INTRODUCTION

TOP ABSTRACT INTRODUCTION METHODS RESULTS DISCUSSION REFERENCES

Idiopathic pulmonary fibrosis (IPF), i.e., cryptogenic fibrosing alveolitis, represents a group of interstitial lung diseases of unknown etiology (1). Four histologically distinct forms of IPF are usual interstitial pneumonia (UIP), desquamative interstitial pneumonia (DIP)/respiratory bronchiolitis interstitial lung disease (RBILD), acute interstitial pneumonia (AIP, Hamman-Rich disease), and nonspecific interstitial pneumonia (2). UIP is the most common type, accounting for more than 60% of IPF cases in one study (3). The prognosis of UIP is poor; the overall median survival reported by Bjoraker and coworkers (3) was 2.8 yr.

Tenascin is an oligomeric extracellular matrix glycoprotein discovered in the 1980s (4). Nowadays the best known isoforms are tenascin-C, -X, -R (5), and -Y (6). The function of tenascin is unclear. It has been suggested that it may play a structural role and modulate the adhesive and migratory functions of cells (7). Tenascin is expressed during embryonic development, inflammation, and wound healing (8) and in several normal and tumorous adult tissues (9).

In the growing lung, tenascin mRNA is expressed by the epithelium at the sites of active growth of bronchial tubes (10). It is strongly expressed by immunohistochemistry in fetal and newborn rat lung (11). Increased tenascin expression has been observed in lung carcinomas (9, 12) and in several types of fibrotic lung disorders (13, 14). In UIP we have found increased tenascin immunoreactivity in the loose fibromyxoid intraalveolar buds, and beneath the metaplastic alveolar and bronchiolar epithelium (14). Our immunoelectron microscopy findings suggested that type 2 pneumocytes could be responsible for tenascin synthesis in UIP (14). However, the knowledge on which cells are synthesizing tenascin in the lung parenchyma in UIP is rather limited.

This study was undertaken to investigate which cells are synthesizing tenascin in UIP. For this, we collected representative material of open lung or thoracoscopic biopsies from patients with UIP in different stages of disease, and applied an in situ hybridization technique allowing us to localize the cells and tissue areas expressing tenascin at the mRNA level. The phenotype of the tenascin mRNA-expressing cells was confirmed by immunohistochemical stainings for -smooth muscle actin and human cytokeratin.

	METHODS

TOP ABSTRACT INTRODUCTION METHODS RESULTS DISCUSSION REFERENCES

Study Population and Handling of Specimens

Histopathologically typical cases of UIP were collected from the files of the Department of Pathology, Oulu University Hospital (Oulu, Finland), by reevaluating lung biopsies taken either as open or as thoracoscopic biopsies between 1977 and 1996. Thirty patients (17 women [mean age 52.9 yr; range, 30-70 yr] and 13 men [mean age, 57.7 yr; range, 34-73 yr]) representing UIP were included in the study. Diagnoses of all patients were based on light microscopy evaluations, using the histologic criteria reviewed by Katzenstein and Myers (2).

Biopsies were taken from different parts of the left or right lung. For primary diagnostic purposes, pieces of the affected tissue were also processed for electron microscopy. A part of the tissue material was used for microbiological analysis for Mycobacterium tuberculosis, other bacteria, and fungi. All these cultures were negative.

The biopsy material was fixed in 10% buffered formalin either under vacuum in order to expand the tissue and to remove air bubbles, or perfused by injecting the fixative, using a small syringe, into bronchioles (for the technique, see reference 14). The specimens were then dehydrated and embedded in paraffin. Five-micron-thick sections were stained with hematoxylin-eosin, Giemsa, Verhoeff, van Gieson, Perl's blue, periodic acid-Schiff alcian blue, and periodic acid-Schiff stains.

The whole material was reevaluated and one representative tissue block was selected for tenascin in situ hybridization experiments. After having observed that tenascin was expressed at the foci of recent injury, i.e., in the loose fibromyxoid intraalveolar and interstitial buds, and in order to identify the phenotype of the tenascin-expressing cells, we next stained the serial sections with commercially available antibodies against -smooth muscle actin (clone 1A4; Sigma, St. Louis, MO) and human cytokeratin (clone MNF116; Dako, Glostrup, Denmark) at a dilution of 1:1,000 and 1:100, respectively.

Preparation of Tissue Sections for In Situ Hybridization

Four-µm-thick sections from paraffin-embedded lung biopsies were collected on clean SuperFrost Plus glass slides (Erie Company, Portsmouth, NH), paraffin was removed by xylene, and tissues were rehydrated through ethanol series. After three immersions in phosphate-buffered saline (PBS), pH 7.2, the sections were treated in 0.2 M HCl for 20 min, twice in PBS for 3 min each, followed by proteinase K (100 µg/ml in PBS) treatment for 15 min at 37° C. Tissue sections were then transferred into 0.025 M glycine for 30 s. Tissues were postfixed in 4% paraformaldehyde (Fluka, Buchs, Switzerland) in PBS, pH 7.2 (all solutions made with 0.1% diethyl pyrocarbonate-treated water). After fixation, tissue sections were transferred into 0.025 M glycine in PBS for 3 min, and then acetylated in 0.25% acetic anhydride in 0.1 M triethanolamine (pH 8.0) for 10 min (15). After that tissue sections were rinsed in 2× SSC (1× SSC is 0.15 M NaCl plus 0.015 M sodium citrate) and dehydrated through a graded ethanol series and air dried.

Preparation of RNA Probes

A cDNA fragment (bases 814-1316) of the full-length human tenascin-C cDNA (16) was synthesized by polymerase chain reaction (PCR) from the HT-11 subclone kindly provided by L. Zardi (Instituto Nazionale per la Ricerca sul Cancro, Genoa, Italy) by using the following primers: 5' CCCTGCAGTGAGGAGCACGGCACA 3' and 5' TGCCCATTGACACAGCGGCCATGG 3'. The 503-base pair PCR product containing a specific sequence for tenascin-C was subcloned into a TA vector (TA cloning kit; InVitrogen, San Diego, CA). Sense and antisense RNA probes were generated from a linearized template by using a riboprobe transcription kit (Promega, Madison, WI) and the probes were labeled with [³⁵S]UTP (Amersham, Little Chalfont, UK). The radioactively labeled RNA probes were purified by centrifugation through Bio-Gel P-30 columns (Bio-Spin 30; Bio-Rad, Hercules, CA). Each in vitro transcription reaction yielded RNA probes of high specific activity (typically 4.5-6 × 10⁸ dpm/µg of DNA template and 50-70% incorporation).

In Situ Hybridization

The hybridization mixture contained the ³⁵S-labeled RNA probe (1.2 × 10⁵ dpm/µl), 50% deionized formamide (GIBCO-BRL, Gaithersburg, MD), 5 mM dithiothreitol, yeast tRNA (500 µg/ml; GIBCO-BRL), bovine serum albumin (2 mg/ml; GIBCO-BRL), and 4× SSC. The samples were hybridized overnight at 50° C while covered with Parafilm (17) and then washed three times in 2× SSC-50% formamide at 52° C and in 2× SSC at room temperature, followed by incubation in an RNase solution (100 µg of RNase A [Boehringer GmbH, Mannheim, Germany] per milliliter in 2× SSC at 37° C for 30 min). The tissue sections were subsequently washed in 2× SSC-50% formamide at 52° C for 5 min and in three changes of 2× SSC at room temperature, dehydrated sequentially in 70, 80, and 95% ethanol for 1 min each with agitation, and air dried. Autoradiography was performed by dipping the sections in Kodak (Rochester, NY) NTB-2 nuclear track emulsion diluted 1:1 with sterile distilled water at 42° C. After 1 wk of exposure at 4° C, the slides were developed in Kodak D-19 developer for 5 min, rinsed in 1% acetic acid in distilled water for 30 s, fixed in a Kodak Agefix for 5 min, rinsed in distilled water, and stained with hematoxylin-eosin.

To evaluate the specificity and reproducibility of the hybridization of the ³⁵S-labeled antisense tenascin probes to the tissue sections of lung biopsy specimens, some control experiments were performed, including (1) always using ³⁵S-labeled sense tenascin probes separately for each sample, and (2) repeating the hybridization experiments for some samples.

The hybridized tissue sections of lung biopsies were examined by light microscopy, and the number of grains over the cells was evaluated in general and especially in locations where tenascin immunoreactivity was located in our previous studies (14). These locations included loose fibromyxoid intraalveolar buds, and the areas beneath alveolar and bronchiolar metaplastic epithelium (14). Cells or cell groups hybridized with the ³⁵S-labeled antisense tenascin probe were considered positive if they contained more grains than the corresponding cells and tissue areas that had been hybridized with the ³⁵S-labeled sense tenascin probe.

	RESULTS

TOP ABSTRACT INTRODUCTION METHODS RESULTS DISCUSSION REFERENCES

The most striking result in UIP was the presence of small foci of cells showing strong tenascin mRNA expression. Such foci were found in 27 of 30 cases (Table 1), and corresponded nicely to the loose either intraalveolar or incorporating fibromyxoid buds, i.e., the foci of recent injury, found in routine stained sections (Figures 1-3). The number of such foci in one section varied from 1 to 12 (Table 1). The positive cells were usually located at the periphery on the epithelial side of the fibromyxoid buds and in most cases were fusiformic in shape (Figures 1C and 2C). Immunohistochemical staining clearly demonstrated that these cells were positive for -smooth muscle actin, a typical phenotype for lung myofibroblasts (Figure 4) (18). Clearly less frequently the cells were cuboidal in shape and epithelial in origin, as demonstrated by immunohistochemical stainings for cytokeratin, evidently corresponding to type 2 pneumocytes (Figure 4). Cases were also found in which both cell types simultaneously showed tenascin mRNA expression (Figure 3C). The total number of type 2 pneumocytes and myofibroblasts in each case are given in Table 1. Even though both myofibroblasts and type 2 pneumocytes showed tenascin mRNA expression, it was clearly stronger and more frequent in myofibroblasts than in type 2 pneumocytes (Table 1). The three UIP cases that showed no clear tenascin mRNA expression represented end-stage fibrosis and honeycombing.

View larger version (124K): [in this window] [in a new window]   View larger version (77K): [in this window] [in a new window]   View larger version (132K): [in this window] [in a new window]   Figure 1.   Tenascin mRNA expression in myofibroblasts. (A) A number of fusiformic cells, showing -smooth muscle actin positivity, apparently myofibroblasts in loose fibromyxoid incorporating bud contain strong signals for tenascin mRNA. Original magnification: ×120. (B) Dark-field illumination of the same section. Original magnification: ×120. (C ) High-power view of the bright-field illumination, demonstrating more clearly the cells showing tenascin mRNA expression. In situ hybridization for tenascin mRNA. Original magnification: ×320.

View larger version (111K): [in this window] [in a new window]   View larger version (79K): [in this window] [in a new window]   View larger version (100K): [in this window] [in a new window]   Figure 2.   Tenascin mRNA expression in type 2 pneumocytes. (A) A number of alveolar epithelial cells, evidently type 2 pneumocytes, express tenascin mRNA. Original magnification: ×120. (B) Dark-field illumination of the same section. Original magnification: ×120. (C ) High-power view of the bright-field illumination, demonstrating more closely the alveolar epithelial cells showing tenascin mRNA expression. Notice that the fusiformic cells inside the fibromyxoid lesion in this case show no signals for tenascin mRNA. In situ hybridization for tenascin mRNA. Original magnification: ×320.

View larger version (124K): [in this window] [in a new window]   View larger version (82K): [in this window] [in a new window]   View larger version (135K): [in this window] [in a new window]   Figure 3.   Tenascin mRNA expression in both type 2 pneumocytes and myofibroblasts in a lung biopsy taken from a patient with UIP. (A) In the middle there is a loose fibromyxoid lesion containing fusiformic cells. The fibromyxoid lesion is covered by regenerating alveolar epithelial cells, evidently type 2 pneumocytes. Original magnification: ×120. (B) Dark-field illumination of the same section. Original magnification: ×120. (C ) High-power view of the bright-field illumination of the same fibromyxoid lesion demonstrates a number of alveolar epithelial cells (long arrows) and fusiformic cells (short arrows) in the fibromyxoid material showing signals for tenascin mRNA. In situ hybridization for tenascin mRNA. Original magnification: ×320.

View larger version (107K): [in this window] [in a new window]   View larger version (124K): [in this window] [in a new window]   Figure 4.   Immunohistochemical staining of serial sections for the demonstration of the phenotype of the cells showing strong tenascin mRNA expression by in situ hybridization. (A) Cuboidal epithelial cells cover loose incorporating fibromyxoid material and are strongly cytokeratin positive. Morphology and cytokeratin positivity suggest that these cells are regenerating type 2 pneumocytes. Immunoperoxidase staining for human cytokeratin. Original magnification: ×200. (B) The cells in loose fibromyxoid material beneath the metaplastic squamous epithelium are -smooth muscle positive, a phenotype typical of lung myofibroblasts. Immunoperoxidase staining for -smooth muscle actin. Original magnification: ×200.

In a few cases bronchial metaplastic epithelium and alveolar macrophages showed weak tenascin mRNA expression (Figure 5) while inflammatory cells such as lymphocytes, plasma cells and neutrophils or smooth muscle cells showed no signals for tenascin mRNA.

View larger version (60K): [in this window] [in a new window]   Figure 5.   Alveolar macrophages show signals for tenascin mRNA. In situ hybridization for tenascin mRNA. Original magnification: ×320.

In normal-looking lung parenchyma, which served as a negative control, bronchiolar epithelium, type 1 and 2 pneumocytes, endothelial and smooth muscle cells of the blood vessels, and alveolar macrophages showed no tenascin mRNA expression.

Repeated hybridization experiments gave consistently similar and, thus, reproducible results.

	DISCUSSION

TOP ABSTRACT INTRODUCTION METHODS RESULTS DISCUSSION REFERENCES

In the present study we investigated which cells in UIP synthesize tenascin mRNA. For this purpose we applied an in situ hybridization technique in order to identify by light microscopy the cells and local tissue areas expressing tenascin mRNA and its context relative to the foci of tissue injuries in UIP. The phenotype of the cells expressing tenascin mRNA was confirmed by immunohistochemical staining of serial sections for -smooth muscle actin and human cytokeratin. Our results clearly demonstrate that tenascin mRNA is expressed in the loose, newly formed fibrotic foci by the myofibroblasts and the type 2 pneumocytes while the old fibrotic areas showed no tenascin expression. However, tenascin mRNA expression was clearly stronger and more frequent in myofibroblasts than in type 2 pneumocytes. The results are in good agreement with previous immunohistochemical studies peformed by us and others (13, 14).

Tenascin mRNA expression was seen especially in the areas termed "fibroblast foci" consisting of fibroblasts, which by immunohistochemical and ultrastructural studies have been demonstrated to differentiate into the myofibroblast-type cells expressing -smooth muscle actin, but not desmin, in UIP (18). It is interesting that transforming growth factor 1 (TGF-1) has been shown to induce both the myofibroblast-like differentiation in human synovial fibroblasts (19) and rat palatal fibroblasts (20), and increased tenascin expression and secretion in chick embryo fibroblasts (21).

In addition to the myofibroblasts of the fibroblast foci we also noticed less frequent tenascin mRNA expression in the newly formed epithelium consisting of the regenerating type 2 pneumocytes. This finding is in concordance with our previous immunoelectron microscopy study showing tenascin labeling in the regenerating type 2 pneumocytes in UIP (14). Findings supporting the idea that tenascin is also synthesized by the epithelial cells have been reported in cytokine (such as TGF-, tumor necrosis factor  [TNF-], and IFN-)-induced transformed bronchial epithelial cells (22, 23), in benign and malignant mesothelioma cells (24), in human epidermal keratinocytes during wound healing (25), in skin tumors (26), in lichen sclerosus (27), and in human benign and malignant breast lesions (28). In one study of human colon adenomas and carcinomas tenascin-C mRNA expression was demonstrated in myofibroblasts, and in vascular and epithelial cells (29).

Corrin and Dewar (30) suggest that the regenerating type 2 pneumocytes synthesize and secrete cytokines such as TGF-, and that they play a major role in the development of the fibrotic process in idiopathic interstitial pulmonary fibrosis. In the mural type of cryptogenic fibrosing alveolitis, i.e., usual interstitial pneumonia, hyperplastic type 2 pneumocytes have been shown by immunohistochemistry to express intracellular TGF-1 (31). In immunohistochemical and in situ hybridization studies, Zhang and coworkers (32) have demonstrated that rat myofibroblasts, fibroblasts, and eosinophils under bleomycin induction express increased amounts of TGF-1. In another study increased TGF-1 expression was localized mainly in fibroblasts and cells lining alveolar walls, probably representing type 2 pneumocytes in mouse lung after bleomycin induction (33). It is possible that in the early lesions of UIP, regenerating type 2 pneumocytes synthesize increased amounts of TGF-1 inducing both the type 2 pneumocytes to produce tenascin, and the surrounding fibroblasts to differentiate into the myofibroblast-like cells synthesizing and secreting tenascin, and perhaps also TGF-1, which may be part of the autocrine or paracrine regulating systems involved in the pathogenesis of UIP.

In conclusion, our results are in good agreement with previous studies showing that tenascin is actively synthesized at the early fibrotic lesions in UIP (13, 14). In addition, our results demonstrate that the interaction between the epithelium and the underlying connective tissue in the early lesions of UIP plays a significant role in tenascin synthesis and that myofibroblasts are mainly responsible for its synthesis in fibroblastic foci of UIP.