|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
 |
ABSTRACT |
|---|
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES
|
|---|
Inhalation of nitric oxide (NO) is useful for the treatment of patients with pulmonary hypertension. However, the potential toxicity of inhaled NO is still unclear. Coagulation activation plays an important role in lung injury. We assessed the effect of low- and high-dose inhaled NO on the coagulation system in the intraalveolar space of mice. The animals were assigned to five groups (n = 6): [RA] group, mice exposed to fresh air alone; [RA+2 ppm NO] group, fresh air and 2 ppm NO; [RA+40 ppm NO] group, fresh air and 40 ppm NO; [RA+2 ppm NO+O2] group, fresh air, 2 ppm NO and O2; and [RA+40 ppm NO+O2] group, fresh air, 40 ppm NO and O2. Each group was treated for 3 wk. Lung specimens of [RA+40 ppm NO] and [RA+40 ppm NO+O2] groups showed significant nitrotyrosine immunoreactivity. BALF concentrations of total protein, thrombin and soluble tissue factor were significantly increased in mice of [RA+40 ppm NO] and [RA+40 ppm NO+O2] groups compared with [RA] group. However, BALF concentrations of total protein, thrombin, and soluble tissue factor were not significantly increased in mice of [RA+2 ppm NO] and [RA+2 ppm NO+O2] groups compared with [RA] group. Lung tissue factor mRNA expression was higher in the high-dose NO group than in the low-dose NO group. NO donor increased significantly tissue factor activity on alveolar epithelial cells. This study has shown for the first time that long-term inhalation of high, but not low, concentration of NO may activate the clotting system by increasing the lung expression of tissue factor.
| |
INTRODUCTION |
|---|
|
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES
|
|---|
Inhaled nitric oxide (NO) has been reported to be an effective therapeutic tool for selectively reducing pulmonary hypertension and improving systemic oxygenation in a variety of clinical situations such as the acute respiratory distress syndrome, pulmonary fibrosis, chronic obstructive pulmonary disease, and primary pulmonary hypertension (1). However, preliminary results of prospective and randomized clinical trials have shown that these beneficial effects of NO inhalation do not improve prognosis in patients with acute lung injury (5). The explanation for this poor outcome remains unclear, but many factors may be involved; a potential implicated factor may be the concurrent detrimental effects of NO on lung tissue after prolonged exposure. Several lines of evidence suggest that in pathologic conditions associated with increased production of oxygen free radicals by lung cells, inhalation or overproduction of NO may cause lung injury. For instance, NO may alter the structure and function of surfactant apoproteins, exert direct cytotoxic effect on epithelial and endothelial cells, or induce apoptosis, DNA fragmentation, or chromosome aberrations in immune-competent cells (6); NO may also favor the progression of the inflammatory process in the lung by increasing pulmonary blood flow, vascular permeability, and protein exudation or by promoting the accumulation of eosinophils in the lung (9).
During the process of lung injury, there is an exquisite interplay between coagulation, anticoagulation proteins, cytokines, adhesion molecules, and inflammatory cells in an attempt to resolve injury. Activation of the coagulation system
in the lung, a common epiphenomenon in several pulmonary
diseases, is triggered by the expression of tissue factor on the
surface of monocytes/macrophages, epithelial or endothelial
cells after stimulation with endotoxin and cytokines (e.g., tumor necrosis factor-
, interleukin-1
) (13). Thrombin, the resultant enzyme of this coagulation system activation, plays important roles in the pathogenesis of interstitial lung disease,
pulmonary fibrosis, and airway remodeling by virtue of its
proliferative activity on fibroblasts and smooth muscle cells
and by its ability to stimulate the secretion of extracellular matrix components (14). Recent evidence suggests that free
radicals may also constitute important stimuli for the expression of tissue factor and increased thrombin generation on the
surface of monocytes/macrophages and endothelial cells (17,
18). During inhalation of the free radical NO, increased formation of the toxic and reactive oxidants peroxynitrite and nitrogen dioxide has been reported in the lungs and bronchoalveolar samples from patients with acute lung injury (19). On
the basis of previous in vitro observations showing that free
radicals may induce the cellular expression of tissue factor, in
the present study, we hypothesized that prolonged inhalation of the free radical NO may be associated with increased expression of tissue factor and, consequently, with enhanced activation of the coagulation system in the lung. To demonstrate
this thesis, in the present study, we assessed the effect of long-term inhalation of NO on tissue factor expression and thrombin generation in the mouse lung.
| |
METHODS |
|---|
|
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES
|
|---|
Reagents
Dulbecco's modified Eagle medium (DMEM), L-glutamine, vitamin solution, sodium pyruvate, and nonessential amino acids were purchased from GIBCO (Grand Island, NY). Fetal bovine serum was from BioWhittaker (Walkersville, MD), penicillin and streptomycin were from Nacalai Tesque (Kyoto, Japan). The NO donor FK-409 was a kind gift from Fujisawa Pharmaceutical (Osaka, Japan). The NO scavenger, 2(4-carboxyphenyl)-4-4,5,5-tetramethylimidazoline-1-oxyl-3-oxide (carboxy-PTIO) was purchased from Funakoshi (Tokyo, Japan). All other chemicals and reagents used were of the best quality commercially available. All animals protocols were approved by Mie University's Committee on Animal Investigation.
Animals and Exposure Chamber
Pathogen-free 8- to 10-wk-old, female C57BL/6 mice weighing 18 to 22 g, were purchased from Nihon SLC (Hamamatsu, Japan) and maintained in a specific pathogen-free environment in the animal house of our University. We previously reported in detail the exposure chamber used in the present investigation (20). NO was purchased from Sumitomo Seika (Chiba, Japan) as a mixture of 1,000 parts per million (ppm) in pure N2. The concentration of NO2 was < 2 ppm in the mixture, and a cylinder containing deoxygenized distilled water was incorporated into the circuit of the exposure chamber to absorb NO2. The gas mixture was connected to the exposure chamber through an inlet, and the concentration of NO was fixed at the desired concentration. NO concentration in the chamber was measured three times per day and NO concentration adjusted during the total period of NO exposure (3 wk). For combined inhalation of O2 and NO, a fixed concentration of O2 (FIO2: 0.24) was administered through an inlet of the chamber. A continuous flow of air (30 L/min) was maintained in the circuit using an electrically driven vacuum pump to dilute the gas mixture with fresh air and to avoid as much as possible the oxidation of NO to NO2. NO + NO2 (NOx) concentration in the chamber was measured with a chemiluminescence analyzer (NOx Analyzer 305A; Shimadzu, Kyoto, Japan). NO and air or O2 were discarded after passing once through the chamber. The chamber was also equipped with urine and stool collectors.
Experimental Design
There were five groups of animals (six in each group). Group 1: mice exposed to fresh room alone (RA). Group 2: mice exposed to fresh air and 2 ppm NO (RA + 2 ppm NO). Group 3: mice exposed to fresh air and 40 ppm NO (RA + 40 ppm NO). Group 4: mice exposed to fresh air, 2 ppm NO, and O2 [FIO2 = 0.24] (RA + 2 ppm NO + O2). Group 5: mice exposed to fresh air, 40 ppm NO, and O2 [FIO2 = 0.24] (RA + 40 ppm NO + O2). Each group of animals was treated for a period of 3 wk to evaluate the effect of chronic exposure to NO on the normal lungs of mice. The O2 concentration was fixed to FI = 0.24 because this is the concentration prescribed to patients with chronic obstructive pulmonary disease undergoing long-term oxygen therapy in Japan.
Sampling of Bronchoalveolar Lavage Fluid
At the end of the treatment, all animals were killed by intraperitoneal
injection of pentobarbital to take samples for biochemical and histologic examinations. Bronchoalveolar lavage fluid (BALF) was obtained after cannulating the trachea with a 20-gauge needle and infusing the lungs four times with 1 mL of saline solution. The recovery of
BALF ranged between 2 and 3.5 mL, with no significant differences in
the volume recovered between the different treatment groups. The
recovered fluid was filtered through a single layer of gauge to remove
mucus. The BALF was then centrifuged (1,000 × g for 10 min at 4° C)
and the cell-free supernatant was stored immediately at 
80° C until
use for biochemical analysis.
Histologic Examination
After thoracotomy, the pulmonary circulation was flushed with saline and the lungs were removed. The left lung of the mouse was perfused with 10% neutral buffered formalin and fixed in formalin for 24 h. After washing in phosphate-buffered saline (PBS), the tissue sections were incubated in 1% H2O2 for 10 min to inhibit peroxidase activity. The tissue sections were embedded in paraffin and then prepared for staining with hematoxilin and eosin or for immunostaining of nitrotyrosine, a marker of peroxynitrite formation. Immunohistochemistry of nitrotyrosine was carried out as described previously (21).
Biochemical Analysis of BALF
Protein concentration in BALF was measured by Bradford's method using the protein assay kit (BioRad Laboratories, Hercules, CA). Thrombin was measured as previously described (15). Soluble tissue factor in BALF was measured using a commercial enzyme immunoassay kit (IMUBIND Tissue Factor ELISA; American Diagnostica, Greenwich, CT). The intraassay and interassay coefficients of variation were 5 and 10%, respectively. Concentration of nitrite/nitrate was measured using a commercial colorimetric assay kit (Cayman Chemical, Ann Arbor, MI).
Reverse Transcription-Polymerase Chain Reaction (RT-PCR) of Tissue Factor in Lung Tissue
Total RNA was extracted from lung tissue of each treatment group of animals by the guanidine isothiocyanate procedure using Trizol Reagent (GIBCO). Five micrograms of total RNA were reverse-transcribed using oligo-dT primers and then the DNA was amplified by PCR. The RT-PCR was performed using the Superscript Preamplification system kit (Life Technologies, Gaithersburg, MD). The sequences of the primers used for mouse tissue factor cDNA (273 bp) amplification were 5'CGGGTGCAGGCATTCCAGAG 3' corresponding to 214-233 nucleotides and 5'CTCCGTGGGACAGAGAGGAC 3' corresponding to nucleotides 435-454. PCR was performed with 35 cycles, denaturation at 94° C for 1 min, annealing at 57° C for 1 min, and elongation at 72° C for 1 min; at the end of these cycles, a further extension was carried out at 72° C for 5 min. The cDNA (532 bp) of the housekeeping gene glyceraldehyde-3-phosphate dehydrogenase (GADPH) was amplified using primers contained in a kit provided by Maxim Biotechnology (San Francisco, CA). The PCR products were separated on a 2% agarose gel containing 0.01% ethidium bromide, and the intensity of the stained bands was quantitated by densitometric analysis on a Macintosh computer using the public domain NIH image program (Wayne Rasband, NIH, Research Service Branch). The amount of mRNA was normalized against the GAPDH mRNA.
Cell Culture
The human lung carcinoma-derived alveolar epithelial cell line A549 was obtained from the American Type Culture Collection (Rockville, MD). The cells were cultured in DMEM containing 10% heat-inactivated fetal bovine serum, 50 µg/mL penicillin, 50 µg/mL streptomycin, 2 mM L-glutamine, 2% vitamin solution, 110 µg/mL sodium pyruvate and 0.1 mM nonessential amino acids in an atmosphere composed of 5% CO2 and 95% air. Confluent cells were harvested by brief exposure to 0.025% trypsin-0.02% EDTA in Hepes-buffered saline (50 mM Hepes, 150 mM NaCl at pH 7.4) and passaged after 5 to 7 d.
Tissue Factor Activity Assay
A549 cells were cultured in 48-well microplates to confluency and then incubated at 37° C under an atmosphere of 95% air and 5% CO2. Tissue factor activity was determined as factor X activation by factor VIIa/tissue factor complex on A549 cells after stimulation with the NO donor FK-409. The cells were incubated for 5 h in the presence of 50 µM FK-409 and varying concentrations of the NO scavenger carboxy-PTIO diluted in DMEM without fetal bovine serum and supplements, and then the cells were washed twice with Hepes-buffered saline containing 5 mM CaCl2. Thereafter, the cells were incubated in the presence of a mixture of 50 µL of 4 nM factor VIIa, 50 µL of 1 µM factor X, and 150 µL of Hepes-buffered saline containing 5 mM CaCl2 for 60 min at room temperature. The reaction was stopped by adding 10 µL of 100 mM EDTA and generated factor Xa was determined using 100 µM S-2222. The reaction was stopped by the addition of 10 µL of 20% acetic acid, and color development was determined by measuring the absorbance of 405 nm with EAR 340 microplate reader (SLT-Lab, Salzburg, Austria).
Statistical Analysis
All data are expressed as the mean ± standard error of the mean, unless otherwise specified. The difference between the means of two variables was calculated by the Mann-Whitney U test and that between three or more variables by analysis of variance. Analysis of residuals showed that the model fit well with our data. The strength of correlation was calculated by Pearson's product-moment correlation. A p < 0.05 was considered statistically significant. Statistical analyses were carried out using the StatView 4.5 package for the Macintosh (Abacus Concepts, Berkeley, CA).
| |
RESULTS |
|---|
|
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES
|
|---|
NO Metabolites and Protein Concentrations in Lung and BALF Samples
As expected, the concentrations of nitrite/nitrate were markedly increased in BALF of mice of the (RA + 2 ppm NO) and (RA + 40 ppm NO) groups and in animals of the (RA + 2 ppm NO + O2) and (RA + 40 ppm NO + O2) groups as compared with animals exposed to RA alone (Figure 1). Immunostaining of nitrotyrosine was performed in each treatment group of animals to assess the degree of peroxynitrite formation in the lung during NO inhalation. Representative lung histologic samples of each treatment group stained for evaluating the presence of nitrotyrosine are shown in Figure 2. Lung specimens from mice of the (RA + 40 ppm NO) and (RA + 40 ppm NO + O2) groups showed significant immunoreactivity for nitrotyrosine. A large number of bronchial and alveolar epithelial cells stained positively for nitrotyrosine; capillaries and cells from the pulmonary interstitium also showed immunoreactivity of nitrotyrosine. Only scarce numbers of bronchial epithelial cells were positive for nitrotyrosine in histologic samples from animals of the (RA + 2 ppm NO) and (RA + 2 ppm NO + O2) groups. The lungs of animals exposed to RA alone were negative for nitrotyrosine. No stain was observed in the absence of the primary antinitrotyrosine antibody or in a section incubated with normal rabbit IgG instead of the antinitrotyrosine antibody.
|
p < 0.05, compared with (RA + 2 ppm NO) group. §p < 0.05, compared with (RA + 2 ppm NO + O2) group: n = 6, each group.
|
The concentration of total protein was measured in BALF of each group (Figure 3). Total protein concentrations were significantly increased in mice of the (RA + 40 ppm NO) and (RA + 40 ppm NO + O2) groups as compared with animals of the (RA) group. Protein concentration in BALF from animals exposed to low concentrations of NO (RA + 2 ppm NO) and (RA + 2 ppm NO + O2) groups were not significantly different from that in the (RA) group. Concomitant administration of NO and O2 did not affect the BALF protein levels as shown by the lack of difference in the BALF protein concentration between (RA + 2 ppm NO) and (RA + 2 ppm NO + O2) groups and between (RA + 40 ppm NO) and (RA + 40 ppm NO + O2) groups.
|
Thrombin Generation in BALF
To evaluate the effect of NO inhalation on activation of the coagulation system in the intraalveolar space, the concentration of thrombin, the key protease of the coagulation system activation, was measured in BALF of all treatment groups. As shown in Figure 4, thrombin generation was significantly increased in animals exposed to high concentrations of NO (RA + 40 ppm NO) and (RA + 40 ppm NO + O2) groups as compared with those exposed to low concentration of NO (RA + 2 ppm NO) and (RA + 2 ppm NO + O2) groups or to (RA) alone. The BALF concentration of thrombin in animals exposed to low concentrations of NO (RA + 2 ppm NO) and (RA + 2 ppm NO + O2) groups were not significantly different from that in the (RA) group. Combined inhalation of O2 and NO did not affect thrombin generation as illustrated by the lack of difference in BALF thrombin levels between (RA + 2 ppm NO) and (RA + 2 ppm NO + O2) groups and between (RA + 40 ppm NO) and (RA + 40 ppm NO + O2) groups.
|
Tissue Factor in Lung and BALF Samples
Tissue factor is the main activator of the extrinsic coagulation system in the lung. To evaluate the effect of NO inhalation on tissue factor expression in the lung, its soluble form was measured in BALF of each treatment group of animals (Figure 5). The concentration of soluble tissue factor in BALF was significantly increased in animals exposed to high concentrations of NO (RA + 40 ppm NO) and (RA + 40 ppm NO + O2) groups as compared with those exposed to low concentration of NO (RA + 2 ppm NO) and (RA + 2 ppm NO + O2) groups or to the (RA) group. The concentration of tissue factor in BALF from animals exposed to low concentrations of NO (RA + 2 ppm NO) and (RA + 2 ppm NO + O2) groups were not significantly different from that in the (RA) group. Combined inhalation of O2 and NO did not affect the concentration of soluble tissue factor in BALF because BALF thrombin levels were not significantly different between (RA + 2 ppm NO) and (RA + 2 ppm NO + O2) groups and between (RA + 40 ppm NO) and (RA + 40 ppm NO + O2) groups (Figure 5).
|
The BALF concentrations of thrombin and tissue factor were significantly and proportionally correlated, suggesting that increased expression of tissue factor in the lung was associated with enhanced activation of the blood coagulation system in the intraalveolar space (Figure 6). The expression of tissue factor mRNA was also evaluated in the lung by RT-PCR. The lung tissue factor mRNA expression was increased 3-fold in the (RA + 2 ppm NO) group, 12-fold in the (RA + 40 ppm NO), 4-fold in the (RA + 2 ppm NO), and 22-fold in the (RA + 40 ppm NO + O2) groups as compared with animals of the (RA) group (Figure 7).
|
|
Tissue Factor Activity Induced by NO Donor on Alveolar Epithelial Cells
The NO donor FK-409 increased significantly the activity of tissue factor on A549 cells; this effect of FK-409 was significantly inhibited by the NO scavenger carboxy-PTIO in a dose-dependent manner, implicating NO in the enhanced activity of tissue factor in alveolar epithelial cells (Figure 8).
|
| |
DISCUSSION |
|---|
|
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES
|
|---|
The use of NO as an inhaled in lung diseases with hypoxemia and pulmonary hypertension is still a matter of controversy. The focus of major concern is its potential toxic effect on lung structural components as demonstrated by the results of several previous studies (22). The untoward effect of NO on lung parenchyma may be one of the causative factors involved in the poor outcome of patients with acute respiratory distress syndrome despite its undoubted beneficial effects on hypoxemia and pulmonary hypertension. Understanding the factors that enhance the potential risk of NO inhalation is fundamental for delineating safe guidelines for its therapeutic indication in clinical practice. The clinical conditions of the disease, concentration of the gas, duration of therapy, and the concomitant administration of oxygen therapy may be important determining factors of the benefit/risk ratio during NO inhalation (23). In the present study, we evaluated the effect of long-term administration of inhaled NO on the activation of coagulation system, a common denominator of acute lung injury, in the normal lung of mice. Low (2 ppm) and high (40 ppm) doses of NO with or without concomitant inhalation of a fixed concentration of O2 were administered to assess the dose-dependency of the effect of inhaled NO on lung injury. Our investigation showed that high doses of NO administered continuously for 3 wk triggered substantial increases in tissue factor expression and thrombin generation in the lung of the mouse. Neither low dose of NO nor concomitant administration of O2 affected activation of the coagulation system in the lung.
Activation of the coagulation system with enhanced thrombin generation in the lung has been implicated in the pathogenesis of acute lung injury (13). The clinical significance of the coagulation system in lung diseases has been additionally reinforced by recent observations demonstrating the value of markers of thrombin generation as prognostic indicators in patients with acute lung injury (24, 25). Thrombin may participate in tissue damage through different mechanisms. Thrombin may stimulate vascular permeability, plasma exudation and accelerated conversion of fibrinogen to fibrin which, if it accumulates, may promote fibroblast chemotaxis and collagen deposition in the interstitium and intraalveolar space of the lung (26). Thrombin may also activate proteases of the metalloproteinase family and thus further promote tissue remodeling in the lung (13). In the present study, the increased concentration of protein in BALF of mice exposed to high concentration of NO probably resulted from increased vascular permeability induced by thrombin. Thrombin is generated after the proteolytic degradation of prothrombin by prothrombinase, an enzymic complex composed of activated factor X, activated factor V, calcium ions, and phospholipids that is formed after activation of factor X by the tissue factor/activated factor VII complex (27). The expression of tissue factor is the major triggering factor of the activation of this coagulation cascade. The significant association between thrombin generation and soluble tissue factor found in BALF of the animals suggests a role for tissue factor in coagulation system activation after inhalation of high concentration of NO.
The cellular source of tissue factor in the lung may be bronchial, alveolar epithelial cells or alveolar macrophages (13). To evaluate the role of alveolar epithelial cells in the expression of tissue factor by NO, we assessed the effect of a NO donor on tissue factor activity in A549 cells. In agreement with
the observation in mice, NO donor was also found to induce
enhanced activity of tissue factor on A549 cells; this effect was
significantly inhibited by the NO scavenger carboxy-PTIO in a
dose-dependent manner, implicating NO in the enhanced activity of tissue factor in alveolar epithelial cells. Several mechanisms may be involved in the induction of tissue factor by
NO. This free radical may indirectly enhance the expression of
tissue factor by stimulating the secretion of tumor necrosis
factor- and interleukin-1 from macrophages that are well-known stimulants of tissue factor expression in these cells
(28). NO may also promote endotoxin-induced expression of
tissue factor in monocytes (17). The expression of tissue factor
is known to be upregulated by the transcription factor NF-
B
(29). Increased activation of NF-B may explain the enhanced expression of tissue factor in our animal model; high-dose, but not low-dose, NO may enhance the activation of NF-B (30).
In addition, NO may be associated with increased procoagulant activity by promoting apoptosis, which is associated with
increased cell surface tissue factor procoagulant activity, or by
inhibiting the activation of protein C, which is the main enzyme of the anticoagulant system (31, 32). It is worthy to note
here that, based on previous in vitro observations, a dual effect of inhaled NO may also be possible. In this regard, it has
been shown that NO promotes protein expression in activated
or stimulated cells, whereas it inhibits protein expression in
resting cells (33, 34). Thus, it is conceivable that, in animal
models of lung injury, inhaled NO may rather inhibit activation of the coagulation system in the lungs.
Long-term administration of inhaled NO in combination with oxygen for treating patients with chronic obstructive pulmonary disease and pulmonary hypertension is currently under clinical investigation (2, 3). However, the potential systemic and lung toxicity of inhaled NO administered on a chronic basis remains to be clarified. For example, it has been shown in previous studies that short-term inhalation of high-dose NO prolongs or exerts no effect on bleeding time (35); however, in our present experimental model we showed for the first time that long-term inhalation of high-dose NO stimulates procoagulant activity in the normal lungs of mice. For clinical practice it would be ideal to use inhaled NO at low doses and to administer it on an ambulatory basis. We have shown previously that low-dose inhaled NO (2 ppm) in combination with O2 (1 L/min) is equally effective as high-dose NO for improving pulmonary hypertension in patients with chronic pulmonary disease (2, 3). In the present study, long-term inhalation of low-dose (2 ppm) NO alone or in combination with O2 (1 L/min) induced no protein exudation nor tissue factor expression, suggesting the relative safety of the long-term administration of inhaled NO at low doses.
In conclusion, the results of this study have shown for the first time that long-term inhalation of high, but not low, concentration of NO may activate the coagulation system by increasing the lung expression of tissue factor.
| |
Footnotes |
|---|
Correspondence and requests for reprints should be addressed to Dr. Esteban C. Gabazza, M.D., Third Dept. of Internal Medicine, Mie University School of Medicine, Edobashi 2-174, Tsu-city, Mie 514 8507, Japan.
(Received in original form February 11, 2000 and in revised form August 11, 2000).
| |
References |
|---|
|
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES
|
|---|
1.
Rossaint R,
Falke KL,
Lopez F,
Slama K,
Pison U,
Zapol WM.
Inhaled
nitric oxide for the adult respiratory distress syndrome.
N Engl J Med
1993;
328:
399-405
2. Yoshida M, Taguchi O, Gabazza EC, Yasui H, Kobayashi T, Kobayashi H, Maruyama K, Adachi Y. The effect of low-dose inhalation of nitric oxide in patients with pulmonary fibrosis. Eur Respir J 1997; 10: 2051-2154 [Abstract].
3. Yoshida M, Taguchi O, Gabazza EC, Kobayashi T, Yamakami T, Kobayashi H, Maruyama K, Shima T. Combined inhalation of nitric oxide and oxygen in chronic obstructive pulmonary disease. Am J Respir Crit Care Med 1997; 155: 526-529 [Abstract].
4. Betit P, Thompson J. Inhaled nitric oxide in the management of cardiopulmonary disorders in infants and children. Respir Care Clin North Am 1997; 3: 459-481 .
5. Lundin S, Mang H, Smithies M, Stenqvist O, Frostell C. Inhalation of nitric oxide in acute lung injury: results of a European multicenter study. The European Study Group of Inhaled Nitric Oxide. Intensive Care Med 1999; 25: 911-999 [Medline].
6. Hallman M, Waffarn F, Bry K, Turbow R, Kleinman MT, Mautz WJ, Rasmussen RE, Bhalla DK, Phallen RF. Surfactant dysfunction after inhalation of nitric oxide. Am J Physiol 1996; 80: 2026-2034 .
7.
Rayhrer CS,
Edmisten TD,
Cephas GA,
Tribble CG,
Kron IL,
Young JS.
Nitric oxide potentiates acute lung injury in an isolated rabbit lung
model.
Ann Thorac Surg
1997;
65:
935-938
8.
Fortenberry JD,
Owens ML,
Brown MR,
Atkinson D,
Brown LA.
Exogenous nitric oxide enhances neutrophil cell death and DNA fragmentation.
Am J Respir Cell Mol Biol
1998;
18:
421-428
9.
De Sanctis GT,
MacLean JA,
Hamada K,
Mehta S,
Scott JA,
Jiao A,
Yandava CN,
Kobzik L,
Wolyniec WW,
Fabian AJ,
Venugopal CS,
Grasemann H,
Huang PL,
Drazen JM.
Contribution of nitric oxide
synthases 1, 2 and 3 to airway hyperresponsiveness and inflammation
in a murine model of asthma.
J Exp Med
1999;
189:
1621-1630
10. Kuo H, Liu S, Barnes PJ. The effect of endogenous nitric oxide on neurogenic plasma exudation in guinea-pig airway. Eur J Pharmacol 1992; 221: 385-388 [Medline].
11. Bernareggi M, Mitchell JA, Barnes PJ, Belvisi MG. Dual action of nitric oxide on airway plasma leakage. Am J Respir Crit Care Med 1997; 155: 869-874 [Abstract].
12. Arock M, Le Goff L, Becherel PA, Dugas B, Debre P, Mossalayi MD. Involvement of Fce RII/CD23 and L-arginine dependent pathway in IgE-mediated activation of human eosinophils. Biochem Biophys Res Commun 1994; 203: 265-271 [Medline].
13.
Chapman HA Jr,,
Bertozzi P,
Reilly JJ.
Role of enzymes mediating thrombosis and thrombolysis in lung disease.
Chest
1994;
93:
1256-1263
14. Chapman HA, Allen CL, Stone AL. Abnormalities in pathways of alveolar fibrin turnover among patients with interstitial lung disease. Am Rev Respir Dis 1986; 133: 137-443 .
15. Gabazza EC, Taguchi O, Tamaki S, Takeya H, Kobayashi H, Yasui H, Kobayashi T, Hataji O, Urano H, Zhou H, Suzuki K, Adachi Y. Thrombin in the airways of asmatic patients. Lung 1999; 177: 253-262 [Medline].
16.
Kobayashi H,
Gabazza EC,
Taguchi O,
Wada H,
Takeya H,
Nishioka J,
Yasui H,
Kobayashi T,
Hataji O,
Suzuki K,
Adachi Y.
Protein C anticoagulant system in patients with interstitial lung disease.
Am J Respir
Crit Care Med
1998;
157:
1850-1854
17. Polack B, Pernod G, Barro C, Doussiere J. Role of oxygen radicals in tissue factor induction by endotoxin in blood monocytes. Haemostasis 1997; 27: 193-200 [Medline].
18. Golino P, Ragni M, Cirillo P, Avvedimento E, Feliciello A, Esposito N, Scognamiglio A, Trimarco B, Iaccarino G, Condorelli M, Chiarieello M, Ambrosio G. Effects of tissue factor induced by oxygen free radicals on coronary flow during reperfusion. Nat Med 1996; 2: 35-40 [Medline].
19.
Sokol GM,
Van Meurs KP,
Wright LL,
Rivera O,
Thorn WJ,
Chu PM,
Dams RL.
Nitrogen dioxide formation during inhaled nitric oxide
therapy.
Clin Chem
1999;
45:
382-387
20.
Maruyama J,
Maruyama K,
Mitani Y,
Kitabatake M,
Yamauchi T,
Miyasaka KK.
Continuous low-dose NO inhalation does not prevent
monocrotaline-induced pulmonary hypertension in rats.
Am J Physiol
1997;
272:
H517-524
21. Ochiai-Kanai R, Hasegawa K, Yoshihiro Y, Yoshioka H, Sawada T. Immunohistochemical nitrotyrosine distribution in neonatal rat cerebrocortical slices during and after hypoxia. Brain Res 1999; 847:59-70.
22.
Smith PG,
Blumer J.
NO good
or not?
Crit Care Med
1999;
27:
1059-1060
[Medline].
23. Garat C, Jayr C, Eddahibi S, Laffon M, Meignan M, Adnot S. Effects of inhaled nitric oxide or inhibition of endogenous nitric oxide formation on hyperoxic lung injury. Am J Respir Crit Care Med 1997; 155: 1957-1964 [Abstract].
24. Meduri GU. The role of the host defence response in the progression and outcome of ARDS: pathophysiological correlations and response to glucocorticoid treatment. Eur Respir J 1996; 12: 2650-2670 .
25. Gando S, Nakanishi Y, Tedo I. Cytokines and plasminogen activator inhibitor-1 in posttrauma disseminated intravascular coagulation: relationship to multiple organ dysfunction syndrome. Crit Care Med 1995; 23: 1835-1842 [Medline].
26. Nakstad B, Lyberg T, Skjonsberg OH, Boye NP. Local activation of the coagulation system and fibrinolysis systems in lung disease. Thromb Res 1990; 57: 827-838 [Medline].
27. Deguchi H, Takeya H, Gabazza EC, Nishioka J, Suzuki K. Prothrombin kringle 1 domain interacts with factor Va during the assembly of prothrombinase complex. Biochem J 1997; 321: 729-731 .
28. Marcinkiewicz J, Grabowska A, Chain B. Nitric oxide up-regulates the release of inflammatory mediators by mouse macrophages. Eur J Immunol 1995; 25: 947-951 [Medline].
29.
Bohrer H,
Qiu F,
Zimmermann T,
Zhang Y,
Jllmer T,
Mannel D,
Bottiger BW,
Stern DW,
Waldherr R,
Saeger HD,
Ziegler R,
Bierhaus A,
Martin E,
Nawroth PP.
Role of NFB in the mortality of sepsis.
J Clin
Invest
1997;
100:
972-985
[Medline].
30. Umansky V, Hehner SP, Dumont A, Hofmann TG, Schirrmacher V, Droge W, Schmitz ML. Co-stimulatory effect of nitric oxide on endothelial NF-kappaB implies a physiological self-amplifying mechanism. Eur J Immunol 1998; 28: 2276-2282 [Medline].
31. Greeno EW, Bach RR, Moldo CF. Apoptosis in associated with increased cell surface tissue factor procoagulant activity. Lab Invest 1996; 75: 281-289 [Medline].
32. Kobayashi T, Taguchi O, Gabazza EC, Yasui H, Hataji O, Adachi Y. Decreased intraalveolar activation of the protein C anticoagulant system in patients with interstitial lung disease (abstract). Am J Respir Crit Care Med 1998;A74.
33.
Schrickerm K,
Kurtz A.
Liberators of NO exert a dual effect on renin secretion from isolated mouse renal juxtaglomerular cells.
Am J Physiol
1993;
265:
F180-186
34.
Brown AS,
Moro MA,
Masse JM,
Cramer EM,
Radomski M,
Darleyusmar V.
Nitric oxide-dependent and independent effects on human
platelets treated with peroxinitrite.
Cardiovasc Res
1998;
40:
380-388
35. Albert J, Wallen NH, Li N, Frostell C, Hjemdahl P. Neither endogenous nor inhaled nitric oxide influences the function of circulating platelets in healthy volunteers. Clin Sci 1999; 97: 345-353 [Medline].
This article has been cited by other articles:
 |
|
 |
|
  D. Salinas, L. Sparkman, K. Berhane, and V. Boggaram Nitric oxide inhibits surfactant protein B gene expression in lung epithelial cells Am J Physiol Lung Cell Mol Physiol, November 1, 2003; 285(5): L1153 - L1165. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Y. Kirov, O. V. Evgenov, V. N. Kuklin, L. Virag, P. Pacher, G. J. Southan, A. L. Salzman, C. Szabo, and L. J. Bjertnaes Aerosolized Linear Polyethylenimine-Nitric Oxide/Nucleophile Adduct Attenuates Endotoxin-induced Lung Injury in Sheep Am. J. Respir. Crit. Care Med., December 1, 2002; 166(11): 1436 - 1442. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. J. TOBIN Critical Care Medicine in AJRCCM 2001 Am. J. Respir. Crit. Care Med., March 1, 2002; 165(5): 565 - 583. [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Proc. Am. Thorac. Soc. | Am. J. Respir. Cell Mol. Biol. |