|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| |
ABSTRACT |
|---|
|
|
|---|
To elucidate which cells are synthesizing tenascin in usual interstitial pneumonia (UIP) we have analyzed thoracoscopic or open lung biopsies from 30 patients with UIP by mRNA in situ hybridization, using 35S-labeled tenascin RNA probes. The phenotype of the cells expressing tenascin mRNA was
confirmed by immunohistochemical stainings of serial sections with antibodies against
-smooth
muscle actin and human cytokeratin. The results demonstrate that tenascin is expressed at the foci of
recent lesions consisting of intralumenal or incorporating loose fibrotic buds. The cells expressing tenascin mRNA were located in and underneath the newly formed epithelium. Immunohistochemical
stainings showed that the cells in the newly formed epithelium were strongly cytokeratin positive,
and thus evidently regenerating type 2 pneumocytes, while the cells underneath the newly formed
epithelium were
-smooth muscle actin positive and apparently myofibroblasts. Tenascin mRNA expression was clearly stronger and more frequent in myofibroblasts than in type 2 pneumocytes, however. Weak tenascin mRNA expression was also found in metaplastic bronchiolar-type epithelium and
alveolar macrophages. Our results are thus in good agreement with the previous studies showing
that tenascin is actively synthesized at the early fibrotic lesions in UIP. Furthermore, results demonstrate that the interaction between the epithelium and the underlying connective tissue plays a
significant role in tenascin synthesis and that myofibroblasts are mainly responsible for its synthesis
in fibroblastic foci of UIP. Pääkkö P, Kaarteenaho-Wiik R, Pöllänen R, Soini Y. Tenascin mRNA
expression at the foci of recent injury in usual interstitial pneumonia.
| |
INTRODUCTION |
|---|
|
|
|---|
Idiopathic pulmonary fibrosis (IPF), i.e., cryptogenic fibrosing alveolitis, represents a group of interstitial lung diseases of unknown etiology (1). Four histologically distinct forms of IPF are usual interstitial pneumonia (UIP), desquamative interstitial pneumonia (DIP)/respiratory bronchiolitis interstitial lung disease (RBILD), acute interstitial pneumonia (AIP, Hamman-Rich disease), and nonspecific interstitial pneumonia (2). UIP is the most common type, accounting for more than 60% of IPF cases in one study (3). The prognosis of UIP is poor; the overall median survival reported by Bjoraker and coworkers (3) was 2.8 yr.
Tenascin is an oligomeric extracellular matrix glycoprotein discovered in the 1980s (4). Nowadays the best known isoforms are tenascin-C, -X, -R (5), and -Y (6). The function of tenascin is unclear. It has been suggested that it may play a structural role and modulate the adhesive and migratory functions of cells (7). Tenascin is expressed during embryonic development, inflammation, and wound healing (8) and in several normal and tumorous adult tissues (9).
In the growing lung, tenascin mRNA is expressed by the epithelium at the sites of active growth of bronchial tubes (10). It is strongly expressed by immunohistochemistry in fetal and newborn rat lung (11). Increased tenascin expression has been observed in lung carcinomas (9, 12) and in several types of fibrotic lung disorders (13, 14). In UIP we have found increased tenascin immunoreactivity in the loose fibromyxoid intraalveolar buds, and beneath the metaplastic alveolar and bronchiolar epithelium (14). Our immunoelectron microscopy findings suggested that type 2 pneumocytes could be responsible for tenascin synthesis in UIP (14). However, the knowledge on which cells are synthesizing tenascin in the lung parenchyma in UIP is rather limited.
This study was undertaken to investigate which cells are
synthesizing tenascin in UIP. For this, we collected representative material of open lung or thoracoscopic biopsies from
patients with UIP in different stages of disease, and applied an
in situ hybridization technique allowing us to localize the cells
and tissue areas expressing tenascin at the mRNA level. The
phenotype of the tenascin mRNA-expressing cells was confirmed by immunohistochemical stainings for
-smooth muscle actin and human cytokeratin.
| |
METHODS |
|---|
|
|
|---|
Study Population and Handling of Specimens
Histopathologically typical cases of UIP were collected from the files of the Department of Pathology, Oulu University Hospital (Oulu, Finland), by reevaluating lung biopsies taken either as open or as thoracoscopic biopsies between 1977 and 1996. Thirty patients (17 women [mean age 52.9 yr; range, 30-70 yr] and 13 men [mean age, 57.7 yr; range, 34-73 yr]) representing UIP were included in the study. Diagnoses of all patients were based on light microscopy evaluations, using the histologic criteria reviewed by Katzenstein and Myers (2).
Biopsies were taken from different parts of the left or right lung. For primary diagnostic purposes, pieces of the affected tissue were also processed for electron microscopy. A part of the tissue material was used for microbiological analysis for Mycobacterium tuberculosis, other bacteria, and fungi. All these cultures were negative.
The biopsy material was fixed in 10% buffered formalin either under vacuum in order to expand the tissue and to remove air bubbles, or perfused by injecting the fixative, using a small syringe, into bronchioles (for the technique, see reference 14). The specimens were then dehydrated and embedded in paraffin. Five-micron-thick sections were stained with hematoxylin-eosin, Giemsa, Verhoeff, van Gieson, Perl's blue, periodic acid-Schiff alcian blue, and periodic acid-Schiff stains.
The whole material was reevaluated and one representative tissue
block was selected for tenascin in situ hybridization experiments. After having observed that tenascin was expressed at the foci of recent
injury, i.e., in the loose fibromyxoid intraalveolar and interstitial buds,
and in order to identify the phenotype of the tenascin-expressing cells,
we next stained the serial sections with commercially available antibodies against
-smooth muscle actin (clone 1A4; Sigma, St. Louis,
MO) and human cytokeratin (clone MNF116; Dako, Glostrup, Denmark) at a dilution of 1:1,000 and 1:100, respectively.
Preparation of Tissue Sections for In Situ Hybridization
Four-µm-thick sections from paraffin-embedded lung biopsies were collected on clean SuperFrost Plus glass slides (Erie Company, Portsmouth, NH), paraffin was removed by xylene, and tissues were rehydrated through ethanol series. After three immersions in phosphate-buffered saline (PBS), pH 7.2, the sections were treated in 0.2 M HCl for 20 min, twice in PBS for 3 min each, followed by proteinase K (100 µg/ml in PBS) treatment for 15 min at 37° C. Tissue sections were then transferred into 0.025 M glycine for 30 s. Tissues were postfixed in 4% paraformaldehyde (Fluka, Buchs, Switzerland) in PBS, pH 7.2 (all solutions made with 0.1% diethyl pyrocarbonate-treated water). After fixation, tissue sections were transferred into 0.025 M glycine in PBS for 3 min, and then acetylated in 0.25% acetic anhydride in 0.1 M triethanolamine (pH 8.0) for 10 min (15). After that tissue sections were rinsed in 2× SSC (1× SSC is 0.15 M NaCl plus 0.015 M sodium citrate) and dehydrated through a graded ethanol series and air dried.
Preparation of RNA Probes
A cDNA fragment (bases 814-1316) of the full-length human tenascin-C cDNA (16) was synthesized by polymerase chain reaction (PCR) from the HT-11 subclone kindly provided by L. Zardi (Instituto Nazionale per la Ricerca sul Cancro, Genoa, Italy) by using the following primers: 5' CCCTGCAGTGAGGAGCACGGCACA 3' and 5' TGCCCATTGACACAGCGGCCATGG 3'. The 503-base pair PCR product containing a specific sequence for tenascin-C was subcloned into a TA vector (TA cloning kit; InVitrogen, San Diego, CA). Sense and antisense RNA probes were generated from a linearized template by using a riboprobe transcription kit (Promega, Madison, WI) and the probes were labeled with [35S]UTP (Amersham, Little Chalfont, UK). The radioactively labeled RNA probes were purified by centrifugation through Bio-Gel P-30 columns (Bio-Spin 30; Bio-Rad, Hercules, CA). Each in vitro transcription reaction yielded RNA probes of high specific activity (typically 4.5-6 × 108 dpm/µg of DNA template and 50-70% incorporation).
In Situ Hybridization
The hybridization mixture contained the 35S-labeled RNA probe (1.2 × 105 dpm/µl), 50% deionized formamide (GIBCO-BRL, Gaithersburg, MD), 5 mM dithiothreitol, yeast tRNA (500 µg/ml; GIBCO-BRL), bovine serum albumin (2 mg/ml; GIBCO-BRL), and 4× SSC. The samples were hybridized overnight at 50° C while covered with Parafilm (17) and then washed three times in 2× SSC-50% formamide at 52° C and in 2× SSC at room temperature, followed by incubation in an RNase solution (100 µg of RNase A [Boehringer GmbH, Mannheim, Germany] per milliliter in 2× SSC at 37° C for 30 min). The tissue sections were subsequently washed in 2× SSC-50% formamide at 52° C for 5 min and in three changes of 2× SSC at room temperature, dehydrated sequentially in 70, 80, and 95% ethanol for 1 min each with agitation, and air dried. Autoradiography was performed by dipping the sections in Kodak (Rochester, NY) NTB-2 nuclear track emulsion diluted 1:1 with sterile distilled water at 42° C. After 1 wk of exposure at 4° C, the slides were developed in Kodak D-19 developer for 5 min, rinsed in 1% acetic acid in distilled water for 30 s, fixed in a Kodak Agefix for 5 min, rinsed in distilled water, and stained with hematoxylin-eosin.
To evaluate the specificity and reproducibility of the hybridization of the 35S-labeled antisense tenascin probes to the tissue sections of lung biopsy specimens, some control experiments were performed, including (1) always using 35S-labeled sense tenascin probes separately for each sample, and (2) repeating the hybridization experiments for some samples.
The hybridized tissue sections of lung biopsies were examined by light microscopy, and the number of grains over the cells was evaluated in general and especially in locations where tenascin immunoreactivity was located in our previous studies (14). These locations included loose fibromyxoid intraalveolar buds, and the areas beneath alveolar and bronchiolar metaplastic epithelium (14). Cells or cell groups hybridized with the 35S-labeled antisense tenascin probe were considered positive if they contained more grains than the corresponding cells and tissue areas that had been hybridized with the 35S-labeled sense tenascin probe.
| |
RESULTS |
|---|
|
|
|---|
The most striking result in UIP was the presence of small foci
of cells showing strong tenascin mRNA expression. Such foci were found in 27 of 30 cases (Table 1), and corresponded
nicely to the loose either intraalveolar or incorporating fibromyxoid buds, i.e., the foci of recent injury, found in routine
stained sections (Figures 1-3). The number of such foci in one
section varied from 1 to 12 (Table 1). The positive cells were
usually located at the periphery on the epithelial side of the fibromyxoid buds and in most cases were fusiformic in shape
(Figures 1C and 2C). Immunohistochemical staining clearly
demonstrated that these cells were positive for
-smooth muscle actin, a typical phenotype for lung myofibroblasts (Figure
4) (18). Clearly less frequently the cells were cuboidal in shape
and epithelial in origin, as demonstrated by immunohistochemical stainings for cytokeratin, evidently corresponding to type 2 pneumocytes (Figure 4). Cases were also found in which both
cell types simultaneously showed tenascin mRNA expression
(Figure 3C). The total number of type 2 pneumocytes and myofibroblasts in each case are given in Table 1. Even though
both myofibroblasts and type 2 pneumocytes showed tenascin
mRNA expression, it was clearly stronger and more frequent in myofibroblasts than in type 2 pneumocytes (Table 1). The
three UIP cases that showed no clear tenascin mRNA expression represented end-stage fibrosis and honeycombing.
|
|
|
|
|
In a few cases bronchial metaplastic epithelium and alveolar macrophages showed weak tenascin mRNA expression (Figure 5) while inflammatory cells such as lymphocytes, plasma cells and neutrophils or smooth muscle cells showed no signals for tenascin mRNA.
|
In normal-looking lung parenchyma, which served as a negative control, bronchiolar epithelium, type 1 and 2 pneumocytes, endothelial and smooth muscle cells of the blood vessels, and alveolar macrophages showed no tenascin mRNA expression.
Repeated hybridization experiments gave consistently similar and, thus, reproducible results.
| |
DISCUSSION |
|---|
|
|
|---|
In the present study we investigated which cells in UIP synthesize tenascin mRNA. For this purpose we applied an in situ
hybridization technique in order to identify by light microscopy the cells and local tissue areas expressing tenascin mRNA
and its context relative to the foci of tissue injuries in UIP. The
phenotype of the cells expressing tenascin mRNA was confirmed by immunohistochemical staining of serial sections for
-smooth muscle actin and human cytokeratin. Our results
clearly demonstrate that tenascin mRNA is expressed in the
loose, newly formed fibrotic foci by the myofibroblasts and
the type 2 pneumocytes while the old fibrotic areas showed no tenascin expression. However, tenascin mRNA expression
was clearly stronger and more frequent in myofibroblasts than
in type 2 pneumocytes. The results are in good agreement with
previous immunohistochemical studies peformed by us and
others (13, 14).
Tenascin mRNA expression was seen especially in the areas termed "fibroblast foci" consisting of fibroblasts, which by
immunohistochemical and ultrastructural studies have been
demonstrated to differentiate into the myofibroblast-type cells
expressing
-smooth muscle actin, but not desmin, in UIP
(18). It is interesting that transforming growth factor
1
(TGF-
1) has been shown to induce both the myofibroblast-like differentiation in human synovial fibroblasts (19) and rat
palatal fibroblasts (20), and increased tenascin expression and
secretion in chick embryo fibroblasts (21).
In addition to the myofibroblasts of the fibroblast foci we
also noticed less frequent tenascin mRNA expression in the
newly formed epithelium consisting of the regenerating type 2 pneumocytes. This finding is in concordance with our previous
immunoelectron microscopy study showing tenascin labeling
in the regenerating type 2 pneumocytes in UIP (14). Findings
supporting the idea that tenascin is also synthesized by the epithelial cells have been reported in cytokine (such as TGF-
,
tumor necrosis factor
[TNF-
], and IFN-
)-induced transformed bronchial epithelial cells (22, 23), in benign and malignant mesothelioma cells (24), in human epidermal keratinocytes during wound healing (25), in skin tumors (26), in lichen
sclerosus (27), and in human benign and malignant breast lesions (28). In one study of human colon adenomas and carcinomas tenascin-C mRNA expression was demonstrated in
myofibroblasts, and in vascular and epithelial cells (29).
Corrin and Dewar (30) suggest that the regenerating type 2 pneumocytes synthesize and secrete cytokines such as TGF-
,
and that they play a major role in the development of the fibrotic process in idiopathic interstitial pulmonary fibrosis. In
the mural type of cryptogenic fibrosing alveolitis, i.e., usual interstitial pneumonia, hyperplastic type 2 pneumocytes have
been shown by immunohistochemistry to express intracellular
TGF-
1 (31). In immunohistochemical and in situ hybridization studies, Zhang and coworkers (32) have demonstrated
that rat myofibroblasts, fibroblasts, and eosinophils under
bleomycin induction express increased amounts of TGF-
1.
In another study increased TGF-
1 expression was localized mainly in fibroblasts and cells lining alveolar walls, probably representing type 2 pneumocytes in mouse lung after bleomycin induction (33). It is possible that in the early lesions of UIP, regenerating type 2 pneumocytes synthesize increased
amounts of TGF-
1 inducing both the type 2 pneumocytes to
produce tenascin, and the surrounding fibroblasts to differentiate into the myofibroblast-like cells synthesizing and secreting tenascin, and perhaps also TGF-
1, which may be part of
the autocrine or paracrine regulating systems involved in the
pathogenesis of UIP.
In conclusion, our results are in good agreement with previous studies showing that tenascin is actively synthesized at the early fibrotic lesions in UIP (13, 14). In addition, our results demonstrate that the interaction between the epithelium and the underlying connective tissue in the early lesions of UIP plays a significant role in tenascin synthesis and that myofibroblasts are mainly responsible for its synthesis in fibroblastic foci of UIP.
| |
Footnotes |
|---|
Correspondence and requests for reprints should be addressed to Paavo Pääkkö, M.D., Ph.D., Department of Pathology, University of Oulu, P.O. Box 5000 (Kajaanintie 52 D), FIN-90401 Oulu, Finland. E-mail: paavo.paakko{at}oulu.fi
(Received in original form September 25, 1998 and in revised form September 15, 1999).
Acknowledgments: The technical assistance of Mr. Tapio Leinonen and Mr. Hannu Wäänänen is acknowledged.
Supported by the Finnish Anti-Tuberculosis Association Foundation and the Finnish Cancer Societies, Finland.
| |
References |
|---|
|
|
|---|
1. Cherniack, R. M., T. V. Colby, A. Flint, W. M. Thurlbeck, J. Waldron, L. Ackerson, T. E. King Jr., and the BAL Cooperative Group Steering Committee. 1991. Quantitative assessment of lung pathology in idiopathic pulmonary fibrosis. Am. Rev. Respir. Dis. 144: 892-900 [Medline].
2.
Katzenstein, A.-L. A., and
J. L. Myers.
1998.
Idiopathic pulmonary fibrosis: clinical relevance of pathologic classification. State of the art.
Am. J. Respir. Crit. Care Med.
157:
1301-1315
3. Bjoraker, J. A., J. H. Ryu, M. K. Edwin, J. L. Myers, H. D. Tazelaar, D. R. Schroeder, and K. P. Offord. 1998. Prognostic significance of histopathologic subsets in idiopathic pulmonary fibrosis. Am. J. Respir. Crit. Care Med. 157: 199-203 .
4.
Chiquet, M., and
D. M. Fambrough.
1984.
Chick myotendinous antigen:
II. A novel extracellular glycoprotein complex consisting of large disulfide-linked subunits.
J. Cell Biol.
98:
1937-1946
5. Erickson, H. P.. 1993. Tenascin-C, tenascin-R and tenascin-X: a family of talented proteins in search of functions. Curr. Opin. Cell Biol. 5: 869-876 [Medline].
6.
Hagios, C.,
M. Koch,
J. Spring,
M. Chiquet, and
R. Chiquet-Ehrismann.
1996.
Tenascin-Y: a protein of novel domain structure is secreted by
differentiated fibroblasts of muscle connective tissue.
J. Cell Biol.
134:
1499-1512
7. Chiquet-Ehrismann, R.. 1990. What distinguishes tenascin from fibronectin? FASEB J. 4: 2598-2604 [Abstract].
8. Erickson, H. P., and M. A. Bourdon. 1989. Tenascin: an extracellular matrix protein prominent in specialized embryonic tissues and tumors. Annu. Rev. Cell Biol. 5: 71-92 .
9. Koukoulis, G. K., V. E. Gould, A. Bhattacharyya, J. E. Gould, A. A. Howeedy, and I. Virtanen. 1991. Tenascin in normal, reactive, hyperplastic, and neoplastic tissues: biologic and pathologic implications. Hum. Pathol 22: 636-643 [Medline].
10. Koch, M., B. Wehrle-Haller, S. Baumgartner, J. Spring, D. Brubacher, and M. Chiquet. 1991. Epithelial synthesis of tenascin at tips of growing bronchi and graded accumulation in basement membrane and mesenchyme. Exp. Cell Res. 194: 297-300 [Medline].
11. Young, S. L., L.-Y. Chang, and H. P. Erickson. 1994. Tenascin-C in rat lung: distribution, ontogeny and role in branching morphogenesis. Dev. Biol. 161: 615-625 [Medline].
12. Soini, Y., P. Pääkkö, K. Nuorva, D. Kamel, A. Linnala, I. Virtanen, and V.-P. Lehto. 1993. Tenascin immunoreactivity in lung tumors. Am. J. Clin. Pathol. 100: 145-150 [Medline].
13. Wallace, W. A. H., S. E. M. Howie, D. Lamb, and D. M. Salter. 1995. Tenascin immunoreactivity in cryptogenic fibrosing alveolitis. J. Pathol. 175: 415-420 [Medline].
14. Kaarteenaho-Wiik, R., T. Tani, R. Sormunen, Y. Soini, I. Virtanen, and P. Pääkkö. 1996. Tenascin immunoreactivity as a prognostic marker in usual interstitial pneumonia. Am. J. Respir. Crit. Care Med. 154: 511-518 [Abstract].
15.
Rosenfeld, M. A.,
W. Siegfried,
K. Yoshimura,
K. Yoneyama,
M. Fukayama,
L. E. Stier,
P. K. Pääkkö,
P. Gilardi,
L. D. Stratford-Perricaudet,
M. Perricaudet,
S. Jallat,
A. Pavirani,
J.-P. Lecocq, and
R. G. Crystal.
1991.
Adenovirus-mediated transfer of a recombinant
1-antitrypsin gene to the lung epithelium in vivo.
Science
252:
431-434
16.
Siri, A.,
B. Carnemolla,
M. Saginati,
A. Leprini,
G. Casari,
F. Baralle, and
L. Zardi.
1991.
Human tenascin: primary structure, pre-mRNA
splicing patterns and localization of the epitopes recognized by two
monoclonal antibodies.
Nucleic Acids Res.
19:
525-531
17. Pääkkö, P., K. Nuorva, D. Kamel, and Y. Soini. 1992. Evidence by in situ hybridization that c-erbB-2 proto-oncogene expression is a marker of malignancy and is expressed in lung adenocarcinomas. Am. J. Respir. Cell Mol. Biol. 7: 325-334 .
18. Kuhn, C., and J. A. McDonald. 1991. The roles of the myofibroblast in idiopathic pulmonary fibrosis: ultrastructural and immunohistochemical features of sites of active extracellular matrix synthesis. Am. J. Pathol. 138: 1257-1265 [Abstract].
19.
Mattey, D. L.,
P. T. Dawes,
N. B. Nixon, and
H. Slater.
1997.
Transforming growth factor
1 and interleukin 4 induced
smooth muscle actin
expression and myofibroblast-like differentiation in human synovial
fibroblasts in vitro: modulation by basic fibroblast growth factor.
Ann.
Rheum. Dis.
56:
426-431
20.
Yokozeki, M.,
K. Moriyama,
H. Shimokawa, and
T. Kuroda.
1997.
Transforming growth factor-
1 modulates myofibroblastic phenotype
of rat palatal fibroblasts in vitro.
Exp. Cell Res.
231:
328-336
[Medline].
21.
Pearson, C. A.,
D. Pearson,
S. Shibahara,
J. Hofsteenge, and
R. Chiquet-Ehrismann.
1988.
Tenascin: cDNA cloning and induction by TGF-
.
EMBO J.
7:
2977-2982
[Medline].
22. Härkönen, E., I. Virtanen, A. Linnala, L. L. Laitinen, and V. L. Kinnula. 1995. Modulation of fibronectin and tenascin production in human bronchial epithelial cells by inflammatory cytokines in vitro. Am. J. Respir. Cell Mol. Biol. 13: 109-115 [Abstract].
23.
Linnala, A.,
V. Kinnula,
L. A. Laitinen,
V.-P. Lehto, and
I. Virtanen.
1995.
Transforming growth factor-
regulates the expression of fibronectin and tenascin in BEAS 2B human bronchial epithelial cells.
Am. J. Respir. Cell Mol. Biol.
13:
578-585
[Abstract].
24.
Kinnula, V. L.,
A. Linnala,
E. Viitala,
K. Linnainmaa, and
I. Virtanen.
1998.
Tenascin and fibronectin expression in human mesothelial cells
and pleural mesothelioma cell-line cells.
Am. J. Respir. Cell Mol. Biol.
19:
445-452
25. Latijnhouwers, M., M. Bergers, M. Ponec, H. Dijkman, and M. Andriessen. 1997. Human epidermal keratinocytes are a source of tenascin-C during wound healing. J. Invest. Dermatol. 108: 776-783 [Medline].
26.
Tuominen, H.,
R. Pöllänen, and
M. Kallioinen.
1997.
Multicellular origin
of tenascin in skin tumors
an in situ hybridization study.
J. Cutan.
Pathol.
24:
590-596
[Medline].
27. Soini, Y., R. Pöllänen, H. Autio-Harmainen, and V.-P. Lehto. 1997. Tenascin expression in lichen sclerosus. Int. J. Gynecol. Pathol. 16: 313-318 [Medline].
28. Yoshida, T., E.-I. Matsumoto, N. Hanamura, I. Kalembeyi, K. Katsuta, A. Ishihara, and T. Sakakura. 1997. Co-expression of tenascin and fibronectin in epithelial and stromal cells of benign lesions and ductal carcinomas in the human breast. J. Pathol. 182: 421-428 [Medline].
29. Hanamura, N., T. Yoshida, E.-I. Matsumoto, Y. Kawarada, and T. Sakakura. 1997. Expression of fibronectin and tenascin-C mRNA by myofibroblasts, vascular cells and epithelial cells in human colon adenomas and carcinomas. Int. J. Cancer 73: 10-15 [Medline].
30. Corrin, B., and A. Dewar. 1996. Pathogenesis of idiopathic interstitial pulmonary fibrosis. Ultrastruct. Pathol. 20: 369-371 [Medline].
31.
Corrin, B.,
D. Butcher,
B. J. McAnulty,
R. M. Dubois,
C. M. Black,
G. J. Laurent, and
N. K. Harrison.
1994.
Immunohistochemical localization
of transforming growth factor-
1 in the lungs of patients with systemic
sclerosis, cryptogenic fibrosing alveolitis and other lung disorders.
Histopathology
24:
145-150
[Medline].
32.
Zhang, K.,
K. C. Flanders, and
S. H. Phan.
1995.
Cellular localization of
transforming growth factor-
expression in bleomycin-induced pulmonary fibrosis.
Am. J. Pathol.
147:
352-361
[Abstract].
33.
Coker, R. K.,
G. J. Laurent,
S. Shahzeidi,
P. A. Lympany,
R. M. duBois,
P. K. Jeffery, and
R. J. McAnulty.
1997.
Transforming growth factors-
1, -
2, and -
3 stimulate fibroblast procollagen production in vitro but
are differentially expressed during bleomycin-induced lung fibrosis.
Am. J. Pathol.
150:
981-991
[Abstract].
This article has been cited by other articles:
![]() |
H. G. R. Thompson, J. D. Mih, T. B. Krasieva, B. J. Tromberg, and S. C. George Epithelial-derived TGF-beta2 modulates basal and wound-healing subepithelial matrix homeostasis Am J Physiol Lung Cell Mol Physiol, December 1, 2006; 291(6): L1277 - L1285. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. R. Flaherty, T. V. Colby, W. D. Travis, G. B. Toews, J. Mumford, S. Murray, V. J. Thannickal, E. A. Kazerooni, B. H. Gross, J. P. Lynch III, et al. Fibroblastic Foci in Usual Interstitial Pneumonia: Idiopathic versus Collagen Vascular Disease Am. J. Respir. Crit. Care Med., May 15, 2003; 167(10): 1410 - 1415. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Inoue, T. E. King Jr., E. Barker, E. Daniloff, and L. S. Newman Basic Fibroblast Growth Factor and Its Receptors in Idiopathic Pulmonary Fibrosis and Lymphangioleiomyomatosis Am. J. Respir. Crit. Care Med., September 1, 2002; 166(5): 765 - 773. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Kaarteenaho-Wiik, V. L. Kinnula, R. Herva, Y. Soini, R. Pollanen, and P. Paakko Tenascin-C Is Highly Expressed in Respiratory Distress Syndrome and Bronchopulmonary Dysplasia J. Histochem. Cytochem., March 1, 2002; 50(3): 423 - 431. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. J. TOBIN Tuberculosis, Lung Infections, and Interstitial Lung Disease in AJRCCM 2000 Am. J. Respir. Crit. Care Med., November 15, 2001; 164(10): 1774 - 1788. [Full Text] [PDF] |
||||
![]() |
R. Kaarteenaho-Wiik, V. Kinnula, R. Herva, P. Paakko, R. Pollanen, and Y. Soini Distribution and mRNA Expression of Tenascin-C in Developing Human Lung Am. J. Respir. Cell Mol. Biol., September 1, 2001; 25(3): 341 - 346. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Proc. Am. Thorac. Soc. | Am. J. Respir. Cell Mol. Biol. |