INTRODUCTION

TOP ABSTRACT INTRODUCTION METHODS RESULTS DISCUSSION REFERENCES

MY-1, a DNA-rich fraction extracted and purified from Mycobacterium bovis bacillus Calmette-Guérin (BCG), showed antitumor activity against various kinds of syngeneic tumors in mice (1). The antitumor mechanism of MY-1 is due to augmentation of natural killer (NK) cell activity and production of interferon (IFN)-/ and - in vivo (2). Also, MY-1 enhanced the NK activity of human peripheral blood mononuclear cells (PBMC) and induced production of IFN- in vitro (3). MY-1 contains 98% nucleic acid (70.0% DNA and 28.0% RNA), 0.15% protein, 0.27% sugar, and 0.1% lipid (1). Because MY-1 was not toxic in humans, an immunotherapeutic trial was conducted of MY-1 against human malignant tumors (4).

Human B cells have been shown to produce immunoglobulin (Ig)E following stimulation with interleukin (IL)-4 plus ligation of CD40 (5). Downregulation of IgE production was caused by IFN- secretion, mainly from T and NK cells. IFN- and IL-4 have antagonistic effects on Ig class switching, with IFN- inhibiting both IL-4 and T-cell-mediated human IgE production (6). In doing this, IFN- appears to act early to prevent switching, since it fails to suppress IgE secretion stimulated by CD40 ligation and IL-4 (7, 8).

These results prompted us to investigate whether MY-1 might be useful for treating allergic disease, as a downregulator of IgE in vivo. In this study, we examined whether MY-1 inhibits IgE production by human PBMC stimulated with IL-4 and monoclonal anti-CD40 antibody in vitro.

	METHODS

TOP ABSTRACT INTRODUCTION METHODS RESULTS DISCUSSION REFERENCES

Reagents

Human IL-4 was the gift of Ono Pharmaceutical Co. Ltd (Osaka, Japan) and monoclonal anti-CD40 antibody G28-5 was a gift from Dr. E. A. Clark of the University of Washington (Seattle, WA). Mouse monoclonal antihuman IgE antibodies (CIA-E-7.12 and CIA-E-4.15) were a gift from Dr. A. Saxon of the University of California, Los Angeles (Los Angeles, CA). Monoclonal antibody (mAb) directed against the IL-12 receptor (12R.44) was a gift from Dr. J. Gollob of the Dana-Farber Cancer Institute (Boston, MA) (9). MY-1 was extracted from Mycobacterium bovis BCG and was purified according to the method previously described (1). The following reagents were obtained commercially: alkaline phosphatase-labeled goat antihuman IgE (Kirkegaard and Perry Laboratories, Inc., Gaithersburg, MD), mouse monoclonal antihuman IFN- antibody (Biosource International, Camarillo, CA), mouse monoclonal antihuman IL-12 antibody (Genzyme, Cambridge, MA), an enzyme-linked immunosorbent assay (ELISA) kit for human IFN- (Biosource), an ELISA kit for human IL-12 (Biosource) and deoxyribonuclease (DNase) (Sigma Chemical Co., St. Louis, MO).

Cells and Cell Cultures

PBMC were isolated from healthy volunteers by centrifugation on Ficoll-Hypaque. PBMC (1 × 10⁶ cells/ml) were cultured for 14 d in complete medium prepared from RPMI-1640 medium supplemented with 2 mM glutamine, 100 U/ml penicillin, and 100 µg/ml streptomycin in the presence of IL-4 (100 U/ml) and monoclonal anti-CD40 antibody (0.1 µg/ml), which constitute optimal conditions for IgE production (10, 11).

Ig Measurements

Total IgE levels in the supernatants of stimulated cells were measured with an ELISA as previously described (10, 11). Briefly, microtiter plates were coated overnight at 4° C with two types of monoclonal antihuman IgE antibody (CIA-E-7.12 and CIA-E-4.15). After the wells were blocked with 0.1% gelatin for at least 1 h, 100 µl of culture supernatants was plated in duplicate wells and the plates were incubated for 2 h at room temperature. After washing, alkaline phosphatase- labeled IgE was added for detection. Absorbance was read at 405 nm with an ELISA reader (Bio-Tek Instruments, Burlingame, CA). The sensitivity of the assay for IgE subclasses was 0.1 ng/ml.

RNA Extraction and Reverse Transcription-Polymerase Chain Reaction

Total messenger RNA (mRNA) was obtained from stimulated and nonstimulated human PBMC through the use of Trizol reagent (GIBCO BRL, Gaithersburg, MD), a monophasic solution of phenol and guanidine isothiocyanate, which is an improvement over the single-step RNA isolation method (12, 13). RNA suspended in 0.1% diethylpyrocarbonate-treated water was digested with DNase I (Sigma) to remove contaminating DNA, and the digest was then extracted with phenol/chloroform, followed by precipitation of the RNA in ethanol. Total RNA (0.5 µg) was reverse-transcribed to complementary DNA (cDNA), using oligodeoxythymidine₁₅ (Boehringer-Mannheim, Indianapolis, IN) as primer and mouse Moloney leukemia virus reverse transcriptase (GIBCO BRL), under conditions recommended by the manufacturer.

All polymerase chain reaction (PCR) assays were done in 50-µl reaction volumes containing 50 mM KCl, 20 mM Tris-HCl (pH 8.4), 2.5 mM MgCl₂, 5% dimethylsulfoxide, 50 pM primer per reaction, and 2.5 U of Taq polymerase. For detection of  germline transcripts and  actin, PCR was conducted with 40 cycles of 94° C for 1 min, 65° C for 1 min, and 72° C for 1 min. The primer sequences were, for  germline transcripts I and C, respectively: AGGCTCCACTGCCCGGCACAGAAATA and GGACAAGTCCACGTCCATGA; and for  actin: TCACCAACTGGGACGACATGGAG and CTCCTTAATGTCACGCACGATTTC (12).

Detection of IFN- and IL-12

The concentrations of IFN- and IL-12 in the supernatants of PBMC stimulated with IL-4 and anti-CD40 mAb in the absence or presence of MY-1 were measured with ELISA kits, as previously described. Using protocols provided with the kits, IFN- and IL-12 can be measured in the range of 4 to 1,000 pg/ml and 7.8 to 500 pg/ml, respectively.

Statistics

Data are expressed as mean ± SEM. Statistical significance of effects on Ig production was determined with Wilcoxon's signed ranks test.

	RESULTS

TOP ABSTRACT INTRODUCTION METHODS RESULTS DISCUSSION REFERENCES

MY-1 Inhibited IgE Production by PBMC

PBMC were cultured for 14 d with IL-4 plus anti-CD40 mAb and various concentrations of MY-1, and the production of IgE was measured through ELISA. As shown in Figure 1, MY-1 inhibited the production of IgE induced by IL-4 plus anti-CD40 mAb in a dose-dependent manner. The maximum effect of MY-1 on suppression of IgE production was obtained at concentrations above 10 µg/ml (p < 0.01) in five independent preparations of PBMC. On the basis of these results, all subsequent experiments were done at an MY-1 concentration of 50 µg/ml. In 12 experiments, MY-1 (50 µg/ml) inhibited the production of IgE (72 ± 6% inhibition) induced by IL-4 plus anti-CD40 mAb without affecting production of IgA (9 ± 17% inhibition) (Table 1). MY-1 had no effect on the viability or cell number of PBMC, as shown by trypan blue dye exclusion (data not shown). To confirm that the DNA in MY-1 is crucial for the suppression of IgE production, MY-1 was treated with DNase for 5 h (1). The DNase digests of MY-1 lost the ability to inhibit IgE synthesis (data not shown).

View larger version (17K): [in this window] [in a new window]   Figure 1.   Effect of MY-1 on IgE production. Human PBMC from nonatopic healthy donors (n = 5) were cultured with IL-4 (100 U/ ml) and anti-CD40 mAb (0.1 µg/ml) for 14 d in the presence of various concentrations of MY-1. MY-1 inhibited IgE production in a dose-dependent manner. Data are expressed as mean ± SEM (*p < 0.05, p < 0.01, compared with IgE values for stimulation with IL-4 plus anti-CD40 mAb in the absence of MY-1).

MY-1 Enhanced Production of IFN- and IL-12 by PBMC

MY-1 has been shown to induce production of large amounts of IFN- by mouse spleen cells (2). This suggested the possibility that MY-1-induced IFN- blocked the production of IgE by human PBMC. We therefore measured the concentration of IFN- in the culture supernatants on Day 7 through ELISA. The level of IFN- in supernatants from PBMC stimulated with IL-4 plus anti-CD40 mAb in the presence of MY-1 (50 µg/ml) was higher than that in supernatants from PBMC stimulated in the absence of MY-1 (p < 0.01, Table 2).

IL-12 affects the induction of IFN- secretion by NK cells and T cells (14). The enhancement of IFN- production by MY-1 led us to speculate that MY-1 also enhances IL-12 production by PBMC. There was no significant difference in the IL-12 concentration in 36-h or 3-d culture supernatants from PBMC stimulated with IL-4 plus anti-CD40 mAb in the presence of MY-1 and that in the corresponding supernatants from PBMC stimulated in the absence of MY-1 (data not shown). The induction of IL-12 in PBMC stimulated with IL-4 plus anti-CD40 mAb in the presence of MY-1 for 7 d was greater than that in PBMC stimulated in the absence of MY-1 (p < 0.05, Table 2).

Inhibition of IgE Production by MY-1 Is Mediated by IFN- and IL-12

To confirm the involvement of IFN- in the decrease in IgE production caused by MY-1, we added anti-IFN- mAb (1 µg/ ml) to the culture system. As shown in Figure 2A, the addition of anti-IFN- mAb did not completely block the inhibition of IgE production by MY-1 in the presence of IL-4 plus anti-CD40 mAb (228 ± 118 ng/ml versus 431 ± 133 ng/ml, p < 0.05). Control mouse IgG had no effect on IgE production (data not shown).

View larger version (17K): [in this window] [in a new window]   View larger version (22K): [in this window] [in a new window]   Figure 2.   The addition of antibodies blocked the inhibition by MY-1 of IgE production stimulated with IL-4 plus anti-CD mAb. PBMC from nonatopic healthy donors (n = 5) were cultured with IL-4 (100 U/ml) and anti-CD40 mAb (0.1 µg/ml) for 14 d in the presence or absence of MY-1 and/or (A) anti-IFN- mAb (1 µg/ml), (B) anti-IL-12 mAb (10 µg/ml), (C ) anti-IL-12R mAb (10 µg/ml). (D) Both anti-IFN- mAb (1 µg/ml) and anti-IL-12 mAb (10 µg/ml) were added to the culture system for 14 d. Addition of the two antibodies partly blocked the inhibition of IgE production by MY-1. Representative data from three experiments are expressed (*p < 0.05).

To test whether IL-12 is involved in the mechanism of suppression of IgE production by MY-1, we added 10 µg/ml of anti-IL-12 mAb, a concentration that neutralizes the activity of approximately 5 ng of recombinant IL-12 to the culture system. The addition of anti-IL-12 mAb also partly blocked the inhibition of IgE production by MY-1, as did anti-IFN- mAb (144 ± 47 ng/ml versus 446 ± 111 ng/ml, p < 0.05) (Figure 2B). In five experiments, IgE production in the presence of anti- IL-12, MY-1, IL-4, and anti-CD40 mAb ranged from 58% to 75% of the IgE production induced by IL-4 plus anti-CD40 mAb. These results suggested that IL-12 participates in the MY-1-induced inhibition of IgE production by PBMC.

It is known that IL-12 exerts a pleiotropic effect via binding to the IL-12 receptor (9). Therefore, as an additional test, we added anti-IL-12R mAb to the culture system. As shown in Figure 2C, the addition of anti-IL-12R mAb (10 µg/ml) partly blocked the MY-1-mediated inhibition of IgE production by PBMC, as did anti-IL-12 mAb (260 ± 89 ng/ml versus 423 ± 119 ng/ml, p < 0.05). Thus, both IL-12 and IL-12R are involved in the MY-1-mediated suppression of IgE production. Although we analyzed the expression of a single low-affinity IL-12R subunit (IL-12R) with Western blotting and flow cytometry, using anti-IL-12R, mAb, we found no marked difference in IL-12R expression on PBMC stimulated with IL-4 plus anti-CD40 mAb in the presence and in the absence of MY-1 with either approach (data not shown).

We also evaluated the effect of adding anti-IFN- and anti-IL-12 mAbs to the culture system (Figure 2D). The combined addition of the anti-IFN- and anti-IL-12 antibodies blocked the MY-1-mediated inhibition of IgE production by PBMC, but not completely. These results suggested that IFN- and IL-12 were involved in the mechanism of suppression of MY-1-mediated inhibition of IgE production by human PBMC, but that other factors than IFN- and IL-12 may be involved in the inhibition by MY-1 of IgE production.

MY-1 Inhibited the Induction of  Germline Transcripts

Expression of germline transcripts from Ig heavy-chain loci precedes the occurrence of isotype switching, and is thought to play an important role in Ig class switching (15). We assessed the presence of  germline transcripts by using an RT-PCR-based strategy. As previously reported, stimulation with IL-4 reproducibly induced  germline transcripts from PBMC (7, 12) (Figure 3A). The amplified fragments of these  germline transcripts were cloned and identified as representing  germline transcripts by DNA sequence analysis (12). Stimulation with MY-1 suppressed the expression of  germline transcripts induced by IL-4 in all four experiments with independent PBMC preparations. Unstimulated PBMC showed no expression of  germline transcripts, as expected. Also, no  germline transcripts were found in PBMC stimulated with MY-1 alone (data not shown). To estimate the sensitivity of our PCR assay for  germline transcripts, we serially diluted total cellular RNA containing  germline transcripts as templates, and subjected the products to amplification via RT-PCR (12) (Figure 3B). The sensitivity of the technique was determined to be 10 pg of total cellular RNA. Semiquantitative analysis by comparison with the data shown in Figure 3B demonstrated that the combination of MY-1 and IL-4 reduced the production of  germline transcripts to almost one-tenth of that induced by IL-4 alone. There was no difference in the brightness of the amplified bands of -actin among the three RT-PCR product groups, as shown in Figure 3A (data not shown).

View larger version (31K): [in this window] [in a new window]   Figure 3.   MY-1 inhibited induction of  germline transcripts by IL-4. (A) Induction of  germline transcripts from PBMC was assessed by RT-PCR. PBMC were cultured for 7 d with medium, IL-4 (100 U/ ml) alone, or IL-4 (100 U/ml) plus MY-1 (50 µg/ml). Cells stimulated with IL-4 expressed the predicted 615-bp band for  germline transcripts. (B) Sensitivity of the RT-PCR assay for  germline transcripts. Total cellular RNA containing  germline transcripts was diluted and amplified as a template. The volumes of total RNA were 1 pg (lane 1), 10 pg (lane 2), 20 pg (lane 3), 100 pg (lane 4), 200 pg (lane 5), 1 ng (lane 6 ), and 2 ng (lane 7).

MY-1 Inhibited Spontaneous IgE Production by PBMC from Atopic Patients

We studied the effect of MY-1 on spontaneous IgE production by PBMC obtained from atopic patients. Serum IgE levels in atopic patients were over 1,000 U/ml. Spontaneous IgE production by PBMC from five atopic patients was 341 ± 123 ng/ml, whereas that by PBMC from nonatopic volunteers was less than 50 ng/ml. MY-1 inhibited spontaneous IgE production by PBMC from all atopic patients (p < 0.05 compared with IgE production in the absence of MY-1) (Table 3). MY-1 inhibited the spontaneous production of IgE by 53.9 ± 9.1%. In contrast, no inhibition by MY-1 of spontaneous production of IgA was found in PBMC from atopic patients (Table 3).

	DISCUSSION

TOP ABSTRACT INTRODUCTION METHODS RESULTS DISCUSSION REFERENCES

In this study we showed that MY-1 inhibited IgE production in vitro by PBMC stimulated with IL-4 plus anti-CD40 mAb. Also, MY-1 inhibited spontaneous IgE production in vitro by unstimulated PBMC from atopic patients. Concentrations of both IFN- and IL-12 in 7-d-culture supernatants were higher in the presence than in the absence of MY-1. The addition of anti-IFN- mAb, anti-IL-12 mAb, or anti-IL-12R mAb blocked the inhibition by MY-1 of IgE production, suggesting that both IFN- and IL-12 play critical roles in the mechanism of suppression of IgE production by MY-1.

Ig isotype switching is preceded by germline transcription (15). The importance of germline transcription was confirmed by gene-targeting experiments (16). In our study, MY-1 inhibited the induction of  germline transcripts in PBMC stimulated with IL-4. This result is in agreement with the evidence that IFN- suppressed the induction of  germline transcripts by IL-4 (8).

IL-12 can have multiple effects on the immune response, but its major role is to augment IFN- production (14, 17). IFN- itself has an important role in IL-12 production (18). IL-12 may suppress IgE synthesis by: (1) inducing production of IFN-, a known inhibitor of IgE synthesis; and (2) a novel mechanism that is IFN--independent (19). Our finding that the inhibition by MY-1 of IgE production was not completely blocked by addition of anti-IFN- mAb and anti-IL-12 mAb suggested that MY-1 may in part inhibit IgE production through a novel activity that is IFN--independent. Also, IL-8 was reported to antagonize IL-4-induced IgE production through a specific mechanism that does not involve IFN-, IFN-, or prostaglandin E₂ (20). In fact, a high level of IL-8 was in some cases detected in the supernatant of PBMC stimulated with MY-1, although no significant difference was detected in IL-8 concentration in the supernatant from PBMC in the presence and absence of MY-1 (data not shown).

It has long been known that Mycobacterium tuberculosis and its related products (e.g., BCG) inhibit IgE responses (21). Preadministration of dinitrophenol (DNP)-coupled M. tuberculosis inhibited the production of anti-DNP IgE antibody induced by DNP-ovalbumin in mice in vivo and in vitro (22). Delayed hypersensitivities to M. tuberculosis are closely associated with the incidence of asthma, serum IgE levels, and cytokine profiles biased toward the T-helper 1 (Th1) type (23). Erb and colleagues clearly showed that intranasal BCG infection of the lung suppressed the development of ovalbumin- induced airway eosinophilia (24).

Although the potential utility of recombinant IFN- (rIFN-) and rIL-12 in allergic disease have been suggested on the basis of a number of human and animal studies, systemic administration of rIFN- did not alter IgE production in patients with allergic rhinitis (25). Administration of rIL-12 has been associated with severe adverse effects (26). Local administration of rIFN- or rIL-12 by ultrasonic nebulization was shown to prevent allergic inflammation and secondarily increased titers of antigen-specific IgE without any adverse effects (27, 28). We showed that repeated intranasal allergen challenge and exposure to diesel exhaust particles induced local in vivo  isotype switching and IgE production (29). IgE values in nasal lavage fluid were associated with clinical outcome in the treatment of nasal allergy (30). These findings suggested that local administration of MY-1 may be a reasonable therapeutic approach for respiratory allergic diseases.

Gene vaccination is a powerful candidate method as an effective strategy for treating allergy in the 21st century. A plasmid backbone that delivers adjuvant and mitogenic activity via immunostimulatory sequences is a major unit in gene vaccination (2, 31). Yamamoto and colleagues demonstrated for the first time that MY-1 activated NK cells and enhanced IFN- production in mice (3). Additionally, they determined several sequences of 30-mer oligonucleotides that most potently augment the secretion of IFN- and NK activity (31). Most of these oligonucleotides included a CpG motif within a palindromic hexamer as an immunologically active sequence (31, 34). The CpG motif in MY-1 was crucial for the effect of MY-1 in inhibiting IgE production (S. Fujieda, unpublished data). Raz and coworkers showed that for clinical application, intradermal injection of plasmid DNA containing short immunostimulatory DNA sequences decreased antigen-specific IgE antibody production and induced Th1 immune responses in mice (32, 33).

MY-1 itself activates cell-mediated immunity and induces production of agents that suppress IgE production. Also, the coadministration of MY-1 with a conventional vaccine or vaccine-encoding expression vector has the possibility of augmenting antibody production and regulating allergic reactions in conventional immunotherapy (35). These results suggest that MY-1 may be an effective novel method of inducing protection against IgE-related allergic disorders.