help button home button
AJRCCM
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by KOPPELMAN, G. H.
Right arrow Articles by BLEECKER, E. R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by KOPPELMAN, G. H.
Right arrow Articles by BLEECKER, E. R.
Am. J. Respir. Crit. Care Med., Volume 163, Number 4, March 2001, 965-969

Association of a Promoter Polymorphism of the CD14 Gene and Atopy

GERARD H. KOPPELMAN, NAOMI E. REIJMERINK, O. COLIN STINE, TIMOTHY D. HOWARD, PAUL A. WHITTAKER, DEBORAH A. MEYERS, DIRKJE S. POSTMA, and EUGENE R. BLEECKER

Department of Pulmonary Rehabilitation, Beatrixoord, Haren, The Netherlands; Department of Pulmonology, University Hospital Groningen, Groningen, The Netherlands; Center for Human Genomics, Wake Forest University School of Medicine, Winston-Salem, North Carolina; Department of Epidemiology and Preventative Medicine, University of Maryland School of Medicine, Baltimore, Maryland; and Novartis Horsham Research Centre, Horsham, West Sussex, United Kingdom




    ABSTRACT
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES

Atopy is generally considered to be caused by interaction of genetic and environmental factors. Recently, an association of a C-to-T transition in the promoter region of the CD14 gene on chromosome 5q31.1 and atopic phenotypes was reported in a population study of school children in the United States. The aim of the present study was to investigate the association of the C allele of the CD14/-159 with phenotypes of atopy and asthma in an adult Dutch population in which linkage of total serum IgE and bronchial hyperresponsiveness to chromosome 5q31-33 is present. We studied 159 probands with asthma and 158 spouses as controls. Phenotypes for asthma (e.g., bronchial hyperresponsiveness, physician's diagnosis) and for atopy (e.g., total serum IgE level, intracutaneous skin test, allergic rhinitis) were studied. In this population, homozygotes for the C allele had a higher number of positive skin tests and higher total serum IgE levels (in skin test-positive individuals) and subsequently, more self-reported allergic symptoms including rhinitis and hay fever, compared with subjects with CT and TT alleles. We conclude that the -159 C-to-T promoter polymorphism in the CD14 gene may result in expression of a more severe allergic phenotype.



    INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES

Atopic diseases, such as asthma, allergic rhinitis, and eczema, are characterized by an elevated and prolonged immunoglobulin E (IgE) antibody response after exposure to ubiquitous, nonpathogenic allergens. Atopy is generally considered to be caused by the interaction of genetic and environmental factors (1). There is concern about the worldwide rise of atopic diseases over the past decades and different hypotheses have been proposed to explain this increased prevalence (2). Changes in environmental factors most likely play an important role, such as life style, diet, air pollution, allergen exposure, and microbial environment (3, 4). Recent studies have suggested that bacterial infections in infancy may protect against the development of allergy (5). In 1997, Holt and coworkers hypothesized that bacterial signals play a functional role in the maturation of the Th1-type immune response, thereby suppressing the Th2-type response, which may produce an atopic phenotype. Microbial products, such as lipopolysaccharides (LPS), can provide activation signals for Th1-maturation (6).

The pathway through which LPS may exert its function includes high- and low-affinity LPS receptors. An important high-affinity receptor for LPS and other bacterial wall components is CD14, a 55-kD glycosylphosphatidylinositol-anchored protein localized on monocytes, macrophages, and polymorphonuclear cells. Binding of LPS to CD14 is facilitated by lipopolysaccharide-binding protein. CD14 is also present as soluble CD14 (sCD14) in serum, where it acts like membrane-bound CD14 in cells that do not express CD14 (7).

The gene encoding CD14 is a positional candidate gene for atopy, as it is localized on chromosome 5q31.1 (8), a region that has been linked to asthma and atopic responses (9). In 1999, Baldini and coworkers (15) reported the association of a polymorphism in the CD14 gene and atopy. In the promoter region of the CD14 gene, a C-to-T transition was identified at position -159 upstream from the major transcription site (CD14/-159). In a Caucasian subset (n = 314) of a general population sample of 11-yr-old children from the United States, homozygotes with TT had higher serum levels of sCD14 than homozygotes with CC. In addition, among skin test-positive children, homozygotes with the TT genotype had lower levels of serum total IgE and a lower number of positive skin prick tests, when compared with the pooled group of subjects carrying CC and CT (15). This study did not assess the effect of CD14 on asthma and allergic rhinitis.

The purpose of the present study was to investigate whether the C allele of the CD14/-159 was associated with elevated total serum IgE levels and number of positive skin tests in an adult Dutch population, in which linkage of total IgE levels and bronchial hyperresponsiveness to chromosome 5q has been previously reported (9, 12). In addition, we investigated whether this polymorphism was associated with allergic rhinitis and asthma phenotypes.


    METHODS
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES

Study Population

Subjects were selected from a family study on the genetics of asthma in the Netherlands, which has been described in detail by Panhuysen and coworkers (16). Between 1962 and 1975, patients with asthma were evaluated for diagnosis of asthma and optimization of their treatment in Beatrixoord, Haren, The Netherlands. For inclusion in this study, from this first evaluation patients had to meet three criteria: (1) symptoms consistent with asthma; (2) age =< 45 yr, and (3) bronchial hyperresponsiveness to histamine (PC20 =< 32 mg/ml using the de Vries 30-s inhalation method) (17).

From 1990 onward, these probands were restudied together with their spouses, a minimum of two children, and, if possible, grandchildren. In total, 200 two- and three-generation families have been studied. Using a case-control approach, probands and their spouses were selected from these families. Data are presented from 159 probands and 158 spouses, from whom DNA was available at the time of this study.

Clinical Assessment

The first evaluation (1962-1975) included the performance of intracutaneous skin tests with common aeroallergens, pulmonary function testing with a water-seal spirometer (Lode Spirograph, Groningen, The Netherlands), and testing for bronchial hyperresponsiveness with histamine, using the 30-s inhalation protocol as described by de Vries and coworkers (17). At the second evaluation (1990-1998), these measurements were repeated in the probands, and also performed in the relatives. Reversibility was tested by repeating spirometry 20 min after administration of 800 µg of salbutamol (albuterol). All participants were asked to stop pulmonary medication before the clinical testing if possible: inhaled corticosteroids were stopped for 14 d, inhaled long-acting beta -mimetics and oral antihistamines 48 h, and inhaled short-acting beta -mimetics and anticholinergics 8 h. The asthma patients did not have an asthma exacerbation or require a course of oral prednisone in the 6 wk prior to the study.

This evaluation further included a modified version of the British Medical Council questionnaire with additional questions on symptoms and therapy of asthma and allergy (16). By definition, a physician's diagnosis of asthma was present in the probands. In the spouses, it was present if the subject reported (1) being under current regular treatment for asthma, (2) having ever visited a general practitioner or specialist for asthma, or (3) having ever used asthma medication. Allergic rhinitis was defined as a positive answer to the following question: Do you have a runny or stuffed nose when you are near animals (e.g., dogs, cats, horses), feathers (e.g., in pillows), a dusty part of the house, or trees, grasses, or flowers? Hay fever was defined as a positive answer to the following question: Did you ever have hay fever?

Serum total IgE was measured in the first 92 families by solid-phase immunoassay (16). In the second set of 108 families, serum IgE levels were measured by an enzyme-linked fluorescent assay (Mini Vidas; Biomerieux Vitek Inc., Marcy, France). Skin testing was performed by an intracutaneous skin test with 16 common aeroallergens, a positive control, and a negative control. The following allergens were tested: mixed grass pollens, two mixed tree pollens, mixed weeds, house dust mite, storage mite, cat-, dog-, horse-, and rabbit/guinea pig dander, feather mix, and five molds (Aspergillus fumigatus, Alternaria alternata, Cladosporium herbarum, Penicillum notatum, and Botrytis cineria) (ALK-Abelló, Nieuwegein, The Netherlands). A positive skin test was considered to be present if the largest wheal diameter was >=  5 mm.

The Medical Ethics Committee of the University Hospital of Groningen and the University of Maryland approved this study. Written informed consents were obtained from all participants.

Molecular Methods

DNA was extracted using standard protocols (Puregene kit; Gentra Systems Inc., Minneapolis, MN). Genotyping of the CD14/-159 polymorphism was performed according to the protocol described by Baldini and coworkers (15). Briefly, polymerase chain reaction (PCR) was performed in 10 µl volumes consisting of 60 ng of DNA, 250 µM dNTP, 1.5 mM MgCl, 10 × buffer (Life Technologies, Rockville, MD), 0.5 U Taq polymerase, and 0.1 µM primer 5'GCCTCTGACAGTTTATGTAATC3' and primer 5'GTGCCAACAGATGAGGTTCAC3'. Cycling conditions were 94° C for 3 min, 28 cycles of 94° C for 30 s, 57° C for 30 s, 72° C for 30 s, and a final extension of 72° C for 6 min. PCR-amplified DNA was digested with 5 U AvaII and 1 µl of the manufacturer's buffer (New England Biolabs Inc., Beverly, MA) at 37° C for 2 h. Products were fractioned on 2.0% agarose gel. AvaII digests the PCR product only when the T allele is present. The uncut product is 497 bp whereas the digested products are 144 and 353 bp (Figure 1). The results of this restriction fragment length polymorphism assay were confirmed by direct sequencing of the -159 promoter region of the CD14 gene in 32 patients and controls.



View larger version (57K):
[in this window]
[in a new window]
 
Figure 1.   CD14/-159 restriction fragment assay. Electrophoresis gel showing size markers on lane 1. On lane 2, one band is visible for homozygotes carrying two C alleles. On lanes 3 and 4 two bands for homozygotes carrying two T alleles, and on lane 5 a CT heterozygote is shown.

Statistical Methods

Three different genetic models were tested. To study a recessive model for the C allele, CC homozygotes were compared with CT heterozygotes and TT homozygotes. To study a recessive model for the T allele, TT homozygotes were compared with individuals with CT and CC. To study a codominant model, the three genotype groups were analyzed separately.

Both parametric (t test, ANOVA) and nonparametric analyses (Mann-Whitney, Kruskal-Wallis test) were used to study phenotypic differences in each genotype group, depending on the normality of the distribution of the variables. The number of skin tests was not normally distributed, whereas serum IgE levels were log transformed to obtain a normal distribution. Linear and logistic regression analyses were used to test and correct for known confounding variables, such as age, sex, and smoking. Results were considered significant if p < 0.05 (two sided). All calculations were performed with the SPSS 8.0 statistical package.


    RESULTS
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES

Study Population

Baseline characteristics of the study population at the second evaluation (1990-1998) are shown in Table 1. Probands were predominantly male and their mean age was 52 yr. All probands were hyperresponsive at initial testing. Although probands were not selected for atopy, 79.9% had atopy as measured by a positive skin test, compared with 29.1% of the spouses.


                              
View this table:
[in this window]
[in a new window]
 

TABLE 1

 BASELINE CHARACTERISTICS OF THE STUDY POPULATION AT THE SECOND EVALUATION*

Genotype Frequency of the CD14/-159 Polymorphism

The genotype frequencies in probands were 32.1% for CC homozygotes, 47.8% for CT heterozygotes, and 20.1% for TT homozygotes. In the spouses, these frequencies were 19.6%, 53.8%, and 26.6%, respectively.

Association of the C Allele with Total IgE Levels, Skin Tests, Hay Fever, and Allergic Rhinitis

Based on the report of Baldini and coworkers (15), the primary analysis was the association of CD14/-159 and skin tests and serum total IgE levels. In the skin test-positive population, CC homozygotes had significantly higher serum IgE levels compared with CT heterozygotes and TT homozygotes (p = 0.036) The difference between the latter was not significant in skin test-negative individuals (Table 2).


                              
View this table:
[in this window]
[in a new window]
 

TABLE 2

 ASSOCIATION OF THE CD14/-159 PROMOTER POLYMORPHISM AND TOTAL SERUM IgE LEVELS*

In the skin test-positive population as well as in the total population, CC homozygotes had a higher number of positive skin tests compared with CT heterozygotes and TT homozygotes. In skin test-positive individuals, the median (mean) number of positive skin tests in individuals with CC was 5 (5.61), for CT 4 (4.19), and for TT 3 (3.76) (Figure 2). The difference was significant in a codominant model (p = 0.01). This difference was also significant in a recessive model for the C allele (p = 0.008) (Figure 2).



View larger version (30K):
[in this window]
[in a new window]
 
Figure 2.   Boxplot of number of positive skin tests within skin test positive individuals. This boxplot shows medians and interquartile ranges. p < 0.01 for CC versus CT and TT (recessive model); p < 0.05 for CC versus CT versus TT (codominant model).

In a logistic regression analysis, CC homozygotes had a higher frequency of reporting hay fever (odds ratio [OR] 2.15, 95% confidence interval (CI) 1.18-3.92) and allergic rhinitis (OR 1.80, 95% CI 1.08-2.99), compared with individuals carrying CT and TT. After introduction of skin test positivity in three classes (0, 1-4, >=  5 positive skin tests) into this regression analysis, this association was no longer significant (allergic rhinitis: CD14 CC homozygotes: OR 1.54, 95% CI 0.89- 2.67; skin test positivity: OR 2.53, 95% CI 1.88-3.43; hay fever: CD14 CC homozygotes: OR 1.78, 95% CI 0.92-3.45; skin test positivity: OR 3.61, 95% CI 2.39-5.44).

Association of the C Allele with Asthma

The CD14/-159 genotype was not associated with doctor's diagnosed asthma and bronchial hyperresponsiveness to histamine, and peripheral blood eosinophilia (p > 0.05). In the total population of subjects with asthma and their spouses, the CD14 genotype showed borderline significance with prebronchodilator FEV1 expressed as percentage of predicted in a codominant model (p = 0.05) and in a recessive model for the C allele (p = 0.015). The CD14/-159 was not associated with FEV1 level when analyzed within the group of patients with asthma. Reversibility to a bronchodilator expressed as the change in FEV1 was not related to the CD14 genotype either in the total or in the asthmatic population.


    DISCUSSION
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES

This study confirms an association of the CD14/-159 promoter polymorphism with the number of positive skin tests and total serum IgE levels in skin test-positive individuals. In this population selected for probands with asthma, as well as in the population studied by Baldini and coworkers, the CD14/-159 genotype was not associated with atopy defined by at least one positive skin test (15). Therefore, the CD14/ -159 genotype does not appear to represent a susceptibility gene for the development of atopy, yet it appears to produce a more severe atopic phenotype, that is, a higher total number of positive skin tests and a higher total IgE level in skin test-positive individuals.

In the population of children as described by Baldini and coworkers, the C allele of the CD14/-159 polymorphism had a dominant effect on total IgE levels and the number of positive skin tests (15). In our data, the C allele is associated with a higher number of positive skin tests in a codominant model, and with higher total IgE levels and higher number of positive skin tests in a recessive model. The results confirm the importance of the C allele influencing the expression and severity of the atopic phenotype. One might argue that this difference in the genetic model suggests that these data do not confirm the previous association study completely. However, we regard this finding as a confirmation, given the same direction of the phenotypical effects of the C allele (higher number of skin tests, higher serum IgE levels). The unresolved difference between these studies is the influence of having one C allele, as the difference between the genetic models is the grouping of the heterozygotes. Possible explanations include differences in recruitment strategies of these populations, an age effect (mean age of our population is 52 yr versus 14 yr in the study of Baldini and coworkers), or different gene-gene and gene- environmental interactions in these different populations.

We could not find a significant association of CD14/-159 with phenotypes of asthma, such as bronchial hyperresponsiveness and physician's diagnosis of asthma. These data fit our hypothesis that separate genes appear to regulate susceptibility to high total serum IgE levels and bronchial hyperresponsiveness on chromosome 5q (12). Atopy and asthma, although separate disease entities, are closely related and it is difficult to distinguish their specific expression on the clinical phenotype. Several studies have shown that total serum IgE levels as well as the number of positive skin prick tests are associated with the presence of bronchial hyperresponsiveness, the development of asthma symptoms, and a physician's diagnosis of asthma (18, 19). Due to this close interrelation of asthma and atopy, alleles that are associated with atopy will be overrepresented in individuals with asthma when compared with the general population. It is possible that genetic studies that separate the effects of atopic and asthmatic genotypes may increase our basic understanding of how allergic factors affect the development and progression of asthma.

A genetic association may be confounded by population admixture or can be observed as the result of linkage disequilibrium with another allele (20). Because all individuals in our study are white and are from a relatively homogeneous population in the northern part of the Netherlands, association due to population admixture seems very unlikely. Linkage disequilibrium as a possible confounder cannot be excluded. However, other polymorphisms in the promoter region of the CD14 gene have not been identified to date (15, 21). The same promoter polymorphism was reported by Hubacek and coworkers (22) in a study on myocardial infarction (-260 C-to-T transition). CD14/-159 is 260 base pairs upstream from the major translation region of CD14 (J. A. Hubacek, personal communication). Interestingly, in this study the T allele had a higher frequency in survivors of myocardial infarction compared with a control group indicating a possible role of CD14 in atherosclerosis (22).

Hall (23) suggested four criteria for a specific gene to become an established biological candidate gene in a complex disease: (1) consistent association, (2) location of the gene in a chromosomal area of linkage, (3) change in protein level or function by the mutation, and, finally, (4) biological plausibility of the gene for the disease.

Two previous studies have reported an association of CD14/-159 with serum total IgE levels (15, 24). Apart from the study by Baldini and coworkers, Gao and coworkers (24) studied the association of this polymorphism in a British (n = 300) and Japanese population (n = 200). The CD14 genotype appeared to be associated with total IgE levels in RAST-negative individuals in a recessive model for the C allele in the British sample. This finding differed from the results in skin test- positive individuals in the United States and The Netherlands. These authors concluded that CD14 might not be an atopy locus, but may act as a basic modifier of serum total IgE levels.

The CD14 gene is localized on chromosome 5q31.1, an area consistently reported to be linked to phenotypes of asthma and atopy. However, linkage analysis for a modifier effect within skin test-positive family members has not been performed (9, 12).

The functional role of CD14/-159 was indicated by the finding that CC homozygotes have lower levels of sCD14 and a lower density of CD14 on monocytes than TT homozygotes (15, 22). This suggests that CD14/-159 could influence the transcription rate of the CD14 gene. CD14/-159 is near an SP1 binding site that has a major influence on monocyte specific expression of CD14, and near a CCAAT/enhancer-binding protein site that may play an important role in promoter activation of the CD14 gene during monocyte development (25, 26). In addition, CD14/-159 is 1 base pair upstream from a putative AP-2-binding site (25). More functional studies are needed to study the effect of CD14/-159 on promoter activity.

Finally, is CD14 a plausible biologic gene for atopy? CD14 is a multifunctional receptor and may play a role in different biological and pathophysiological processes: apoptosis, sepsis, and inflammatory diseases, such as atherosclerosis and atopy (5, 27, 28). There are several plausible explanations for a possible role of CD14 in atopy. CD14 on monocytes and polymorphonuclear cells functions as a receptor for LPS, thereby inducing mediator and cytokine release, including interleukin (IL)-6 and IL-8. Blockade of CD14 prevents release of LPS-induced cytokines. Thus, CD14 may be involved in a proinflammatory pathway through the release of cytokines (7). In addition, Jabara and Vercelli (29) suggested a direct action of CD14 on monocytes, thereby inhibiting IgE production by B-lymphocytes. Finally, Holt and coworkers (6) suggested that LPS or other bacterial wall products could stimulate antigen-presenting cells (APCs) (e.g., dendritic cells) to produce IL-12 through the action of sCD14 (30). The source of LPS could be either the microbial flora from the gastrointestinal tract, inhaled LPS from house dust, or bacterial infection (6). Subsequently, genetically determined higher levels of sCD14 in serum (15), or a higher density of membrane-bound CD14 could result in a stronger IL-12 signal of these APCs, which in turn may be a potent signal for Th1 maturation in early life. The interesting question is whether CD14-LPS interactions have a relevant role in the development of atopy. If this is true, the interaction of age, infectious exposure, as well as environmental factors such as allergens needs to be investigated.

Besides the possible role of CD14 in the development of atopy, we studied the CD14 genotype in relationship to asthma severity. Several studies have indicated that LPS inhalation in patients with asthma is associated with the severity of asthma, as assessed by medication use, clinical scores, and an increased bronchial responsiveness to histamine (31). From studies of bronchoalveolar lavage, it has been suggested that CD14-mediated cell activation could play a role in the inflammatory response after allergen challenge (34, 35). We asked if genetic variation in the CD14 gene could therefore play a modifying role in asthma severity. In the combined sample of cases and controls, evidence for an association of CD14/-159 with prebronchodilator FEV1 levels was identified. This association was not significant in the group of patients with asthma only. One reason for this may be lack of power. We conclude that these analyses need to be repeated in a larger sample size before definitive conclusions can be drawn.

In summary, in this study the association of a -159 C-to-T promoter polymorphism and atopy is confirmed. Homozygotes for the C allele had a higher number of positive skin tests and higher total serum IgE levels (in skin test-positive individuals) and, subsequently, more self-reported allergic rhinitis and hay fever.


    Footnotes

Correspondence and requests for reprints should be addressed to Professor D.S. Postma, Department of Pulmonology, P.O. Box 30.001, 9700 RB Groningen, The Netherlands. E-mail: d.s.postma{at}int.azg.nl

(Received in original form April 14, 2000 and in revised form July 24, 2000).

Acknowledgments: The authors would like to thank all participants of the study, and E. Gankema, H. Koops, M. Leever, and D. Faber who assisted in the clinical testing. In addition, we are thankful to C. I. M. Panhuysen, B. Meijer, and G. G. Meijer for their work in patient recruitment.

This study was supported by the Netherlands Asthma Foundation (Grant AF 95.09), the "Jan Kornelis de Cock Stichting," and the National Institute of Health (Grant R01 HL48341).


    References
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES

1. Postma DS, Bleecker ER. Genetics of asthma. In: Barnes PJ, Grunstein MM, Leff AR, Woolcock AJ, editors. Asthma. Philadelphia: Lippincott-Raven; 1997. p. 145-154.

2. Burney PGJ. Epidemiologic trends. In: Barnes PJ, Grunstein MM, Leff AR, Woolcock AJ, editors. Asthma. Philadelphia: Lippincott-Raven; 1997. p. 35-47.

3. Strachan DP. Lifestyle and atopy. Lancet 1999; 353: 1457-1458 [Medline].

4. Hopkin JM. Mechanisms of enhanced prevalence of asthma and atopy in developed countries. Curr Opin Immunol 1997; 9: 788-792 [Medline].

5. Martinez FD, Holt PG. Role of microbial burden in aetiology of allergy and asthma. Lancet 1999;354(Suppl II):12-15.

6. Holt PG, Sly PD, Bjorksten B. Atopic versus infectious diseases in childhood: a question of balance? Pediatr Allergy Immunol 1997; 8: 53-58 [Medline].

7. Wright SD. Innate recognition of microbial lipids. In: Gallin JI, Snyderman R, editors. Inflammation: basic principles and clinical correlates, 3rd ed. Philadelphia: Lippincott Williams & Wilkins; 1999. p. 525-535.

8. Goyert SM, Ferrero E, Rettig WJ, Yenamandra AK, Obata F, Le Beau MM. The CD14 monocyte differentiation antigen maps to a region encoding growth factors and receptors. Science 1988; 239: 497-500 [Abstract/Free Full Text].

9. Xu J, Levitt RC, Panhuysen CI, Postma DS, Taylor EW, Amelung PJ, Holroyd KJ, Bleecker ER, Meyers DA. Evidence for two unlinked loci regulating total serum IgE levels. Am J Hum Genet 1995; 57: 425-430 [Medline].

10. Marsh DG, Neely JD, Breazeale DR, Ghosh B, Freidhoff LR, Ehrlich-Kautzky E, Schou C, Krishnaswamy G, Beaty TH. Linkage analysis of IL4 and other chromosome 5q31.1 markers and total serum immunoglobulin E concentrations. Science 1994; 264: 1152-1156 [Abstract/Free Full Text].

11. Hizawa N, Freidhoff LR, Ehrlich E, Chiu YF, Duffy DL, Schou C, Dunston G, Beaty TH, Marsh DG, Barnes KC, Huang SK. Genetic influences of chromosome 5q31-33 and 11q13 on specific IgE responsiveness to common inhaled allergens among African American families. Collaborative Study on the Genetics of Asthma (CSGA). J Allergy Clin Immunol 1998; 102: 449-453 [Medline].

12. Postma DS, Bleecker ER, Amelung PJ, Holroyd KJ, Xu J, Panhuysen CI, Meyers DA, Levitt RC. Genetic susceptibility to asthma-bronchial hyperresponsiveness coinherited with a major gene for atopy. N Engl J Med 1995; 333: 894-900 [Abstract/Free Full Text].

13. Noguchi E, Shibasaki M, Arinami T, Takeda K, Maki T, Miyamoto T, Kawashima K, Hamaguchi H. Evidence for linkage between asthma/ atopy in childhood and chromosome 5q31-q33 in a Japanese population. Am J Respir Crit Care Med 1997; 156: 1390-1393 [Abstract/Free Full Text].

14. Martinez FD, Solomon S, Holberg CJ, Graves PE, Baldini M, Erickson RP. Linkage of cirulating eosinophils to markers on chromosome 5q. Am J Respir Crit Care Med 1998; 158: 1739-1744 [Abstract/Free Full Text].

15. Baldini M, Lohman IC, Halonen M, Erickson RP, Holt PG, Martinez FD. A polymorphism in the 5' flanking region of the CD14 gene is associated with circulating soluble CD14 levels and with total serum immunoglobulin E.  Am J Respir Cell Mol Biol 1999; 20: 976-983 [Abstract/Free Full Text].

16. Panhuysen CI, Bleecker ER, Koeter GH, Meyers DA, Postma DS. Dutch approach to the study of the genetics of asthma. Clin Exp Allergy 1995;25(Suppl 2):35-38.

17. de Vries K, Goei JT, Booy-Noord H, Orie NGM. Changes during 24 hours in the lung function and histamine hyperreactivity of the bronchial tree in asthmatic and bronchitic patients. Int Arch Allergy 1962; 20: 93-101 .

18. Sears MR, Herbison GP, Holdaway MD, Hewitt CJ, Flannery EM, Silva PA. The relative risk of sensitivity to grass pollen, house dust mite and cat dander in the development of childhood asthma. Clin Exp Allergy 1989; 19: 419-424 [Medline].

19. Burrows B, Martinez FD, Halonen M, Barbee R, Cline MG. Association of asthma with serum IgE levels and skin-test reactivity to allergens. N Engl J Med 1989; 320: 271-277 [Abstract].

20. Khoury MJ, Beaty TH, Cohen BH. Study of genetic factors in disease. In: Khoury MJ, Beaty TH, Cohen BH, editors. Fundamentals of genetic epidemiology, 1st ed. New York: Oxford University Press; 1993. p. 124-163.

21. Unkelbach K, Gardemann A, Kostrzewa M, Philipp M, Tillmanns H, Haberbosch W. A new promoter polymorphism in the gene of lipopolysaccharide receptor CD14 is associated with expired myocardial infarction in patients with low atherosclerotic risk profile. Arterioscler Thromb Vasc Biol 1992; 19: 932-938 [Abstract/Free Full Text].

22. Hubacek JA, Pit'ha J, Skodova Z, Stanek V, Poledne R. C(-260)-T polymorphism in the promoter of the CD14 monocyte receptor gene as a risk factor for myocardial infarction. Circulation 1999; 99: 3218-3220 [Abstract/Free Full Text].

23. Hall IP. Genetics and pulmonary medicine: asthma. Thorax 1999; 54: 65-69 [Free Full Text].

24. Gao PS, Mao XQ, Baldini M, Roberts MH, Adra CN, Shirakawa T, Holt PG, Martinez FD, Hopkin JM. Serum total IgE levels and CD14 on chromosome 5q31. Clin Gen 1999; 56: 164-165 .

25. Zhang DE, Hetherington CJ, Tan S, Dziennis SE, Gonzales DA, Chen HM, Tenen DG. Sp1 is a critical factor for the monocytic specific expresion of human CD14. J Biol Chem 1994; 269: 11425-11434 [Abstract/Free Full Text].

26. Pan Z, Hetherington CJ, Zhang DE. CCAAT/enhancer-binding protein activates the CD14 promoter and mediates transforming growth factor beta  signaling in monocyte development. J Biol Chem 1999; 274: 23242-23248 [Abstract/Free Full Text].

27. Kane JP, Havel RJ. Polymorphism of the lipopolysaccharide receptor (CD14) and myocardial infarction: new evidence for a role of Gram-negative bacterial infection? Circulation 1999; 99: 3210-3212 [Free Full Text].

28. Schlegel RA, Krahling S, Callahan MK, Williamson P. CD14 is a component of multiple recognition systems used by macrophages to phagocytose apoptotic lymphocytes. Cell Death Differ 1999; 6: 583-592 . [Medline]

29. Jabara HH, Vercelli D. Engagement of CD14 on monocytes inhibits the synthesis of human Igs, including IgE. J Immunol 1994; 153: 972-978 [Abstract].

30. Verhasselt V, Buelens C, Willems F, De Groote D, Haeffner-Cavaillon N, Goldman M. Bacterial lipopolysaccharide stimulates the production of cytokines and the expression of costimulatory molecules by human peripheral blood dendritic cells: evidence for a soluble CD14- dependent pathway. J Immunol 1997; 158: 2919-2925 [Abstract].

31. Michel O, Kips J, Duchateau J, Vertongen F, Robert L, Collet H, Pauwels R, Sergysels R. Severity of asthma is related to endotoxin in house dust. Am J Respir Crit Care Med 1996; 154: 1641-1646 [Abstract].

32. Michel O, Duchateau J, Sergysels R. Effect of inhaled endotoxin on bronchial reactivity in asthmatic and normal subjects. J Appl Physiol 1989; 66: 1059-1064 [Abstract/Free Full Text].

33. Michel O, Ginanni R, Duchateau J, Vertongen F, Le Bon B, Sergysels R. Domestic endotoxin exposure and clinical severity of asthma. Clin Exp Allergy 1991; 21: 441-448 [Medline].

34. Virchow JC Jr,, Julius P, Matthys H, Kroegel C, Luttmann W. CD14 expression and soluble CD14 after segmental allergen provocation in atopic asthma. Eur Respir J 1998; 11: 317-323 [Abstract].

35. Dubin W, Martin TR, Swoveland P, Leturcq DJ, Moriarty AM, Tobias PS, Bleecker ER, Goldblum SE, Hasday JD. Asthma and endotoxin: lipopolysaccharide-binding protein and soluble CD14 in bronchoalveolar compartment. Am J Physiol 1996; 270: L736-L744 [Abstract/Free Full Text].





This article has been cited by other articles:


Home page
Am. J. Respir. Crit. Care Med.Home page
L. A. M. Smit, V. Siroux, E. Bouzigon, M.-P. Oryszczyn, M. Lathrop, F. Demenais, F. Kauffmann, and on behalf of the Epidemiological Study on the Gene
CD14 and Toll-like Receptor Gene Polymorphisms, Country Living, and Asthma in Adults
Am. J. Respir. Crit. Care Med., March 1, 2009; 179(5): 363 - 368.
[Abstract] [Full Text] [PDF]


Home page
PediatricsHome page
D. A. Schwartz
Gene-Environment Interactions and Airway Disease in Children
Pediatrics, March 1, 2009; 123(Supplement_3): S151 - S159.
[Abstract] [Full Text] [PDF]


Home page
Eur Respir JHome page
R. W. B. Bottema, N. E. Reijmerink, M. Kerkhof, G. H. Koppelman, F. F. Stelma, J. Gerritsen, C. Thijs, B. Brunekreef, C. P. van Schayck, and D. S. Postma
Interleukin 13, CD14, pet and tobacco smoke influence atopy in three Dutch cohorts: the allergenic study
Eur. Respir. J., September 1, 2008; 32(3): 593 - 602.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Respir. Crit. Care Med.Home page
G. M. Hunninghake, J. Lasky-Su, M. E. Soto-Quiros, L. Avila, C. Liang, S. L. Lake, T. J. Hudson, M. Spesny, E. Fournier, J. S. Sylvia, et al.
Sex-stratified Linkage Analysis Identifies a Female-specific Locus for IgE to Cockroach in Costa Ricans
Am. J. Respir. Crit. Care Med., April 15, 2008; 177(8): 830 - 836.
[Abstract] [Full Text] [PDF]


Home page
Proc Am Thorac SocHome page
F. D. Martinez
CD14, Endotoxin, and Asthma Risk: Actions and Interactions
Proceedings of the ATS, July 1, 2007; 4(3): 221 - 225.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Respir. Crit. Care Med.Home page
W. C. Moore and S. P. Peters
Update in Asthma 2006
Am. J. Respir. Crit. Care Med., April 1, 2007; 175(7): 649 - 654.
[Full Text] [PDF]


Home page
Proc Am Thorac SocHome page
F. D. Martinez
Gene-Environment Interactions in Asthma: With Apologies to William of Ockham
Proceedings of the ATS, January 1, 2007; 4(1): 26 - 31.
[Abstract] [Full Text] [PDF]


Home page
Proc Am Thorac SocHome page
K. C. Barnes, A. V. Grant, N. N. Hansel, P. Gao, and G. M. Dunston
African Americans with Asthma: Genetic Insights
Proceedings of the ATS, January 1, 2007; 4(1): 58 - 68.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Respir. Crit. Care Med.Home page
M. Kabesch
A Glitch in the Switch?: Of Endotoxin, CD14, and Allergy.
Am. J. Respir. Crit. Care Med., August 15, 2006; 174(4): 365 - 366.
[Full Text] [PDF]


Home page
Am. J. Respir. Crit. Care Med.Home page
A. Simpson, S. L. John, F. Jury, R. Niven, A. Woodcock, W. E. R. Ollier, and A. Custovic
Endotoxin Exposure, CD14, and Allergic Disease: An Interaction between Genes and the Environment
Am. J. Respir. Crit. Care Med., August 15, 2006; 174(4): 386 - 392.
[Abstract] [Full Text] [PDF]


Home page
CVIHome page
S. P. Wiertsema, S.-K. Khoo, G. Baynam, R. H. Veenhoven, I. A. Laing, G. A. Zielhuis, G. T. Rijkers, J. Goldblatt, P. N. LeSouef, and E. A. M. Sanders
Association of CD14 Promoter Polymorphism with Otitis Media and Pneumococcal Vaccine Responses.
Clin. Vaccine Immunol., August 1, 2006; 13(8): 892 - 897.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Respir. Crit. Care Med.Home page
A. C. Martin, I. A. Laing, S.-K. Khoo, G. Zhang, K. Rueter, L. Teoh, S. Taheri, C. M. Hayden, G. C. Geelhoed, J. Goldblatt, et al.
Acute Asthma in Children: Relationships among CD14 and CC16 Genotypes, Plasma Levels, and Severity
Am. J. Respir. Crit. Care Med., March 15, 2006; 173(6): 617 - 622.
[Abstract] [Full Text] [PDF]


Home page
Proc Am Thorac SocHome page
K. C. Barnes
Genetic Determinants and Ethnic Disparities in Sepsis-associated Acute Lung Injury
Proceedings of the ATS, October 1, 2005; 2(3): 195 - 201.
[Abstract] [Full Text] [PDF]


Home page
PediatricsHome page
H.-H. Shih, T.-M. Lin, J.-H. Chuang, H.-L. Eng, S.-H. H. Juo, F.-C. Huang, C.-L. Chen, and H.-L. Chen
Promoter Polymorphism of the CD14 Endotoxin Receptor Gene Is Associated With Biliary Atresia and Idiopathic Neonatal Cholestasis
Pediatrics, August 1, 2005; 116(2): 437 - 441.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Respir. Crit. Care Med.Home page
S. Choudhry, P. C. Avila, S. Nazario, N. Ung, J. Kho, J. R. Rodriguez-Santana, J. Casal, H.-J. Tsai, A. Torres, E. Ziv, et al.
CD14 Tobacco Gene-Environment Interaction Modifies Asthma Severity and Immunoglobulin E Levels in Latinos with Asthma
Am. J. Respir. Crit. Care Med., July 15, 2005; 172(2): 173 - 182.
[Abstract] [Full Text] [PDF]


Home page
ThoraxHome page
M-A Kedda, F Lose, D Duffy, E Bell, P J Thompson, and J Upham
The CD14 C-159T polymorphism is not associated with asthma or asthma severity in an Australian adult population
Thorax, March 1, 2005; 60(3): 211 - 214.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
M. E. H. Bashir, S. Louie, H. N. Shi, and C. Nagler-Anderson
Toll-Like Receptor 4 Signaling by Intestinal Microbes Influences Susceptibility to Food Allergy
J. Immunol., June 1, 2004; 172(11): 6978 - 6987.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
S. Bozinovski, J. Jones, S.-J. Beavitt, A. D. Cook, J. A. Hamilton, and G. P. Anderson
Innate immune responses to LPS in mouse lung are suppressed and reversed by neutralization of GM-CSF via repression of TLR-4
Am J Physiol Lung Cell Mol Physiol, April 1, 2004; 286(4): L877 - L885.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Respir. Crit. Care Med.Home page
M. N. Blumenthal
New Thoughts Regarding the Genetics of Atopy
Am. J. Respir. Crit. Care Med., March 1, 2004; 169(5): 555 - 556.
[Full Text] [PDF]


Home page
J. Leukoc. Biol.Home page
M. Kabesch and R. P. Lauener
Why Old McDonald had a farm but no allergies: genes, environments, and the hygiene hypothesis
J. Leukoc. Biol., March 1, 2004; 75(3): 383 - 387.
[Full Text] [PDF]


Home page
Am. J. Respir. Crit. Care Med.Home page
A. R. O'Donnell, B. G. Toelle, G. B. Marks, C. M. Hayden, I. A. Laing, J. K. Peat, J. Goldblatt, and P. N. Le Souef
Age-specific Relationship between CD14 and Atopy in a Cohort Assessed from Age 8 to 25 Years
Am. J. Respir. Crit. Care Med., March 1, 2004; 169(5): 615 - 622.
[Abstract] [Full Text] [PDF]


Home page
Innate ImmunityHome page
O. Michel
Role of lipopolysaccharide (LPS) in asthma and other pulmonary conditions
Innate Immunity, October 1, 2003; 9(5): 293 - 300.
[Abstract] [PDF]


Home page
Am. J. Respir. Crit. Care Med.Home page
K. A. Pacheco, C. McCammon, A. H. Liu, P. S. Thorne, M. E. O'Neill, J. Martyny, L. S. Newman, R. F. Hamman, and C. S. Rose
Airborne Endotoxin Predicts Symptoms in Non-Mouse-sensitized Technicians and Research Scientists Exposed to Laboratory Mice
Am. J. Respir. Crit. Care Med., April 1, 2003; 167(7): 983 - 990.
[Abstract] [Full Text] [PDF]


Home page
J. Med. Genet.Home page
H-J Yoon, J H Shin, S H Yang, D-W Chae, H Kim, D-S Lee, H L Kim, S Kim, J S Lee, and Y S Kim
Association of the CD14 gene -159C polymorphism with progression of IgA nephropathy
J. Med. Genet., February 1, 2003; 40(2): 104 - 108.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Respir. Crit. Care Med.Home page
B. A. Raby, W. T. Klimecki, C. Laprise, Y. Renaud, J. Faith, M. Lemire, C. Greenwood, K. M. Weiland, C. Lange, L. J. Palmer, et al.
Polymorphisms in Toll-Like Receptor 4 Are Not Associated with Asthma or Atopy-related Phenotypes
Am. J. Respir. Crit. Care Med., December 1, 2002; 166(11): 1449 - 1456.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Respir. Cell Mol. Bio.Home page
M. N. Hylkema, W. Timens, M. Luinge, N. van der Werf, and M. O. Hoekstra
The Effect of Bacillus Calmette-Guerin Immunization Depends on the Genetic Predisposition to Th2-Type Responsiveness
Am. J. Respir. Cell Mol. Biol., August 1, 2002; 27(2): 244 - 249.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
K. Dabbagh, M. E. Dahl, P. Stepick-Biek, and D. B. Lewis
Toll-Like Receptor 4 Is Required for Optimal Development of Th2 Immune Responses: Role of Dendritic Cells
J. Immunol., May 1, 2002; 168(9): 4524 - 4530.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Respir. Crit. Care Med.Home page
M. J. TOBIN
Asthma, Airway Biology, and Nasal Disorders in AJRCCM 2001
Am. J. Respir. Crit. Care Med., March 1, 2002; 165(5): 598 - 618.
[Full Text] [PDF]


Home page
Am. J. Respir. Crit. Care Med.Home page
T. Kusunoki, T. Nakahata, T. Miyanomae, and Y. Inoue
POSSIBLE DUAL EFFECT OF CD14 MOLECULE ON ATOPY
Am. J. Respir. Crit. Care Med., February 15, 2002; 165(4): 551a - 552.
[Full Text]


Home page
Toxicol SciHome page
B. Granum and M. Lovik
The Effect of Particles on Allergic Immune Responses
Toxicol. Sci., January 1, 2002; 65(1): 7 - 17.
[Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by KOPPELMAN, G. H.
Right arrow Articles by BLEECKER, E. R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by KOPPELMAN, G. H.
Right arrow Articles by BLEECKER, E. R.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Proc. Am. Thorac. Soc. Am. J. Respir. Cell Mol. Biol.
Copyright © 2001 American Thoracic Society