INTRODUCTION

TOP ABSTRACT INTRODUCTION METHODS RESULTS DISCUSSION REFERENCES

Keywords: airway remodeling; cytokines; smooth-muscle contraction; asthma; chronic obstructive lung disease

Current evidence suggests that the cysteinyl leukotrienes, especially leukotriene (LT) D₄, play an important role in the bronchoconstriction of asthma. For example, new therapeutic agents that block the action of LTD₄, either by inhibiting its synthesis or by abrogating its ability to bind to the cysteinyl leukotriene receptor (CysLT), are efficacious in the treatment of some individuals with asthma (1). The CysLT receptors, CysLT₁ and CysLT₂, are G protein-coupled receptors that mediate contraction of airway smooth muscle (ASM) in part by altering calcium homeostasis. Despite significant progress in characterizing the structure and the sequence of these receptors, little is known about the cellular and molecular mechanisms that alter CysLT receptor expression. Recently, Thivierge and colleagues (2) showed that interleukin (IL)-5 upregulates CysLT₁ expression and enhances responsiveness to LTD₄ in HL-60 cell lines. Whether cytokines can also modulate LTD₄ expression on ASM is not known.

A common trigger for asthma exacerbations is viral infection (1). Even in nonasthmatic individuals, viral infections may induce airway hyperresponsiveness and cough that can persist for weeks or months. The precise mechanisms by which viruses alter the function of ASM remain unknown. Typically, viral syndromes are characterized by intense inflammatory responses in the airways, with marked leukocyte trafficking and production of leukotrienes and T-helper (TH)-1-type cytokines such as interferon (IFN)- (3). In young children with acute episodes of virus-induced wheezing, levels of IFN- and cysteinyl leukotrienes are significantly increased in sputum (3). More importantly, montelukast, a CysLT₁ antagonist, induces a significant clinical improvement in children with persistent wheezing (4).

The purpose of the present study was to examine the hypothesis that IFN- augments LTD₄-mediated responses in human airway smooth muscle (HASM) cells. This hypothesis is supported by the observations that HASM cells can respond to IFN- (5, 6) and that other cytokines, such as tumor necrosis factor (TNF)-, augment responses to other G-protein- coupled receptors (7). To that end, we examined the effect of IFN- on CysLT₁ expression in cultured HASM cells, using flow cytometry and reverse transcription-polymerase chain reaction (RT-PCR). We also examined the effect of IFN- on HASM cell stiffness responses to LTD₄, using magnetic twisting cytometry. Previous studies have shown that stiffness can be used as a proxy for force development in these cells (8).

	METHODS

TOP ABSTRACT INTRODUCTION METHODS RESULTS DISCUSSION REFERENCES

HASM Culture

HASM cell culture was performed as described previously (9).

Flow-Cytometric Measurement of Expression of CysLT Receptors

Expression of CysLT₁ was analyzed through flow-cytometric analysis, using goat antiserum to CysLT₁ (10). Briefly, HASM cells treated with IFN- were incubated with isotype-matched serum or goat anti-serum to CysLT₁ (1:200) for 2 h at 4° C, and were then incubated with fluorescein isothiocyanate-conjugated antigoat antibody (1:100; Chemicon International, Temecula, CA) for 1 h at 4° C. CysLT₁ expression was recorded as the mean fluorescence intensity reading from an EPICS XL flow cytometer (Coulter Corporation, Hialeah, FL).

RT-PCR Analysis of CysLT Receptors

RNA isolation was performed as described previously (11). The following specific primer pairs (designed through the use of GeneBank sequence information from accession number NM_006639 for CysLT₁ and accession number AF254664 for CysLT2) were used at 200 nM: GCCATGACACTATTGATGACTTCCGC (CysLT1sense), and CGG TCACGACCATGATCATTCCTATAGC (CysLT1 antisense); and GGAACCAAATGGCACCTTCAGCAAT (CysLTR2 sense) and GCA GTCTGTCTTTGCATAAACCCAC (CysLTR2 antisense). Primers for smooth-muscle -actin, glyceraldehyde-3-phosphate dehydrogenase (GAPDH), and intercellular adhesion molecule (ICAM)-1 were as described previously (11). PCR reactions were run at 94° C for 30 s, 60° C for 45 s, and 72° C for 60 s for 30 cycles. Reaction products were electrophoresed on 1% agarose gels.

Magnetic Twisting Cytometry

Magnetic twisting cytometry (MTC) was used to measure cytoskeletal mechanics of HASM cells, as previously described (12). Confluent HASM cells were serum-deprived for 24 h and then treated with IFN- (1,000 U/ml). Twenty hours later, cells were plated on collagen I (500 ng/cm²)-coated plastic bacteriology dishes (96-well Removawells; Immulon 2; Dynatech Laboratories, Chantilly, VA). Cell stiffness measurements were made with MTC at 2 to 6 h after plating, with alternation of untreated and treated cells from one well to another, so that on each experimental day, from three to five wells of HASM cells were studied in each treatment group. To study responses to agonists, from two to four measurements of cell stiffness were made under baseline conditions and 1 min after the addition of LTD₄ (10⁷ M) or bradykinin (10⁶ M).

Statistical Analysis

All data were subjected to one-way or two-way analysis of variance (ANOVA) when experiments were of a factorial design, in order to compare differences between treatment means (expressed as mean ± SEM). After ANOVA, Fisher's method of protected least significant differences was used as a multiple comparison test. Comparison of two populations was made with Student's t test. The relationship between two variables was examined through linear regression analysis, and results of analyses were summarized as the regression equation, correlation (r²), and level of significance (p). Values of p < 0.05 were sufficient to reject the null hypothesis for all analyses.

Materials and Reagents

Tissue culture reagents were obtained from Sigma (St. Louis, MO), with the exception of amphotericin-B and trypsin-ethylene diamine tetraacetic acid solution, which were purchased from Gibco (Grand Island, NY). Antibodies to CysLT₁ and isotype-matched antibodies used for flow cytometry were obtained from Dr. Jilly Evans of Merck & Co. (West Point, PA). LTD₄ was obtained from Biomol (Plymouth Meeting, PA). IFN- was bought from R&D Systems (Minneapolis, MN). All other chemicals used in the study were purchased from Sigma. Montelukast was a gift from Merck & Co.

	RESULTS

TOP ABSTRACT INTRODUCTION METHODS RESULTS DISCUSSION REFERENCES

IFN- Increases CysLT₁ Expression in HASM Cells

In order to quantitate cell-surface expression of CysLT₁, we performed flow cytometry, using antiserum to CysLT₁ receptor as previously described (10). We found that treatment of HASM cells with IFN- significantly enhanced the expression of CysLT₁ in a dose-dependent manner (Figures 1A and 1B). Although the magnitude of the increase in CysLT₁ expression induced by IFN- varied among donor cells, IFN- increased CysLT₁ expression as compared with that in untreated cells in all tested concentrations. As compared with basal expression (0.49 ± 0.07 [mean ± SEM] as the mean fluorescence intensity), CysLT₁ expression was increased to 0.73 ± 0.11, 0.83 ± 0.13, and 0.98 ± 0.19 in cells treated with IFN- at 10, 100, and 1,000 U/ml (Figure 1B). Importantly, IFN- had no effect on the binding of normal goat serum (data not shown). In parallel experiments, TNF- and IL-1 had no effect on CysLT₁ expression (data not shown). These data show that IFN- increased CysLT₁ expression in HASM cells.

View larger version (16K): [in this window] [in a new window]   Figure 1.   Upregulation of CysLT1 in ASM cells treated with IFN-. (A) Representative flow-cytometric analysis of CysLT1 expression in basal and HASM cells exposed to IFN- at 1,000 U/ml for 24 h. (B) ASM cells were treated with IFN- at the indicated concentrations for 24 h and CysLT1 was analyzed with flow cytometry as described in METHODS. Values represent the mean fluorescence intensity. *p < 0.05 as compared with untreated cells, n = 4.

IFN- Increases CysLT₁ and CysLT₂ mRNA Expression in HASM Cells

To study whether the increase in CysLT₁ expression was due to an increase in CysLT gene expression, we assessed the effect of IFN- on steady-state levels of mRNA for CysLT₁ and CysLT₂ by using RT-PCR. Semiquantitative expression of CysLT receptors was measured by calculating the ratio of CysLT receptor gene expression to concomitant expression of the human GAPDH or -actin genes, which are constitutively expressed in HASM cells. Figure 2 shows that IFN- significantly upregulated steady-state mRNA expression for CysLT₁ and CysLT₂. Levels of mRNA for ICAM-1 were also increased after IFN- treatment, in accord with previous observations (13). These data strongly suggest that the increase in CysLT₁ induced by IFN- in HASM cells is due to an increase in steady-state expression of CysLT receptor mRNA.

View larger version (28K): [in this window] [in a new window]   Figure 2.   Effect of IFN- on CysLT receptor mRNA levels. (A) ASM cells were stimulated with IFN- (1,000 U/ml for 24 h). Five micrograms of total RNA was subjected to RT-PCR with the primers for GAPDH, -actin, ICAM-1, and CysLT1 or CysLT2. PCR products were separated on 1% agarose gel and stained with ethidium bromide. (B) Scanning densitometry of the gel. Data are representative of RNA obtained from three different experiments with ASM cells from at least two different donors.

IFN- Modulates Cell Stiffness Induced by LTD₄

IFN- significantly enhanced the ability of LTD₄ to increase HASM cell stiffness as measured with MTC (Figure 3). LTD₄ (10⁷ M) increased cell stiffness by only 4.6 ± 1.0% in control cells, but by 24.4 ± 3.7% in IFN- (1,000 U/ml for 24 h)- treated cells (p < 0.001). Even though control cells responded only modestly to LTD₄, the cells had robust responses to bradykinin (10⁶ M), and changes in cell stiffness induced by bradykinin were unaffected by IFN-. Baseline cell stiffness in the two treatment groups did not differ significantly (107.5 ± 8.5 dynes/cm² versus 109.2 ± 7.5 dynes/cm² in the control and IFN- treated groups, respectively).

View larger version (14K): [in this window] [in a new window]   Figure 3.   Cell stiffness responses to LTD4 (107 M) and bradykinin (106 M) of HASM cells treated with IFN- (1,000 U/ml for 24 h) and of untreated (control) cells were measured. Results are expressed as percent of baseline cell stiffness. Data are the mean ± SEM of eight wells in each group, and were obtained from two different donors on two experimental days. *p < 0.001 as compared with control.

In order to confirm that IFN--mediated increases in LTD₄- induced cell stiffness were due to CysLT₁ activation, we examined the effect of the CysLT₁ antagonist montelukast (10⁶ M for 20 min) on LTD₄-induced changes in cell stiffness (Figure 4). Montelukast abrogates LTD₄-induced changes in cell stiffness in cells pretreated with IFN- (ANOVA, p < 0.05). Again, neither baseline cell stiffness nor responses to bradykinin differed significantly among the four treatment groups.

View larger version (14K): [in this window] [in a new window]   Figure 4.   The effect of montelukast (106 M) on changes in cell stiffness induced by LTD4 was measured in control HASM cells and in cells treated with IFN- (1,000 U/ml for 24 h). Results are expressed as percent of baseline cell stiffness. Data are the mean ± SEM of 9 to 11 wells in each group, and were obtained from cells taken from three different donors on five experimental days. *p < 0.02 as compared with untreated control cells. #p < 0.005 as compared with cells treated with IFN- alone.

	DISCUSSION

TOP ABSTRACT INTRODUCTION METHODS RESULTS DISCUSSION REFERENCES

Our results indicate that IFN- enhances the expression of CysLT₁ and also increases contractile responses to LTD₄ in HASM cells. To our knowledge, this is the first study showing that a proinflammatory cytokine can regulate CysLT₁ expression and function in smooth muscle.

Previous studies with HASM cells showed that IFN- alone or in combination with other cytokines stimulates the expression of various proinflammatory proteins, such as ICAM-1, regulated on activation, normal T-cell expressed and secreted (RANTES), and IL-8 by directly enhancing the transcription of their genes (5, 6, 14). We also found that upregulation of CysLT₁ protein as measured with flow cytometry was associated with an increase in steady-state mRNA levels for the CysLT₁ gene. Thivierge and colleagues (2), who observed an increase in CysLT₁ in response to IL-5 in HL-60 cells, also showed that the levels of CysLT₁ mRNA in eosinophils decreased in a time-dependent manner in untreated cells, whereas mRNA levels were maintained in the presence of IL-5. These studies suggest that gene expression may account for cytokine-induced increases in CysLT₁ in some cells. Additional experiments are needed to understand the precise transcriptional mechanisms by which IFN- regulates CysLT₁ gene expression in human ASM cells, but these studies await cloning of the regulatory region of this gene.

We also found that IFN- enhanced LTD₄-induced changes in HASM cell stiffness (Figures 3 and 4). Our previous studies found that stiffness, as measured with MTC, can be used as a proxy for force generation in these cells (8, 12). It is likely that the observed changes in cell stiffness were due to increases in CysLT₁ expression induced by IFN-. Since the measured stiffness relates to the stiffness of all cytoskeleton elements, including actin and myosin, it is plausible that the effects of IFN- on cell-stiffness responses may be due to effects of this cytokine on cytoskeletal proteins, as has been described for lung carcinoma cells (15). However, we believe this to be an unlikely explanation for our results, since bradykinin-induced changes in cell stiffness were unaffected by IFN-. The lack of effect of IFN- on responses to bradykinin suggests that other mechanisms, such as an increase in G protein-coupled signaling events (7), are also unlikely explanations for the effect of IFN- on LTD₄-induced force generation.

The ability of IFN- to modulate both CysLT₁ expression and function in HASM cells has important implications for airway diseases such as asthma. First, both CysLT₁ protein and mRNA are expressed in vivo in bronchial smooth muscle (10). Second, IFN- levels within the airways are dramatically increased in asthmatic individuals (16, 17) and after viral infections (1). Activation of STAT-1, the primary component of IFN- signaling, and STAT-1-dependent genes has been demonstrated in the epithelium of asthmatic patients (18). Furthermore, IFN- has been implicated in virus- and allergen-induced bronchial hyperresponsiveness (19, 20). The present study shows that one mechanism by which IFN- may promote the development of virus-induced bronchial hyperresponsiveness is by enhancing ASM contractile responses to LTD₄. Further clinical studies are necessary to determine whether LT antagonists may be useful in treating virus-induced bronchial hyperresponsiveness and cough.