| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
 |
ABSTRACT |
|---|
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES
|
|---|
Atopy is generally considered to be caused by interaction of genetic and environmental factors. Recently, an association of a C-to-T
transition in the promoter region of the CD14 gene on chromosome 5q31.1 and atopic phenotypes was reported in a population study of school children in the United States. The aim of the present study was to investigate the association of the C allele of
the CD14/
159 with phenotypes of atopy and asthma in an adult Dutch population in which linkage of total serum IgE and bronchial hyperresponsiveness to chromosome 5q31-33 is present. We
studied 159 probands with asthma and 158 spouses as controls.
Phenotypes for asthma (e.g., bronchial hyperresponsiveness, physician's diagnosis) and for atopy (e.g., total serum IgE level, intracutaneous skin test, allergic rhinitis) were studied. In this population, homozygotes for the C allele had a higher number of positive
skin tests and higher total serum IgE levels (in skin test-positive individuals) and subsequently, more self-reported allergic symptoms
including rhinitis and hay fever, compared with subjects with CT
and TT alleles. We conclude that the 159 C-to-T promoter polymorphism in the CD14 gene may result in expression of a more severe allergic phenotype.
| |
INTRODUCTION |
|---|
|
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES
|
|---|
Atopic diseases, such as asthma, allergic rhinitis, and eczema, are characterized by an elevated and prolonged immunoglobulin E (IgE) antibody response after exposure to ubiquitous, nonpathogenic allergens. Atopy is generally considered to be caused by the interaction of genetic and environmental factors (1). There is concern about the worldwide rise of atopic diseases over the past decades and different hypotheses have been proposed to explain this increased prevalence (2). Changes in environmental factors most likely play an important role, such as life style, diet, air pollution, allergen exposure, and microbial environment (3, 4). Recent studies have suggested that bacterial infections in infancy may protect against the development of allergy (5). In 1997, Holt and coworkers hypothesized that bacterial signals play a functional role in the maturation of the Th1-type immune response, thereby suppressing the Th2-type response, which may produce an atopic phenotype. Microbial products, such as lipopolysaccharides (LPS), can provide activation signals for Th1-maturation (6).
The pathway through which LPS may exert its function includes high- and low-affinity LPS receptors. An important high-affinity receptor for LPS and other bacterial wall components is CD14, a 55-kD glycosylphosphatidylinositol-anchored protein localized on monocytes, macrophages, and polymorphonuclear cells. Binding of LPS to CD14 is facilitated by lipopolysaccharide-binding protein. CD14 is also present as soluble CD14 (sCD14) in serum, where it acts like membrane-bound CD14 in cells that do not express CD14 (7).
The gene encoding CD14 is a positional candidate gene for
atopy, as it is localized on chromosome 5q31.1 (8), a region that has been linked to asthma and atopic responses (9). In 1999, Baldini and coworkers (15) reported the association of a
polymorphism in the CD14 gene and atopy. In the promoter
region of the CD14 gene, a C-to-T transition was identified
at position 159 upstream from the major transcription site
(CD14/159). In a Caucasian subset (n = 314) of a general
population sample of 11-yr-old children from the United States,
homozygotes with TT had higher serum levels of sCD14 than
homozygotes with CC. In addition, among skin test-positive
children, homozygotes with the TT genotype had lower levels
of serum total IgE and a lower number of positive skin prick
tests, when compared with the pooled group of subjects carrying CC and CT (15). This study did not assess the effect of
CD14 on asthma and allergic rhinitis.
The purpose of the present study was to investigate whether
the C allele of the CD14/159 was associated with elevated
total serum IgE levels and number of positive skin tests in an
adult Dutch population, in which linkage of total IgE levels
and bronchial hyperresponsiveness to chromosome 5q has
been previously reported (9, 12). In addition, we investigated
whether this polymorphism was associated with allergic rhinitis and asthma phenotypes.
| |
METHODS |
|---|
|
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES
|
|---|
Study Population
Subjects were selected from a family study on the genetics of asthma
in the Netherlands, which has been described in detail by Panhuysen
and coworkers (16). Between 1962 and 1975, patients with asthma
were evaluated for diagnosis of asthma and optimization of their
treatment in Beatrixoord, Haren, The Netherlands. For inclusion in
this study, from this first evaluation patients had to meet three criteria: (1) symptoms consistent with asthma; (2) age 
45 yr, and (3)
bronchial hyperresponsiveness to histamine (PC20 32 mg/ml using
the de Vries 30-s inhalation method) (17).
From 1990 onward, these probands were restudied together with their spouses, a minimum of two children, and, if possible, grandchildren. In total, 200 two- and three-generation families have been studied. Using a case-control approach, probands and their spouses were selected from these families. Data are presented from 159 probands and 158 spouses, from whom DNA was available at the time of this study.
Clinical Assessment
The first evaluation (1962-1975) included the performance of intracutaneous skin tests with common aeroallergens, pulmonary function
testing with a water-seal spirometer (Lode Spirograph, Groningen,
The Netherlands), and testing for bronchial hyperresponsiveness with
histamine, using the 30-s inhalation protocol as described by de Vries
and coworkers (17). At the second evaluation (1990-1998), these
measurements were repeated in the probands, and also performed in
the relatives. Reversibility was tested by repeating spirometry 20 min
after administration of 800 µg of salbutamol (albuterol). All participants were asked to stop pulmonary medication before the clinical
testing if possible: inhaled corticosteroids were stopped for 14 d, inhaled long-acting 
-mimetics and oral antihistamines 48 h, and inhaled short-acting -mimetics and anticholinergics 8 h. The asthma
patients did not have an asthma exacerbation or require a course of
oral prednisone in the 6 wk prior to the study.
This evaluation further included a modified version of the British Medical Council questionnaire with additional questions on symptoms and therapy of asthma and allergy (16). By definition, a physician's diagnosis of asthma was present in the probands. In the spouses, it was present if the subject reported (1) being under current regular treatment for asthma, (2) having ever visited a general practitioner or specialist for asthma, or (3) having ever used asthma medication. Allergic rhinitis was defined as a positive answer to the following question: Do you have a runny or stuffed nose when you are near animals (e.g., dogs, cats, horses), feathers (e.g., in pillows), a dusty part of the house, or trees, grasses, or flowers? Hay fever was defined as a positive answer to the following question: Did you ever have hay fever?
Serum total IgE was measured in the first 92 families by solid-phase
immunoassay (16). In the second set of 108 families, serum IgE levels
were measured by an enzyme-linked fluorescent assay (Mini Vidas;
Biomerieux Vitek Inc., Marcy, France). Skin testing was performed by
an intracutaneous skin test with 16 common aeroallergens, a positive
control, and a negative control. The following allergens were tested:
mixed grass pollens, two mixed tree pollens, mixed weeds, house dust
mite, storage mite, cat-, dog-, horse-, and rabbit/guinea pig dander,
feather mix, and five molds (Aspergillus fumigatus, Alternaria alternata,
Cladosporium herbarum, Penicillum notatum, and Botrytis cineria)
(ALK-Abelló, Nieuwegein, The Netherlands). A positive skin test was
considered to be present if the largest wheal diameter was 
5 mm.
The Medical Ethics Committee of the University Hospital of Groningen and the University of Maryland approved this study. Written informed consents were obtained from all participants.
Molecular Methods
DNA was extracted using standard protocols (Puregene kit; Gentra
Systems Inc., Minneapolis, MN). Genotyping of the CD14/159 polymorphism was performed according to the protocol described by Baldini and coworkers (15). Briefly, polymerase chain reaction (PCR)
was performed in 10 µl volumes consisting of 60 ng of DNA, 250 µM
dNTP, 1.5 mM MgCl, 10 × buffer (Life Technologies, Rockville, MD), 0.5 U Taq polymerase, and 0.1 µM primer 5'GCCTCTGACAGTTTATGTAATC3' and primer 5'GTGCCAACAGATGAGGTTCAC3'. Cycling conditions were 94° C for 3 min, 28 cycles of 94° C for
30 s, 57° C for 30 s, 72° C for 30 s, and a final extension of 72° C for
6 min. PCR-amplified DNA was digested with 5 U AvaII and 1 µl of
the manufacturer's buffer (New England Biolabs Inc., Beverly, MA)
at 37° C for 2 h. Products were fractioned on 2.0% agarose gel. AvaII
digests the PCR product only when the T allele is present. The uncut
product is 497 bp whereas the digested products are 144 and 353 bp
(Figure 1). The results of this restriction fragment length polymorphism assay were confirmed by direct sequencing of the 159 promoter region of the CD14 gene in 32 patients and controls.
|
Statistical Methods
Three different genetic models were tested. To study a recessive model for the C allele, CC homozygotes were compared with CT heterozygotes and TT homozygotes. To study a recessive model for the T allele, TT homozygotes were compared with individuals with CT and CC. To study a codominant model, the three genotype groups were analyzed separately.
Both parametric (t test, ANOVA) and nonparametric analyses (Mann-Whitney, Kruskal-Wallis test) were used to study phenotypic differences in each genotype group, depending on the normality of the distribution of the variables. The number of skin tests was not normally distributed, whereas serum IgE levels were log transformed to obtain a normal distribution. Linear and logistic regression analyses were used to test and correct for known confounding variables, such as age, sex, and smoking. Results were considered significant if p < 0.05 (two sided). All calculations were performed with the SPSS 8.0 statistical package.
| |
RESULTS |
|---|
|
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES
|
|---|
Study Population
Baseline characteristics of the study population at the second evaluation (1990-1998) are shown in Table 1. Probands were predominantly male and their mean age was 52 yr. All probands were hyperresponsive at initial testing. Although probands were not selected for atopy, 79.9% had atopy as measured by a positive skin test, compared with 29.1% of the spouses.
|
Genotype Frequency of the CD14/159 Polymorphism
The genotype frequencies in probands were 32.1% for CC homozygotes, 47.8% for CT heterozygotes, and 20.1% for TT homozygotes. In the spouses, these frequencies were 19.6%, 53.8%, and 26.6%, respectively.
Association of the C Allele with Total IgE Levels, Skin Tests, Hay Fever, and Allergic Rhinitis
Based on the report of Baldini and coworkers (15), the primary analysis was the association of CD14/159 and skin tests and serum total IgE levels. In the skin test-positive population, CC homozygotes had significantly higher serum IgE levels
compared with CT heterozygotes and TT homozygotes (p = 0.036) The difference between the latter was not significant in
skin test-negative individuals (Table 2).
|
In the skin test-positive population as well as in the total population, CC homozygotes had a higher number of positive skin tests compared with CT heterozygotes and TT homozygotes. In skin test-positive individuals, the median (mean) number of positive skin tests in individuals with CC was 5 (5.61), for CT 4 (4.19), and for TT 3 (3.76) (Figure 2). The difference was significant in a codominant model (p = 0.01). This difference was also significant in a recessive model for the C allele (p = 0.008) (Figure 2).
|
In a logistic regression analysis, CC homozygotes had a
higher frequency of reporting hay fever (odds ratio [OR] 2.15, 95% confidence interval (CI) 1.18-3.92) and allergic rhinitis
(OR 1.80, 95% CI 1.08-2.99), compared with individuals carrying CT and TT. After introduction of skin test positivity in
three classes (0, 1-4, 5 positive skin tests) into this regression analysis, this association was no longer significant (allergic rhinitis: CD14 CC homozygotes: OR 1.54, 95% CI 0.89-
2.67; skin test positivity: OR 2.53, 95% CI 1.88-3.43; hay fever:
CD14 CC homozygotes: OR 1.78, 95% CI 0.92-3.45; skin test
positivity: OR 3.61, 95% CI 2.39-5.44).
Association of the C Allele with Asthma
The CD14/159 genotype was not associated with doctor's diagnosed asthma and bronchial hyperresponsiveness to histamine, and peripheral blood eosinophilia (p > 0.05). In the total population of subjects with asthma and their spouses, the
CD14 genotype showed borderline significance with prebronchodilator FEV1 expressed as percentage of predicted in a
codominant model (p = 0.05) and in a recessive model for the
C allele (p = 0.015). The CD14/159 was not associated with
FEV1 level when analyzed within the group of patients with
asthma. Reversibility to a bronchodilator expressed as the
change in FEV1 was not related to the CD14 genotype either in the total or in the asthmatic population.
| |
DISCUSSION |
|---|
|
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES
|
|---|
This study confirms an association of the CD14/159 promoter polymorphism with the number of positive skin tests
and total serum IgE levels in skin test-positive individuals. In
this population selected for probands with asthma, as well as
in the population studied by Baldini and coworkers, the
CD14/159 genotype was not associated with atopy defined
by at least one positive skin test (15). Therefore, the CD14/
159 genotype does not appear to represent a susceptibility
gene for the development of atopy, yet it appears to produce a
more severe atopic phenotype, that is, a higher total number
of positive skin tests and a higher total IgE level in skin test-positive individuals.
In the population of children as described by Baldini and
coworkers, the C allele of the CD14/159 polymorphism had
a dominant effect on total IgE levels and the number of positive skin tests (15). In our data, the C allele is associated with a
higher number of positive skin tests in a codominant model,
and with higher total IgE levels and higher number of positive
skin tests in a recessive model. The results confirm the importance of the C allele influencing the expression and severity of
the atopic phenotype. One might argue that this difference in
the genetic model suggests that these data do not confirm the
previous association study completely. However, we regard
this finding as a confirmation, given the same direction of the
phenotypical effects of the C allele (higher number of skin
tests, higher serum IgE levels). The unresolved difference between these studies is the influence of having one C allele, as
the difference between the genetic models is the grouping of
the heterozygotes. Possible explanations include differences in
recruitment strategies of these populations, an age effect
(mean age of our population is 52 yr versus 14 yr in the study
of Baldini and coworkers), or different gene-gene and gene-
environmental interactions in these different populations.
We could not find a significant association of CD14/159
with phenotypes of asthma, such as bronchial hyperresponsiveness and physician's diagnosis of asthma. These data fit
our hypothesis that separate genes appear to regulate susceptibility to high total serum IgE levels and bronchial hyperresponsiveness on chromosome 5q (12). Atopy and asthma, although separate disease entities, are closely related and it is
difficult to distinguish their specific expression on the clinical
phenotype. Several studies have shown that total serum IgE
levels as well as the number of positive skin prick tests are associated with the presence of bronchial hyperresponsiveness,
the development of asthma symptoms, and a physician's diagnosis of asthma (18, 19). Due to this close interrelation of
asthma and atopy, alleles that are associated with atopy will be
overrepresented in individuals with asthma when compared
with the general population. It is possible that genetic studies
that separate the effects of atopic and asthmatic genotypes
may increase our basic understanding of how allergic factors
affect the development and progression of asthma.
A genetic association may be confounded by population
admixture or can be observed as the result of linkage disequilibrium with another allele (20). Because all individuals in our
study are white and are from a relatively homogeneous population in the northern part of the Netherlands, association due
to population admixture seems very unlikely. Linkage disequilibrium as a possible confounder cannot be excluded. However, other polymorphisms in the promoter region of the
CD14 gene have not been identified to date (15, 21). The same
promoter polymorphism was reported by Hubacek and coworkers (22) in a study on myocardial infarction (260 C-to-T
transition). CD14/159 is 260 base pairs upstream from the
major translation region of CD14 (J. A. Hubacek, personal communication). Interestingly, in this study the T allele had a
higher frequency in survivors of myocardial infarction compared with a control group indicating a possible role of CD14
in atherosclerosis (22).
Hall (23) suggested four criteria for a specific gene to become an established biological candidate gene in a complex disease: (1) consistent association, (2) location of the gene in a chromosomal area of linkage, (3) change in protein level or function by the mutation, and, finally, (4) biological plausibility of the gene for the disease.
Two previous studies have reported an association of
CD14/159 with serum total IgE levels (15, 24). Apart from
the study by Baldini and coworkers, Gao and coworkers (24)
studied the association of this polymorphism in a British (n = 300) and Japanese population (n = 200). The CD14 genotype
appeared to be associated with total IgE levels in RAST-negative individuals in a recessive model for the C allele in the British sample. This finding differed from the results in skin test-
positive individuals in the United States and The Netherlands.
These authors concluded that CD14 might not be an atopy locus, but may act as a basic modifier of serum total IgE levels.
The CD14 gene is localized on chromosome 5q31.1, an area consistently reported to be linked to phenotypes of asthma and atopy. However, linkage analysis for a modifier effect within skin test-positive family members has not been performed (9, 12).
The functional role of CD14/159 was indicated by the
finding that CC homozygotes have lower levels of sCD14 and
a lower density of CD14 on monocytes than TT homozygotes
(15, 22). This suggests that CD14/159 could influence the
transcription rate of the CD14 gene. CD14/159 is near an
SP1 binding site that has a major influence on monocyte specific expression of CD14, and near a CCAAT/enhancer-binding protein site that may play an important role in promoter
activation of the CD14 gene during monocyte development
(25, 26). In addition, CD14/159 is 1 base pair upstream from
a putative AP-2-binding site (25). More functional studies are
needed to study the effect of CD14/159 on promoter activity.
Finally, is CD14 a plausible biologic gene for atopy? CD14 is a multifunctional receptor and may play a role in different biological and pathophysiological processes: apoptosis, sepsis, and inflammatory diseases, such as atherosclerosis and atopy (5, 27, 28). There are several plausible explanations for a possible role of CD14 in atopy. CD14 on monocytes and polymorphonuclear cells functions as a receptor for LPS, thereby inducing mediator and cytokine release, including interleukin (IL)-6 and IL-8. Blockade of CD14 prevents release of LPS-induced cytokines. Thus, CD14 may be involved in a proinflammatory pathway through the release of cytokines (7). In addition, Jabara and Vercelli (29) suggested a direct action of CD14 on monocytes, thereby inhibiting IgE production by B-lymphocytes. Finally, Holt and coworkers (6) suggested that LPS or other bacterial wall products could stimulate antigen-presenting cells (APCs) (e.g., dendritic cells) to produce IL-12 through the action of sCD14 (30). The source of LPS could be either the microbial flora from the gastrointestinal tract, inhaled LPS from house dust, or bacterial infection (6). Subsequently, genetically determined higher levels of sCD14 in serum (15), or a higher density of membrane-bound CD14 could result in a stronger IL-12 signal of these APCs, which in turn may be a potent signal for Th1 maturation in early life. The interesting question is whether CD14-LPS interactions have a relevant role in the development of atopy. If this is true, the interaction of age, infectious exposure, as well as environmental factors such as allergens needs to be investigated.
Besides the possible role of CD14 in the development of
atopy, we studied the CD14 genotype in relationship to asthma
severity. Several studies have indicated that LPS inhalation in
patients with asthma is associated with the severity of asthma, as
assessed by medication use, clinical scores, and an increased
bronchial responsiveness to histamine (31). From studies
of bronchoalveolar lavage, it has been suggested that CD14-mediated cell activation could play a role in the inflammatory
response after allergen challenge (34, 35). We asked if genetic
variation in the CD14 gene could therefore play a modifying
role in asthma severity. In the combined sample of cases and
controls, evidence for an association of CD14/159 with prebronchodilator FEV1 levels was identified. This association was
not significant in the group of patients with asthma only. One
reason for this may be lack of power. We conclude that these
analyses need to be repeated in a larger sample size before definitive conclusions can be drawn.
In summary, in this study the association of a 159 C-to-T
promoter polymorphism and atopy is confirmed. Homozygotes
for the C allele had a higher number of positive skin tests and
higher total serum IgE levels (in skin test-positive individuals)
and, subsequently, more self-reported allergic rhinitis and hay fever.
| |
Footnotes |
|---|
Correspondence and requests for reprints should be addressed to Professor D.S. Postma, Department of Pulmonology, P.O. Box 30.001, 9700 RB Groningen, The Netherlands. E-mail: d.s.postma{at}int.azg.nl
(Received in original form April 14, 2000 and in revised form July 24, 2000).
Acknowledgments: The authors would like to thank all participants of the study, and E. Gankema, H. Koops, M. Leever, and D. Faber who assisted in the clinical testing. In addition, we are thankful to C. I. M. Panhuysen, B. Meijer, and G. G. Meijer for their work in patient recruitment.
This study was supported by the Netherlands Asthma Foundation (Grant AF 95.09), the "Jan Kornelis de Cock Stichting," and the National Institute of Health (Grant R01 HL48341).
| |
References |
|---|
|
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES
|
|---|
1. Postma DS, Bleecker ER. Genetics of asthma. In: Barnes PJ, Grunstein MM, Leff AR, Woolcock AJ, editors. Asthma. Philadelphia: Lippincott-Raven; 1997. p. 145-154.
2. Burney PGJ. Epidemiologic trends. In: Barnes PJ, Grunstein MM, Leff AR, Woolcock AJ, editors. Asthma. Philadelphia: Lippincott-Raven; 1997. p. 35-47.
3. Strachan DP. Lifestyle and atopy. Lancet 1999; 353: 1457-1458 [Medline].
4. Hopkin JM. Mechanisms of enhanced prevalence of asthma and atopy in developed countries. Curr Opin Immunol 1997; 9: 788-792 [Medline].
5. Martinez FD, Holt PG. Role of microbial burden in aetiology of allergy and asthma. Lancet 1999;354(Suppl II):12-15.
6. Holt PG, Sly PD, Bjorksten B. Atopic versus infectious diseases in childhood: a question of balance? Pediatr Allergy Immunol 1997; 8: 53-58 [Medline].
7. Wright SD. Innate recognition of microbial lipids. In: Gallin JI, Snyderman R, editors. Inflammation: basic principles and clinical correlates, 3rd ed. Philadelphia: Lippincott Williams & Wilkins; 1999. p. 525-535.
8.
Goyert SM,
Ferrero E,
Rettig WJ,
Yenamandra AK,
Obata F,
Le Beau MM.
The CD14 monocyte differentiation antigen maps to a region
encoding growth factors and receptors.
Science
1988;
239:
497-500
9. Xu J, Levitt RC, Panhuysen CI, Postma DS, Taylor EW, Amelung PJ, Holroyd KJ, Bleecker ER, Meyers DA. Evidence for two unlinked loci regulating total serum IgE levels. Am J Hum Genet 1995; 57: 425-430 [Medline].
10.
Marsh DG,
Neely JD,
Breazeale DR,
Ghosh B,
Freidhoff LR,
Ehrlich-Kautzky E,
Schou C,
Krishnaswamy G,
Beaty TH.
Linkage analysis of
IL4 and other chromosome 5q31.1 markers and total serum immunoglobulin E concentrations.
Science
1994;
264:
1152-1156
11. Hizawa N, Freidhoff LR, Ehrlich E, Chiu YF, Duffy DL, Schou C, Dunston G, Beaty TH, Marsh DG, Barnes KC, Huang SK. Genetic influences of chromosome 5q31-33 and 11q13 on specific IgE responsiveness to common inhaled allergens among African American families. Collaborative Study on the Genetics of Asthma (CSGA). J Allergy Clin Immunol 1998; 102: 449-453 [Medline].
12.
Postma DS,
Bleecker ER,
Amelung PJ,
Holroyd KJ,
Xu J,
Panhuysen CI,
Meyers DA,
Levitt RC.
Genetic susceptibility to asthma-bronchial
hyperresponsiveness coinherited with a major gene for atopy.
N Engl
J Med
1995;
333:
894-900
13.
Noguchi E,
Shibasaki M,
Arinami T,
Takeda K,
Maki T,
Miyamoto T,
Kawashima K,
Hamaguchi H.
Evidence for linkage between asthma/
atopy in childhood and chromosome 5q31-q33 in a Japanese population.
Am J Respir Crit Care Med
1997;
156:
1390-1393
14.
Martinez FD,
Solomon S,
Holberg CJ,
Graves PE,
Baldini M,
Erickson RP.
Linkage of cirulating eosinophils to markers on chromosome 5q.
Am J Respir Crit Care Med
1998;
158:
1739-1744
15.
Baldini M,
Lohman IC,
Halonen M,
Erickson RP,
Holt PG,
Martinez FD.
A polymorphism in the 5' flanking region of the CD14 gene is associated with circulating soluble CD14 levels and with total serum immunoglobulin E.
Am J Respir Cell Mol Biol
1999;
20:
976-983
16. Panhuysen CI, Bleecker ER, Koeter GH, Meyers DA, Postma DS. Dutch approach to the study of the genetics of asthma. Clin Exp Allergy 1995;25(Suppl 2):35-38.
17. de Vries K, Goei JT, Booy-Noord H, Orie NGM. Changes during 24 hours in the lung function and histamine hyperreactivity of the bronchial tree in asthmatic and bronchitic patients. Int Arch Allergy 1962; 20: 93-101 .
18. Sears MR, Herbison GP, Holdaway MD, Hewitt CJ, Flannery EM, Silva PA. The relative risk of sensitivity to grass pollen, house dust mite and cat dander in the development of childhood asthma. Clin Exp Allergy 1989; 19: 419-424 [Medline].
19. Burrows B, Martinez FD, Halonen M, Barbee R, Cline MG. Association of asthma with serum IgE levels and skin-test reactivity to allergens. N Engl J Med 1989; 320: 271-277 [Abstract].
20. Khoury MJ, Beaty TH, Cohen BH. Study of genetic factors in disease. In: Khoury MJ, Beaty TH, Cohen BH, editors. Fundamentals of genetic epidemiology, 1st ed. New York: Oxford University Press; 1993. p. 124-163.
21.
Unkelbach K,
Gardemann A,
Kostrzewa M,
Philipp M,
Tillmanns H,
Haberbosch W.
A new promoter polymorphism in the gene of lipopolysaccharide receptor CD14 is associated with expired myocardial infarction in patients with low atherosclerotic risk profile.
Arterioscler Thromb Vasc Biol
1992;
19:
932-938
22. Hubacek JA, Pit'ha J, Skodova Z, Stanek V, Poledne R. C(-260)-T polymorphism in the promoter of the CD14 monocyte receptor gene as a risk factor for myocardial infarction. Circulation 1999; 99: 3218-3220 [Medline].
23.
Hall IP.
Genetics and pulmonary medicine: asthma.
Thorax
1999;
54:
65-69
24. Gao PS, Mao XQ, Baldini M, Roberts MH, Adra CN, Shirakawa T, Holt PG, Martinez FD, Hopkin JM. Serum total IgE levels and CD14 on chromosome 5q31. Clin Gen 1999; 56: 164-165 .
25.
Zhang DE,
Hetherington CJ,
Tan S,
Dziennis SE,
Gonzales DA,
Chen HM,
Tenen DG.
Sp1 is a critical factor for the monocytic specific expresion of human CD14.
J Biol Chem
1994;
269:
11425-11434
26.
Pan Z,
Hetherington CJ,
Zhang DE.
CCAAT/enhancer-binding protein
activates the CD14 promoter and mediates transforming growth factor signaling in monocyte development.
J Biol Chem
1999;
274:
23242-23248
27. Kane JP, Havel RJ. Polymorphism of the lipopolysaccharide receptor (CD14) and myocardial infarction: new evidence for a role of Gram-negative bacterial infection? Circulation 1999; 99: 3210-3212 [Medline].
28. Schlegel RA, Krahling S, Callahan MK, Williamson P. CD14 is a component of multiple recognition systems used by macrophages to phagocytose apoptotic lymphocytes. Cell Death Differ 1999; 6: 583-592 . [Medline]
29. Jabara HH, Vercelli D. Engagement of CD14 on monocytes inhibits the synthesis of human Igs, including IgE. J Immunol 1994; 153: 972-978 [Abstract].
30. Verhasselt V, Buelens C, Willems F, De Groote D, Haeffner-Cavaillon N, Goldman M. Bacterial lipopolysaccharide stimulates the production of cytokines and the expression of costimulatory molecules by human peripheral blood dendritic cells: evidence for a soluble CD14- dependent pathway. J Immunol 1997; 158: 2919-2925 [Abstract].
31. Michel O, Kips J, Duchateau J, Vertongen F, Robert L, Collet H, Pauwels R, Sergysels R. Severity of asthma is related to endotoxin in house dust. Am J Respir Crit Care Med 1996; 154: 1641-1646 [Abstract].
32.
Michel O,
Duchateau J,
Sergysels R.
Effect of inhaled endotoxin on
bronchial reactivity in asthmatic and normal subjects.
J Appl Physiol
1989;
66:
1059-1064
33. Michel O, Ginanni R, Duchateau J, Vertongen F, Le Bon B, Sergysels R. Domestic endotoxin exposure and clinical severity of asthma. Clin Exp Allergy 1991; 21: 441-448 [Medline].
34. Virchow JC Jr,, Julius P, Matthys H, Kroegel C, Luttmann W. CD14 expression and soluble CD14 after segmental allergen provocation in atopic asthma. Eur Respir J 1998; 11: 317-323 [Abstract].
35.
Dubin W,
Martin TR,
Swoveland P,
Leturcq DJ,
Moriarty AM,
Tobias PS,
Bleecker ER,
Goldblum SE,
Hasday JD.
Asthma and endotoxin:
lipopolysaccharide-binding protein and soluble CD14 in bronchoalveolar compartment.
Am J Physiol
1996;
270:
L736-L744
This article has been cited by other articles:
 |
|
 |
|
  G. M. Hunninghake, J. Lasky-Su, M. E. Soto-Quiros, L. Avila, C. Liang, S. L. Lake, T. J. Hudson, M. Spesny, E. Fournier, J. S. Sylvia, et al. Sex-stratified Linkage Analysis Identifies a Female-specific Locus for IgE to Cockroach in Costa Ricans Am. J. Respir. Crit. Care Med., April 15, 2008; 177(8): 830 - 836. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 F. D. Martinez CD14, Endotoxin, and Asthma Risk: Actions and Interactions Proceedings of the ATS, July 1, 2007; 4(3): 221 - 225. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
W. C. Moore and S. P. Peters Update in Asthma 2006 Am. J. Respir. Crit. Care Med., April 1, 2007; 175(7): 649 - 654. [Full Text] [PDF]
|
|
|
|
|
|
F. D. Martinez Gene-Environment Interactions in Asthma: With Apologies to William of Ockham Proceedings of the ATS, January 1, 2007; 4(1): 26 - 31. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. C. Barnes, A. V. Grant, N. N. Hansel, P. Gao, and G. M. Dunston African Americans with Asthma: Genetic Insights Proceedings of the ATS, January 1, 2007; 4(1): 58 - 68. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Kabesch A Glitch in the Switch?: Of Endotoxin, CD14, and Allergy. Am. J. Respir. Crit. Care Med., August 15, 2006; 174(4): 365 - 366. [Full Text] [PDF]
|
|
|
|
|
|
A. Simpson, S. L. John, F. Jury, R. Niven, A. Woodcock, W. E. R. Ollier, and A. Custovic Endotoxin Exposure, CD14, and Allergic Disease: An Interaction between Genes and the Environment Am. J. Respir. Crit. Care Med., August 15, 2006; 174(4): 386 - 392. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. P. Wiertsema, S.-K. Khoo, G. Baynam, R. H. Veenhoven, I. A. Laing, G. A. Zielhuis, G. T. Rijkers, J. Goldblatt, P. N. LeSouef, and E. A. M. Sanders Association of CD14 Promoter Polymorphism with Otitis Media and Pneumococcal Vaccine Responses. Clin. Vaccine Immunol., August 1, 2006; 13(8): 892 - 897. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. C. Martin, I. A. Laing, S.-K. Khoo, G. Zhang, K. Rueter, L. Teoh, S. Taheri, C. M. Hayden, G. C. Geelhoed, J. Goldblatt, et al. Acute Asthma in Children: Relationships among CD14 and CC16 Genotypes, Plasma Levels, and Severity Am. J. Respir. Crit. Care Med., March 15, 2006; 173(6): 617 - 622. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. C. Barnes Genetic Determinants and Ethnic Disparities in Sepsis-associated Acute Lung Injury Proceedings of the ATS, October 1, 2005; 2(3): 195 - 201. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 H.-H. Shih, T.-M. Lin, J.-H. Chuang, H.-L. Eng, S.-H. H. Juo, F.-C. Huang, C.-L. Chen, and H.-L. Chen Promoter Polymorphism of the CD14 Endotoxin Receptor Gene Is Associated With Biliary Atresia and Idiopathic Neonatal Cholestasis Pediatrics, August 1, 2005; 116(2): 437 - 441. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Choudhry, P. C. Avila, S. Nazario, N. Ung, J. Kho, J. R. Rodriguez-Santana, J. Casal, H.-J. Tsai, A. Torres, E. Ziv, et al. CD14 Tobacco Gene-Environment Interaction Modifies Asthma Severity and Immunoglobulin E Levels in Latinos with Asthma Am. J. Respir. Crit. Care Med., July 15, 2005; 172(2): 173 - 182. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M-A Kedda, F Lose, D Duffy, E Bell, P J Thompson, and J Upham The CD14 C-159T polymorphism is not associated with asthma or asthma severity in an Australian adult population Thorax, March 1, 2005; 60(3): 211 - 214. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. E. H. Bashir, S. Louie, H. N. Shi, and C. Nagler-Anderson Toll-Like Receptor 4 Signaling by Intestinal Microbes Influences Susceptibility to Food Allergy J. Immunol., June 1, 2004; 172(11): 6978 - 6987. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. Bozinovski, J. Jones, S.-J. Beavitt, A. D. Cook, J. A. Hamilton, and G. P. Anderson Innate immune responses to LPS in mouse lung are suppressed and reversed by neutralization of GM-CSF via repression of TLR-4 Am J Physiol Lung Cell Mol Physiol, April 1, 2004; 286(4): L877 - L885. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. N. Blumenthal New Thoughts Regarding the Genetics of Atopy Am. J. Respir. Crit. Care Med., March 1, 2004; 169(5): 555 - 556. [Full Text] [PDF]
|
|
|
|
 |
|
 M. Kabesch and R. P. Lauener Why Old McDonald had a farm but no allergies: genes, environments, and the hygiene hypothesis J. Leukoc. Biol., March 1, 2004; 75(3): 383 - 387. [Full Text] [PDF]
|
|
|
|
|
|
A. R. O'Donnell, B. G. Toelle, G. B. Marks, C. M. Hayden, I. A. Laing, J. K. Peat, J. Goldblatt, and P. N. Le Souef Age-specific Relationship between CD14 and Atopy in a Cohort Assessed from Age 8 to 25 Years Am. J. Respir. Crit. Care Med., March 1, 2004; 169(5): 615 - 622. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 O. Michel Role of lipopolysaccharide (LPS) in asthma and other pulmonary conditions Innate Immunity, October 1, 2003; 9(5): 293 - 300. [Abstract] [PDF]
|
|
|
|
|
|
K. A. Pacheco, C. McCammon, A. H. Liu, P. S. Thorne, M. E. O'Neill, J. Martyny, L. S. Newman, R. F. Hamman, and C. S. Rose Airborne Endotoxin Predicts Symptoms in Non-Mouse-sensitized Technicians and Research Scientists Exposed to Laboratory Mice Am. J. Respir. Crit. Care Med., April 1, 2003; 167(7): 983 - 990. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 H-J Yoon, J H Shin, S H Yang, D-W Chae, H Kim, D-S Lee, H L Kim, S Kim, J S Lee, and Y S Kim Association of the CD14 gene -159C polymorphism with progression of IgA nephropathy J. Med. Genet., February 1, 2003; 40(2): 104 - 108. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
B. A. Raby, W. T. Klimecki, C. Laprise, Y. Renaud, J. Faith, M. Lemire, C. Greenwood, K. M. Weiland, C. Lange, L. J. Palmer, et al. Polymorphisms in Toll-Like Receptor 4 Are Not Associated with Asthma or Atopy-related Phenotypes Am. J. Respir. Crit. Care Med., December 1, 2002; 166(11): 1449 - 1456. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. N. Hylkema, W. Timens, M. Luinge, N. van der Werf, and M. O. Hoekstra The Effect of Bacillus Calmette-Guerin Immunization Depends on the Genetic Predisposition to Th2-Type Responsiveness Am. J. Respir. Cell Mol. Biol., August 1, 2002; 27(2): 244 - 249. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. Dabbagh, M. E. Dahl, P. Stepick-Biek, and D. B. Lewis Toll-Like Receptor 4 Is Required for Optimal Development of Th2 Immune Responses: Role of Dendritic Cells J. Immunol., May 1, 2002; 168(9): 4524 - 4530. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. J. TOBIN Asthma, Airway Biology, and Nasal Disorders in AJRCCM 2001 Am. J. Respir. Crit. Care Med., March 1, 2002; 165(5): 598 - 618. [Full Text] [PDF]
|
|
|
|
|
|
T. Kusunoki, T. Nakahata, T. Miyanomae, and Y. Inoue POSSIBLE DUAL EFFECT OF CD14 MOLECULE ON ATOPY Am. J. Respir. Crit. Care Med., February 15, 2002; 165(4): 551a - 552. [Full Text]
|
|
|
|
 |
|
 B. Granum and M. Lovik The Effect of Particles on Allergic Immune Responses Toxicol. Sci., January 1, 2002; 65(1): 7 - 17. [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||