptor as previously described (10). We found that treatment of
HASM cells with IFN-
significantly enhanced the expression
of CysLT1 in a dose-dependent manner (Figures 1A and 1B).
Although the magnitude of the increase in CysLT1 expression
induced by IFN-
varied among donor cells, IFN-
increased
CysLT1 expression as compared with that in untreated cells in
all tested concentrations. As compared with basal expression
(0.49 ± 0.07 [mean ± SEM] as the mean fluorescence intensity), CysLT1 expression was increased to 0.73 ± 0.11, 0.83 ± 0.13, and 0.98 ± 0.19 in cells treated with IFN-
at 10, 100, and
1,000 U/ml (Figure 1B). Importantly, IFN-
had no effect on the binding of normal goat serum (data not shown). In parallel experiments, TNF-
and IL-1
had no effect on CysLT1 expression (data not shown). These data show that IFN-
increased CysLT1 expression in HASM cells.
|
IFN-
Increases CysLT1 and CysLT2 mRNA Expression in
HASM Cells
To study whether the increase in CysLT1 expression was due
to an increase in CysLT gene expression, we assessed the effect of IFN-
on steady-state levels of mRNA for CysLT1 and
CysLT2 by using RT-PCR. Semiquantitative expression of
CysLT receptors was measured by calculating the ratio of CysLT
receptor gene expression to concomitant expression of the human GAPDH or
-actin genes, which are constitutively expressed in HASM cells. Figure 2 shows that IFN-
significantly upregulated steady-state mRNA expression for CysLT1
and CysLT2. Levels of mRNA for ICAM-1 were also increased after IFN-
treatment, in accord with previous observations (13). These data strongly suggest that the increase in
CysLT1 induced by IFN-
in HASM cells is due to an increase
in steady-state expression of CysLT receptor mRNA.
|
IFN-
Modulates Cell Stiffness Induced by LTD4
IFN-
significantly enhanced the ability of LTD4 to increase
HASM cell stiffness as measured with MTC (Figure 3). LTD4
(10
7 M) increased cell stiffness by only 4.6 ± 1.0% in control
cells, but by 24.4 ± 3.7% in IFN-
(1,000 U/ml for 24 h)-
treated cells (p < 0.001). Even though control cells responded
only modestly to LTD4, the cells had robust responses to
bradykinin (10
6 M), and changes in cell stiffness induced by
bradykinin were unaffected by IFN-
. Baseline cell stiffness in
the two treatment groups did not differ significantly (107.5 ± 8.5 dynes/cm2 versus 109.2 ± 7.5 dynes/cm2 in the control and
IFN-
treated groups, respectively).
|
In order to confirm that IFN-
-mediated increases in LTD4-
induced cell stiffness were due to CysLT1 activation, we examined the effect of the CysLT1 antagonist montelukast (10
6 M for 20 min) on LTD4-induced changes in cell stiffness (Figure 4). Montelukast abrogates LTD4-induced changes in cell stiffness in cells
pretreated with IFN-
(ANOVA, p < 0.05). Again, neither baseline cell stiffness nor responses to bradykinin differed significantly among the four treatment groups.
|
| |
DISCUSSION |
|---|
|
|
|---|
Our results indicate that IFN-
enhances the expression of
CysLT1 and also increases contractile responses to LTD4 in
HASM cells. To our knowledge, this is the first study showing
that a proinflammatory cytokine can regulate CysLT1 expression and function in smooth muscle.
Previous studies with HASM cells showed that IFN-
alone
or in combination with other cytokines stimulates the expression of various proinflammatory proteins, such as ICAM-1,
regulated on activation, normal T-cell expressed and secreted
(RANTES), and IL-8 by directly enhancing the transcription
of their genes (5, 6, 14). We also found that upregulation of
CysLT1 protein as measured with flow cytometry was associated with an increase in steady-state mRNA levels for the
CysLT1 gene. Thivierge and colleagues (2), who observed an
increase in CysLT1 in response to IL-5 in HL-60 cells, also
showed that the levels of CysLT1 mRNA in eosinophils decreased in a time-dependent manner in untreated cells,
whereas mRNA levels were maintained in the presence of IL-5.
These studies suggest that gene expression may account for cytokine-induced increases in CysLT1 in some cells. Additional experiments are needed to understand the precise transcriptional mechanisms by which IFN-
regulates CysLT1
gene expression in human ASM cells, but these studies await
cloning of the regulatory region of this gene.
We also found that IFN-
enhanced LTD4-induced changes
in HASM cell stiffness (Figures 3 and 4). Our previous studies
found that stiffness, as measured with MTC, can be used as a
proxy for force generation in these cells (8, 12). It is likely that the observed changes in cell stiffness were due to increases in CysLT1 expression induced by IFN-
. Since the measured
stiffness relates to the stiffness of all cytoskeleton elements,
including actin and myosin, it is plausible that the effects of
IFN-
on cell-stiffness responses may be due to effects of this
cytokine on cytoskeletal proteins, as has been described for
lung carcinoma cells (15). However, we believe this to be an
unlikely explanation for our results, since bradykinin-induced
changes in cell stiffness were unaffected by IFN-
. The lack of
effect of IFN-
on responses to bradykinin suggests that other
mechanisms, such as an increase in G protein-coupled signaling events (7), are also unlikely explanations for the effect of
IFN-
on LTD4-induced force generation.
The ability of IFN-
to modulate both CysLT1 expression
and function in HASM cells has important implications for
airway diseases such as asthma. First, both CysLT1 protein and
mRNA are expressed in vivo in bronchial smooth muscle (10).
Second, IFN-
levels within the airways are dramatically increased in asthmatic individuals (16, 17) and after viral infections (1). Activation of STAT-1, the primary component of
IFN-
signaling, and STAT-1-dependent genes has been demonstrated in the epithelium of asthmatic patients (18). Furthermore, IFN-
has been implicated in virus- and allergen-induced bronchial hyperresponsiveness (19, 20). The present
study shows that one mechanism by which IFN-
may promote the development of virus-induced bronchial hyperresponsiveness is by enhancing ASM contractile responses to
LTD4. Further clinical studies are necessary to determine
whether LT antagonists may be useful in treating virus-induced
bronchial hyperresponsiveness and cough.
| |
Footnotes |
|---|
Correspondence and requests for reprints should be addressed to Reynold A. Panettieri, Jr., M.D., University of Pennsylvania Medical Center, 421 Curie Boulevard, 805 BRB II/III, Philadelphia, PA 19104-6160. E-mail: rap{at}mail.med.upenn.edu
(Received in original form August 1, 2001; accepted in final form October 3, 2001)Acknowledgments: The authors would like to acknowledge the expertise of Andrew Eszterhas in the preparation of the human airway smooth muscle cell lines, Mary McNichol for assistance in the preparation of this manuscript, and Mark Calder for his excellent technical assistance.
Supported by National Institutes of Health Grants HL55301, HL64063, AI40203 (R.A.P.), HL56383, and HL33009 (S.S.), and by a research grant from Merck & Co., Inc.
| |
References |
|---|
|
|
|---|
1.
Gern JE,
Busse WW.
Association of rhinovirus infections with asthma.
Clin Microbiol Rev
1999;
12:
9-18
2.
Thivierge M,
Doty M,
Johnson J,
Stankova J,
Rola-Pleszczynski M.
IL-5
up-regulates cysteinyl leukotriene 1 receptor expression in HL-60 cells
differentiated into eosinophils.
J Immunol
2000;
165:
5221-5226
3. Van Schaik SM, Welliver RC, Kimpen JL. Novel pathways in the pathogenesis of respiratory syncytial virus disease. Pediatr Pulmonol 2000; 30: 131-138 [Medline].
4. Ng DK, Law AK, Chau KW, Chan HK. Use of montelukast in the treatment of early childhood wheezing from clinical experience with three cases. Respirology 2000; 5: 389-392 . [Medline]
5. John M, Hirst SJ, Jose PJ, Robichaud A, Berkman N, Witt C, Twort CHC, Barnes PJ, Chung KF. Human airway smooth muscle cells express and release RANTES in response to T helper 1 cytokines. Regulation by T helper 2 cytokines and corticosteroids. J Immunol 1997; 158: 1841-1847 [Abstract].
6.
Lazaar AL,
Albelda SM,
Pilewski JM,
Brennan B,
Puré E,
Panettieri RA Jr..
T lymphocytes adhere to airway smooth muscle cells via integrins and CD44 and induce smooth muscle cell DNA synthesis.
J Exp
Med
1994;
180:
807-816
7. Amrani Y, Chen H, Panettieri RA Jr.. Activation of tumor necrosis factor receptor 1 in airway smooth muscle: a potential pathway that modulates bronchial hyper-responsiveness in asthma? Respir Res 2000; 1: 49-53 . [Medline]
8.
Fabry B,
Maksym GN,
Shore SA,
Moore PE,
Panettieri RA Jr,,
Butler JP,
Fredberg JJ.
Signal transduction in smooth muscle. Selected contribution: time course and heterogeneity of contractile responses in
cultured human airway smooth muscle cells.
J Appl Physiol
2001;
91:
986-994
9. Panettieri RA Jr, Murray RK, DePalo LR, Yadvish PA, Kotlikoff MI. A human airway smooth muscle cell line that retains physiological responsiveness. Am J Physiol (Cell Physiol) 1989;256/25:C329-C335.
10.
Figueroa DJ,
Breyer RM,
Defoe SK,
Kargman S,
Daugherty BL,
Waldburger K,
Liu Q,
Clements M,
Zeng Z,
O'Neill GP, et al
.
. Expression of
the cysteinyl leukotriene 1 receptor in normal human lung and peripheral blood leukocytes.
Am J Respir Crit Care Med
2001;
163:
226-233
11.
Amrani Y,
Lazaar AL,
Hoffman R,
Amin K,
Ousmer S,
Panettieri RA Jr..
Activation of the p55 TNFR1 coupled to TRAF2 stimulates
ICAM-1 expression by modulating a thapsigargin-sensitive pathway in
human tracheal smooth muscle cells.
Mol Pharmacol
2000;
58:
237-245
12. Hubmayr RD, Shore SA, Fredberg JJ, Planus E, Panettieri RA Jr, Moller W, Heyder J, Wang N. Pharmacological activation changes stiffness of cultured human airway smooth muscle cells. Am J Physiol (Cell Physiol) 1996;271/40:C1660-C1668.
13.
Panettieri RA Jr,,
Lazaar AL,
Puré E,
Albelda S.
Activation of cAMP-dependent pathways in human airway smooth muscle cells inhibits
TNF
-induced ICAM-1 and VCAM-1 expression and T lymphocyte
adhesion.
J Immunol
1995;
154:
2358-2365
[Abstract].
14.
John M,
Au B-T,
Jose PJ,
Lim S,
Saunders M,
Barnes PJ,
Mitchell JA,
Belvisi MG,
Chung KF.
Expression and release of interleukin-8 by human airway smooth muscle cells: Inhibition by Th-2 cytokines and
corticosteroids.
Am J Respir Cell Mol Biol
1998;
18:
84-90
15. Everding B, Wilhelm S, Averesch S, Scherdin U, Holzel F, Steffen M. IFN-gamma-induced change in microtubule organization and alpha-tubulin expression during growth inhibition of lung squamous carcinoma cells. J Interferon Cytokine Res 2000; 20: 983-990 [Medline].
16. Cembrzynska-Nowak M, Szklarz E, Inglot AD, Teodorczyk-Injeyan JA. Elevated release of tumor necrosis factor-alpha and interferon-gamma by bronchoalveolar leukocytes from patients with bronchial asthma. Am Rev Respir Dis 1993; 147: 291-295 [Medline].
17.
Guo FH,
Comhair SA,
Zheng S,
Dweik RA,
Eissa NT,
Thomassen MJ,
Calhoun W,
Erzurum SC.
Molecular mechanisms of increased nitric
oxide (NO) in asthma: evidence for transcriptional and post-translational regulation of NO synthesis.
J Immunol
2000;
164:
5970-5980
18. Sampath D, Castro M, Look DC, Holtzman MJ. Constitutive activation of an epithelial signal transducer and activator of transcription (STAT) pathway in asthma. J Clin Invest 1999; 103: 1353-1361 [Medline].
19. Hessel EM, Van Oosterhout AJ, Van Ark I, Van Esch B, Hofman G, Van Loveren H, Savelkoul HF, Nijkamp FP. Development of airway hyperresponsiveness is dependent on interferon-gamma and independent of eosinophil infiltration. Am J Respir Cell Mol Biol 1997; 16: 325-334 [Abstract].
20. Jacoby DB, Xiao HQ, Lee NH, Chan-Li Y, Fryer AD. Virus- and interferon-induced loss of inhibitory M2 muscarinic receptor function and gene expression in cultured airway parasympathetic neurons. J Clin Invest 1998; 102: 242-248 [Medline].
This article has been cited by other articles:
![]() |
M. Profita, A. Sala, A. Bonanno, L. Siena, M. Ferraro, R. Di Giorgi, A. M. Montalbano, G. D. Albano, R. Gagliardo, and M. Gjomarkaj Cysteinyl Leukotriene-1 Receptor Activation in a Human Bronchial Epithelial Cell Line Leads to Signal Transducer and Activator of Transcription 1-Mediated Eosinophil Adhesion J. Pharmacol. Exp. Ther., June 1, 2008; 325(3): 1024 - 1030. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Hastie, J. R. Masters, S. E. Moss, and S. Naaby-Hansen Interferon-{gamma} Reduces Cell Surface Expression of Annexin 2 and Suppresses the Invasive Capacity of Prostate Cancer Cells J. Biol. Chem., May 2, 2008; 283(18): 12595 - 12603. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. B. Early, E. Barekzi, J. Negri, K. Hise, L. Borish, and J. W. Steinke Concordant Modulation of Cysteinyl Leukotriene Receptor Expression by IL-4 and IFN-{gamma} on Peripheral Immune Cells Am. J. Respir. Cell Mol. Biol., June 1, 2007; 36(6): 715 - 720. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. K. Kumar, C. Herbert, D. C. Webb, L. Li, and P. S. Foster Effects of Anticytokine Therapy in a Mouse Model of Chronic Asthma Am. J. Respir. Crit. Care Med., November 15, 2004; 170(10): 1043 - 1048. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Chen, O. Tliba, C. R. Van Besien, R. A. Panettieri Jr., and Y. Amrani Selected Contribution: TNF-{alpha} modulates murine tracheal rings responsiveness to G-protein-coupled receptor agonists and KCl J Appl Physiol, August 1, 2003; 95(2): 864 - 872. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Amrani, O. Tliba, D. Choubey, C.-D. Huang, V. P. Krymskaya, A. Eszterhas, A. L. Lazaar, and R. A. Panettieri Jr. IFN-gamma inhibits human airway smooth muscle cell proliferation by modulating the E2F-1/Rb pathway Am J Physiol Lung Cell Mol Physiol, June 1, 2003; 284(6): L1063 - L1071. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. B. Vargaftig and M. Singer Leukotrienes, IL-13, and chemokines cooperate to induce BHR and mucus in allergic mouse lungs Am J Physiol Lung Cell Mol Physiol, February 1, 2003; 284(2): L260 - L269. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. J. Tobin Compliance (COMmunicate PLease wIth Less Abbreviations, Noun Clusters, and Exclusiveness) Am. J. Respir. Crit. Care Med., December 15, 2002; 166(12): 1534 - 1536. [Full Text] [PDF] |
||||
![]() |
M. J. TOBIN Asthma, Airway Biology, and Nasal Disorders in AJRCCM 2001 Am. J. Respir. Crit. Care Med., March 1, 2002; 165(5): 598 - 618. [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Proc. Am. Thorac. Soc. | Am. J. Respir. Cell Mol. Biol. |