help button home button
AJRCCM
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by MOHAMMED, K. A.
Right arrow Articles by ANTONY, V. B.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by MOHAMMED, K. A.
Right arrow Articles by ANTONY, V. B.
Am. J. Respir. Crit. Care Med., Volume 159, Number 5, May 1999, 1653-1659

Helper T Cell Type 1 and 2 Cytokines Regulate C-C Chemokine Expression in Mouse Pleural Mesothelial Cells

KAMAL A. MOHAMMED, NAJMUNNISA NASREEN, MELISSA J. WARD, and VEENA B. ANTONY

Division of Pulmonary and Critical Care Medicine, Department of Medicine, Veterans Affairs Medical Center, Indiana University School of Medicine, Indianapolis, Indiana

    ABSTRACT
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES

The recruitment of leukocytes to an area of injury or inflammation site is one of the most fundamental host defenses. Pulmonary tuberculosis is characterized by granulomatous inflammation with an extensive infiltration of mononuclear cells. In tuberculous pleurisy pleural mesothelial cells are exposed to mycobacteria in the pleural space. In this study we demonstrate that mouse pleural mesothelial cells (PMCs), when stimulated with BCG or IFN-gamma , produced MIP-1alpha and MCP-1 in vitro. IFN-gamma enhanced the BCG-mediated MIP-1alpha and MCP-1 expression in a concentration-dependent manner. The RT-PCR studies also confirmed that both BCG and IFN-gamma induce chemokine expression. IL-4 inhibited the BCG-mediated MIP-1alpha and MCP-1 expression in a concentration-dependent manner. The lower concentrations of IL-4 were ineffective; however, at higher concentrations, the inhibitory effect of IL-4 persisted for 24 h and decreased thereafter. BCG stimulation resulted in an increase of IFN-gamma and IL-4 receptors on PMCs. Our results demonstrate that Th1 and Th2 cytokines may regulate the C-C chemokine expression in PMCs and thus play a biologically important role in mononuclear cell recruitment to the pleural space.

    INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES

Tuberculosis remains the leading infectious cause of mortality in the world (1). Tuberculous pleural effusions occur in approximately 30% of patients with tuberculosis (2). Tuberculosis is a chronic mycobacterial infection caused by Mycobacterium tuberculosis (MTB); it is characterized morphologically by the formation of granulomas, compact organized collections of cells in infected tissues (3) that protect the host by sequestering invading microbes. MTB infection results in chronic inflammation characterized by the migration of mononuclear cells to the site of infection (4). Macrophage inflammatory protein 1alpha (MIP-1alpha ) and monocyte chemoattractant protein 1 (MCP-1) (C-C chemokines) are chemotactic for mononuclear cells. MIP-1alpha , a low molecular weight heparin-binding protein, is known to exert chemotactic and activating effects on phagocytic mononuclear cells (5). MCP-1 is an 8.7-kD protein, and has specific chemoattractant and activating activity for monocytes under inflammatory conditions (5).

Cytokines secreted by T cells after antigenic stimulation are the determinants of T cell function. On the basis of functional heterogeneity and their predominant cytokine secretion profiles, CD4+ helper T (Th) cells have been subdivided into Th1 and Th2 subpopulations. Th1 cells secrete interleukin 2 (IL-2), interferon gamma  (IFN-gamma ), and lymphotoxin and are responsible for the delayed-type hypersensitivity (DTH) reaction, whereas Th2 cells secrete IL-4, IL-5, IL-6, and IL-10 and render B cell help (6). Th1 and Th2 responses are reciprocally cross-regulated by IFN-gamma , which inhibits Th2 (7), and IL-10, which inhibits the Th1 response (8).

Mesothelial cells are metabolically active cells that line the pleura in a continuous monolayer. Chemokine synthesis is induced in various cells by inflammatory stimuli. Pleural mesothelial cells were observed to produce C-C chemokines on stimulation by inflammatory mediators (9, 10); however, the mechanisms of their regulation in MTB infection are still undefined. Studies have attempted to draw a correlation between disease resistance/susceptibility and Th1/Th2 responses, respectively, in parasitic infections (11). However, the extent to which the helper cytokine subsets regulate the inflammatory process is yet to be determined. To delineate whether Th1 and Th2 cytokines have any regulatory role in pleural mesothelial cell (PMC) chemokine expression we probed the effect of IFN-gamma and IL-4 on PMC chemokine expression in the presence of heat-killed bacillus Calmette-Guérin (BCG) in vitro. In the present study we demonstrate that when mouse pleural mesothelial cells are stimulated in vitro with heat-killed BCG, they express MIP-1alpha and MCP-1 mRNA and release the protein in a time-dependent manner. IFN-gamma has an additive effect on the BCG-stimulated C-C chemokine response in PMCs whereas IL-4 has an inhibitory effect. The BCG stimulation resulted in an increase in IFN-gamma and IL-4 receptors on the PMCs. These observations suggest that pleural mesothelial cell production of MIP-1alpha and MCP-1 is influenced by the Th1 and Th2 cytokines and thus the mononuclear cell migration into the pleural space may also be regulated by their effects.

    METHODS
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES

Animals, Antibodies, and Reagents

C57BL/6 female mice, 6 wk old, were purchased from Harlan Sprague Dawley (Indianapolis, IN) and used in this study. Also purchased were penicillin and streptomycin for cell culture, nonspecific rat IgG (Sigma Chemical Co., St. Louis, MO), rat anti-mouse IFN-gamma receptor antibody, rat anti-mouse IL-4 receptor antibody, goat anti-rat IgG conjugated to fluorescein isothiocyanate (FITC) (PharMingen, San Diego, CA), bacillus Calmette-Guérin (American Type Culture Collection [ATCC], Rockville, MD), F12K medium (GIBCO Laboratories, Grand Island, NY), and fetal bovine serum (FBS; Harlan Sprague Dawley).

Isolation and Characterization of Mouse Pleural Mesothelial Cells

PMCs were obtained by collagenase digestion of visceral and parietal pleura (12). The cells were suspended in F12K culture medium containing 10% FBS and a combination of penicillin (100 U/ml) and streptomycin (100 µg/ml). The cells were plated in 75-cm2 culture flasks and incubated overnight at 37° C in a 5% CO2 atmosphere. The next day nonadherent cells were removed. The medium was changed three times weekly thereafter. The cells grew to confluence in approximately 7-14 d. The mesothelial cells were characterized by the presence of classic cobblestone morphology (13), the absence of factor VIII antigen, and the presence of cytokeratin (14). All cells were used between the second and fourth passages.

Antigenic MIP-1alpha and MCP-1 Production In Vitro

To evaluate the concentration-dependent effect of IFN-gamma and IL-4 on PMC chemokine expression, PMCs (0.5 × 106/ml) were incubated in the presence of heat-killed BCG (1 × 106 CFU), along with varying concentrations of recombinant mouse IFN-gamma (50, 100, 250, 500, and 1,000 U/ml) and recombinant mouse IL-4 (5, 10, 20, 40, 80 ng/ml), for 24 h in serum-free medium at 37° C and 5% CO2. The PMC culture medium was collected for MIP-1alpha and MCP-1 estimation by enzyme-linked immunosorbent assay (ELISA), and the cells were saved for total RNA extraction for reverse transcriptase-mediated polymerase chain reaction (RT-PCR). PMCs were also incubated in serum-free medium, in the presence of BCG, BCG + IFN-gamma (500 U/ml), or BCG + IL-4 (40 ng/ml), at 37° C in 5% CO2. The cultures were terminated at different time points (6, 12, 24, and 48 h), supernatants were collected, and MIP-1alpha and MCP-1 levels were measured by sandwich ELISA.

Antigenic MIP-1alpha and MCP-1 Analysis in PMC Culture Fluids

MIP-1alpha and MCP-1 levels in the PMC culture supernatant were estimated by a sandwich ELISA (Quantikine; R&D Systems, Minneapolis, MN). The procedure followed was that suggested by the manufacturer. Briefly, 50-µl aliquots of PMC culture medium were added to 96-well microtiter plates, coated previously with anti-chemokine polyclonal antibody, and incubated at room temperature (RT) for 2 h. The wells were blocked with 2% bovine serum albumin (BSA) in phosphate-buffered saline (PBS). The chemokines were detected by incubation with peroxidase-conjugated MIP-1alpha - or MCP-1-specific antibodies at RT for 2 h. The microtiter plates were rinsed with PBS-Tween 20 (0.05% Tween 20 in PBS) and developed with substrate o-phenylenediamine (OPD) plus H2O2. The color intensity was measured at 450 nm with an ELISA reader. The minimum detectable levels of the assay were < 1.5 pg/ml for MIP-1alpha and < 2.0 pg/ml for MCP-1.

Isolation of RNA and Reverse Transcriptase-mediated Polymerase Chain Reaction

Total cellular RNA was isolated from PMCs by using Tri-reagent as reported earlier (10). One microgram of total RNA was reverse transcribed into cDNA. The first strand of cDNA was synthesized in a total volume of 20 µl in the presence of 5 mM MgCl2, 50 mM KCl, 10 mM Tris-HCl (pH 8.3), 1 mM dNTPs, RNase inhibitor (1 U/µl), 15 µM primer, and murine leukemia virus (MuLV) reverse transcriptase (2.5 U/µl; Perkin-Elmer Cetus, Norwalk, CT). The reverse transcription was conducted at 42° C for 15 min and the reaction was stopped by incubation at 99° C for 5 min.

The cDNA was then amplified using specific primers for mouse beta -actin as control. Primers for amplification were synthesized by the phosphoroamidite method with a Beckman (Fullerton, CA) 200 A synthesizer, and they were found to be specific for the chemokine tested and not for any other chemokine family member. The primers used were 5' GGTCGTACCACAGGCATTGTG 3' (sense) and 5' GCAATGCCTGGGTACATGGTG 3' (antisense) for beta -actin, 5' GCTTCTCCTACAGCCGGAAG 3' (sense) and 5' ACTCTCAGGCAATCAGTTCCAG 3' (antisense) for MIP-1alpha (GenBank accession no. M19382), and 5' GTCTCTGTCACGCTTCTGG 3' (sense) and 5' GATCTCTCTCTTGAGCTTGG 3' (antisense) for MCP-1 (GenBank accession no. M57441). The PCR was performed with 5 µl of RT product in a reaction mixture containing 2 mM MgCl2, 50 mM KCl, 10 mM Tris-HCl (pH 8.30), specific oligonucleotide primers (15 µM), and 2.5 U of Taq DNA polymerase (Perkin-Elmer Cetus). The samples were amplified in a thermal cycler (GeneAmp PCR system 9600; Perkin-Elmer Cetus), preheated for 90 s at 95° C. Amplification required 30 cycles, each cycle consisted of denaturation at 95° C for 15 s, primer annealing at 58° C for 30 s, and extension at 72° C for 30 s. (For MIP-1alpha the annealing and extension were carried out at 64° C for 30 s.) The amplification products were analyzed by agarose gel electrophoresis and their identities were initially confirmed after sequence determination.

Detection of IFN-gamma and IL-4 Receptor Expression by Flow Cytometry

The mesothelial cells were stimulated with heat-killed BCG (1 × 106 CFU/ml) for varying times at 37° C, in a 5% CO2 atmosphere. PMCs stimulated with lipopolysaccharide (LPS) served as positive control. The PMCs were trypsinized and washed three times in PBS with 2.5% BSA and 5 mM sodium azide and incubated for 45 min at 4° C, either in presence of rat anti-mouse IFN-gamma receptor (IFN-gamma R) or IL-4 receptor (IL-4R) monoclonal antibody (1 µg/106 cells) or rat IgG isotype. Cells were washed three times and incubated with goat anti-rat IgG- FITC conjugate to detect the antibody bound to the antigen. After incubations the cells were washed three times and fixed in 4% paraformaldehyde. The fluorescence associated with the cells was analyzed by flow cytometry using a FACStar (Becton Dickinson Immunocytometry Systems, Mountain View, CA). Fluorescence data were presented on a log scale and the relative fluorescence intensity was reported by comparing their light scatter characteristics with those of normal cells analyzed in the same experiment.

Statistical Analysis

The significance of differences between experimental and control group means was tested with a two-tailed Student's t test. The difference between group means was tested by Kruskal-Wallis one-way analysis of variance on ranks. A p value < 0.05 was considered significant.

    RESULTS
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES

Activated PMCs Release C-C Chemokines In Vitro

When PMCs (0.5 × 106/ml) were stimulated with BCG or with BCG + IFN-gamma , they released MIP-1alpha and MCP-1 antigenic protein in a time-dependent manner (Figures 1A and 1B). At all time points (6 to 48 h), stimulated mesothelial cells released significantly higher (p < 0.001) amounts of MIP-1alpha and MCP-1 when compared with unstimulated control cultures. The maximal response, seen at 24 h, plateaued thereafter. At all time points studied, cells stimulated with IFN-gamma and BCG together produced higher levels of chemokine than when stimulated with either IFN-gamma or BCG alone. Addition of IL-4 inhibited the BCG-induced chemokine response until 24 h; thereafter the inhibitory effect of IL-4 disappeared.


View larger version (18K):
[in this window]
[in a new window]
 
Figure 1.   Th1 and Th2 cytokine-mediated regulation of bacillus Calmette-Guérin (BCG)-induced MIP-1alpha , (A) and MCP-1 (B); production in pleural mesothelial cells. Data at each time point are means ± SE of six independent experiments. *p < 0.001, dagger p < 0.05 versus unstimulated cultures (control).

BCG Mediates C-C Chemokine mRNA Expression in PMCs

Figures 2A and 2B shows the expression of MIP-1alpha and MCP-1 mRNA in PMCs treated with BCG, BCG + IFN-gamma , or BCG + IL-4 as demonstrated by RT-PCR. BCG alone and BCG + IFN-gamma induced MIP-1alpha and MCP-1 expression. However, BCG and IFN-gamma together caused higher mRNA expression. Addition of recombinant mouse IL-4 to the BCG-stimulated cultures resulted in inhibition of the chemokine expression.


View larger version (41K):
[in this window]
[in a new window]
 
Figure 2.   IFN-gamma - and IL-4-mediated regulation of bacillus Calmette-Guérin (BCG)-induced expression of MIP-1alpha and MCP-1 mRNA in pleural mesothelial cells. (A and B) MIP-1alpha - and MCP-1-specific amplification products, respectively, on agarose gels stained with ethidium bromide. Results are representative of four independent experiments. beta -Actin served as positive control for the RT-PCR. Lane 1, molecular weight (HaeIII) markers; lane 2, unstimulated; lane 3, BCG exposed; lane 4, BCG + IFN-gamma exposed; lane 5, BCG + IL-4 exposed.

IFN-gamma Upregulates BCG-mediated C-C Chemokine Expression in a Concentration-dependent Manner

Figure 3A shows that IFN-gamma upregulated BCG-induced chemokine expression in mouse pleural mesothelial cells. IFN-gamma was ineffective at lower concentrations, but at higher concentrations IFN-gamma potentiated BCG-mediated expression of MIP-1alpha and MCP-1. IFN-gamma at 50 U/ml did not induce any significant enhancement; however, at 100 U/ml a marginal increase was noticed. With IFN-gamma at 250 U/ml the MIP-1alpha and MCP-1 response significantly increased to 7,496 ± 245 and 5,864 ± 167 pg/ml, respectively. The MIP-1alpha and MCP-1 response reached a maximum of 9,147 ± 208 and 6,959 ± 192 pg/ml, respectively, at 1,000 U/ml. The MIP-1alpha response was relatively higher than the MCP-1 response. IFN-gamma was more effective in enhancing the chemokine response at higher concentrations. MIP-1alpha and MCP-1 mRNA expression was also increased at higher concentrations of IFN-gamma (Figures 4A and 4B).


View larger version (16K):
[in this window]
[in a new window]
 
Figure 3.   Regulation of bacillus Calmette-Guérin (BCG)-induced MIP-1alpha and MCP-1 production by (A) IFN-gamma and (B) IL-4 in pleural mesothelial cells. PMCs were incubated in the presence of varying concentrations of either IFN-gamma or IL-4 along with BCG for 24 h. Results are means ± SE of six independent experiments. *p < 0.001, dagger p < 0.05 versus unstimulated cultures (control).


View larger version (42K):
[in this window]
[in a new window]
 
Figure 4.   Regulation of bacillus Calmette-Guérin (BCG)-induced MIP-1alpha and MCP-1 mRNA expression by IFN-gamma in pleural mesothelial cells. (A and B) MIP-1alpha - and MCP-1-specific amplification products, respectively, on agarose gels stained with ethidium bromide. Results are representative of four independent experiments. beta -Actin served as positive control for RT-PCR. Lane 1, molecular weight (HaeIII) markers; lane 2, BCG stimulated; lane 3, BCG + IFN-gamma (50 U/ml) stimulated; lane 4, BCG + IFN-gamma (100 U/ml) stimulated; lane 5, BCG + IFN-gamma (250 U/ml) stimulated; lane 6, BCG + IFN-gamma (500 U/ml) stimulated; lane 7, BCG + IFN-gamma (1,000 U/ml) stimulated.

IL-4 Downregulates BCG-mediated Chemokine Expression in PMCs in a Concentration-dependent Manner

BCG alone induced a maximum of 6,279 ± 151 and 5,029 ± 146 pg/ml of MIP-1alpha and MCP-1, respectively. IL-4 at low concentration (5 ng/ml) did not cause significant inhibition; however, at 10 ng/ml it significantly inhibited MIP-1alpha (4,987 ± 204 pg/ml) and MCP-1 (3,878 ± 185 pg/ml) production (Figure 3B). The MIP-1alpha and MCP-1 response further declined at an IL-4 concentration of 20 ng/ml. At a 40-ng/ml concentration of IL-4, the MIP-1alpha and MCP-1 response decreased to 1,489 ± 289 and 1,172 ± 178 pg/ml, respectively. The MIP-1alpha and MCP-1 response was further decreased to 1,108 ± 169 and 967 ± 195 pg/ml, respectively, at an 80-ng/ml concentration of IL-4. The difference between the inhibitory effect of 40- and 80-ng/ ml concentrations of IL-4 was insignificant. IL-4 affected BCG-induced chemokine mRNA expression in mouse PMCs (Figures 5A and 5B). At low concentrations IL-4 did not demonstrate any inhibition of PMC chemokine expression. However, at higher concentrations IL-4 inhibited BCG-mediated MIP-1alpha and MCP-1 mRNA expression.


View larger version (44K):
[in this window]
[in a new window]
 
Figure 5.   Regulation of bacillus Calmette-Guérin (BCG)-induced MIP-1alpha and MCP-1 mRNA expression by IL-4 in pleural mesothelial cells. (A and B) MIP-1alpha - and MCP-1-specific amplification products, respectively, on agarose gels stained with ethidium bromide. Results are representative of four independent experiments. beta -Actin served as positive control for RT-PCR. Lane 1, molecular weight (HaeIII) markers; lane 2, BCG-stimulated PMCs; lane 3, BCG + IL-4 (5 ng/ml) stimulated; lane 4, BCG + IL-4 (10 ng/ml) stimulated; lane 5, BCG + IL-4 (20 ng/ml) stimulated; lane 6, BCG + IL-4 (40 ng/ml) stimulated; lane 7, BCG + IL-4 (80 ng/ml) stimulated.

BCG Stimulates IFN-gamma and IL-4 Receptor Expression in PMCs

PMCs were stimulated with LPS to induce IFN-gamma and IL-4 receptor expression as a positive control for comparison with BCG-mediated receptor expression. Resting pleural mesothelial cells expressed low levels of IFN-gamma and IL-4 receptors. When PMCs were stimulated with BCG a significant increase in both IFN-gamma R and IL-4R was noted (Figure 6). BCG stimulated IFN-gamma R and IL-4R receptor expression in a time-dependent manner (data not shown). Maximum expression was noticed after 24 h, and the response plateaued thereafter.


View larger version (39K):
[in this window]
[in a new window]
 
Figure 6.   IFN-gamma and IL-4 receptor expression in PMCs after 24 h of exposure. Flow cytometric analysis of resting PMCs (serum-free media) and of BCG- or LPS-stimulated PMCs was done with a control nonbinding antibody (isotype), a monoclonal anti-IFN-gamma receptor (IFN-gamma R) antibody, or an anti-IL-4 receptor (IL-4R) antibody. The horizontal axis measures the surface density of the antigen on a log scale; the vertical axis measures the cell number.

    DISCUSSION
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES

Pleuropulmonary tuberculosis is the most common infectious cause of pleural effusions in several parts of the world. The pleural space is lined with a monolayer of mesothelial cells and PMCs are the first cells to encounter organisms invading the pleural space. Mycobacterial infection results in granulomatous inflammation with a predominant accumulation of mononuclear phagocytes (4). Pleural effusions due to tuberculosis are characterized by the presence of mononuclear cells (15). MIP-1alpha and MCP-1 are chemotactic for mononuclear phagocytes (5). The recruitment of monocytes to the site of inflammation is crucial to the perpetuation of the inflammatory response. Several locally generated chemokines are responsible for the movement of inflammatory cells from the vascular compartment into the pleural space. In earlier studies we demonstrated that stimulated pleural mesothelial cells release C-C and C-X-C chemokines (9, 10). The chemokines released by PMCs are responsible in part for initiating the inflammatory response that recruits mononuclear cells to the pleural space. The current investigation demonstrates in vitro that Th1- derived cytokine IFN-gamma and the Th2-derived cytokine IL-4 have a regulatory role in MIP-1alpha and MCP-1 expression in mouse pleural mesothelial cells. Heat-killed mycobacteria were found to enhance MIP-1alpha and MCP-1 expression in mouse PMCs, and the addition of IL-4 resulted in inhibition of this response. The inhibitory response of IL-4 was concentration dependent. IL-4 at lower concentrations was not effective; however, at 20 ng/ml it significantly inhibited BCG-mediated chemokine expression. The chemokine response was increased further when PMCs were incubated in presence of IFN-gamma together with BCG. IFN-gamma potentiated the chemokine response in a concentration-dependent manner. BCG also induced IFN-gamma and IL-4 receptor expression on PMCs.

Th1 and Th2 cells are known to develop from a common precursor and if the primary stimulation of CD4+ cells is accompanied by IL-4, a Th2 cytokine switch is elicited (16); on the other hand, the presence of IL-12 favors the Th1 cell phenotype (17). Evidence suggests that antigen priming in a large population of lymphocytes results into three predominant types of cells: Th1, Th2, and a third type, Th0, which contributes by providing lymphokines of both mature subsets (18). Mycobacterial antigens elicits Th1 effector function (19); in contrast, HIV infection leads to a shift from the Th1 to Th2 cytokine response (20).

C-C chemokines are recognized as important mediators in a variety of inflammatory states (5). Mesothelial cells, on activation, produce C-C chemokines (9, 10). The mechanisms whereby the pleural mesothelial responses are regulated in pleural tuberculosis remain unknown. When PMCs were stimulated in vitro with PCG they produced MIP-1alpha and MCP-1 in a time-dependent manner (Figures 1A and 1B). These observations were further supported by enhanced chemokine mRNA expression as demonstrated by RT-PCR. The chemokine release was detectable as early as 6 h and lasted for up to 48 h. Phagocytosis of M. tuberculosis induced MCP-1 (21) and IL-8 (22) expression in monocytic cells. Mycobacterium tuberculosis induced MIP-1alpha and MCP-1 production in monocytes and alveolar macrophages (23), and C-C and C-X-C chemokine levels were elevated in the bronchoalveolar fluid of patients with tuberculosis (24). Besides, the infection of murine macrophages with M. tuberculosis was found to induce chemokine expression (25), which suggests that mycobacteria are capable of inducing chemokine expression.

IFN-gamma is a pleiotropic cytokine secreted by natural killer (NK) and T cells, and it has been found to be essential for the development of protective cell-mediated immunity to tuberculous mycobacterial pathogens. When PMCs were incubated with IFN-gamma along with BCG an additive effect was noticed in the chemokine response. The additive effect of IFN-gamma was concentration dependent (Figure 3A). Higher concentrations of IFN-gamma were more effective in potentiating the chemokine response. This enhanced response was also confirmed at the mRNA level by RT-PCR studies (Figures 4A and 4B). In a similar study, IFN-gamma was found to potentiate the C-C and C-X-C chemokine expression in peripheral blood monocytes and neutrophils (26). At the site of M. tuberculosis infection, elicited mononuclear cells can become activated and synthesize a number of potent mediators with autocrine and paracrine effector activities (27). Mycobacterium tuberculosis stimulated IFN-gamma production in human peripheral blood lymphocytes (19). IFN-gamma was detected in pleural fluid from patients with tuberculosis and IFN-gamma was selectively concentrated 5- to 30-fold in the pleural fluid, compared with blood from the same patients (27). This indicates that in tuberculous pleuritis the IFN-gamma levels may exceed physiological levels in the pleural compartment. Besides, M. tuberculosis cell wall components were found to enhance IFN-gamma production in pleural fluid mononuclear cells (19). Thus IFN-gamma released in response to mycobacterial infection may also amplify the PMC production of MIP-1alpha and MCP-1.

In our studies, addition of IL-4 to BCG-stimulated PMC cultures resulted in a lower yield of chemokines when compared with PMC cultures that were stimulated with BCG alone (Figure 3B). RT-PCR studies also reveal a clear decrease in specific mRNA. Studies have demonstrated that IL-4 destroys the mRNA of inflammatory cytokines at the posttranscriptional level (28). Our results by RT-PCR also suggest that IL-4 inhibits MIP-1alpha and MCP-1 mRNA expression in a concentration-dependent manner (Figures 5A and 5B). The lower concentration of IL-4 was ineffective in decreasing the chemokine mRNA. The suppressive effect of IL-4 was time dependent, and at 48 h IL-4 lost its inhibitory effect. Other studies have demonstrated that IL-4 downregulates IL-1beta and TNF-alpha in peripheral blood monocytes in inflammatory bowel disease in a dose-dependent manner (29). In human synovial fibroblats IL-4 downregulated and IFN-gamma enhanced the TNF-alpha - and IL-beta -induced expression of RANTES (30). Besides, IFN-gamma enhanced MCP-1 expression in renal cortical epithelial cells (31), and in neutrophils it enhanced the LPS- mediated expression of MIP-1alpha , MIP-beta , and IL-8 (26). Thus, in several cell types other than PMCs, Th1- and Th2-derived cytokines were found to regulate chemokine expression.

In general, the IFN-gamma receptor is expressed on cell surfaces at low levels; however, certain tumor cell lines such as EL-4 exhibit high levels of IFN-gamma receptors without stimulation. To delineate the mode of action of IFN-gamma and IL-4 on BCG- induced chemokine expression, we examined their respective functional receptor expression on PMCs. Flow cytometry studies demonstrated that resting PMCs express moderate amounts of IFN-gamma and IL-4 receptors. When PMCs were stimulated with BCG, both IFN-gamma and IL-4 receptor expression was increased significantly, suggesting that BCG, apart from potentiating MIP-1alpha and MCP-1, was also inducing cytokine receptor expression (Figure 6). Other bacteria, such as Staphylococcus aureus, have been reported to increase IL-4 receptor expression in B cells (32). In mice, the lack of a functional IFN-gamma receptor resulted in an altered cytokine (TNF-alpha , IL-1alpha , and IL-6) response to BCG infection, and the IFN-gamma receptor was found to be essential for the recovery of mice from BCG infection (33). IFN-gamma enhances IL-4 receptor expression in a murine macrophage cell line and bone marrow-derived macrophages (34), and IL-4 enhances IL-4 receptor expression in resting T and B cells (35). Once the cytokines bind to their respective receptors they are rapidly internalized. As the PMCs express both IFN-gamma and IL-4 receptors in significant numbers, it may be construed that IFN-gamma and IL-4, by binding to their receptors on PMCs, are modulating the chemokine expression in PMCs. However, at the later time period (48 h), although the IL-4 receptor was still present, the inhibitory effect of IL-4 was diminished as indicated by protein and mRNA levels. This could be due to inactivation of IL-4 during the longer incubation period in vitro, or it may be due to its rapid metabolism in cells.

The significance of this study is that in tuberculous pleuritis mycobacteria induce chemokine release from the mesothelium, resulting in the initiation of pleural inflammation and subsequent recruitment of mononuclear phagocytes to the pleural space. Pleural mesothelial cell expression of MIP-1alpha and MCP-1 in mycobacterial infection is regulated, in part, by Th1 and Th2 cytokines and the progress of the pleural infection is likely to depend on the relative levels of Th1 and Th2 cytokines present in the milieu of the pleural space.

    Footnotes

Correspondence and requests for reprints should be addressed to Veena B. Antony, M.D., Veterans Affairs Medical Center, 1481 West 10th Street, 111-P, Indianapolis, IN 46202. E-mail: vantony{at}iupui.edu.

(Received in original form October 5, 1998 and in revised form December 15, 1998).

Acknowledgments: The authors acknowledge the help of Diana L. Baxter (Medical Media, Veterans Affairs Medical Center) for photographic work.

Supported in part by grants NIH RO1 AI 37454-03 and NIH RO1 AI 41877-02 from the National Institutes of Health.

    References
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES

1. Bloom, B. R., and C. M. Murray. 1992. Tuberculosis: commentary on re-emergent killer. Science 25: 1055-1064 .

2. Ferrer Sancho, J. 1996. Pleural tuberculosis: incidence, pathogenesis, diagnosis, and treatment. Curr. Opin. Pulm. Med. 2: 327-334 . [Medline]

3. Dannenberg, A. M., Jr., and G. A. W. Rock. 1994. Pathogenesis of pulmonary tuberculosis: an interplay of tissue damaging and macrophage-activating immune responses---dual mechanisms that control bacillary multiplication. In B. R. Bloom, editor. Tuberculosis: Pathogenesis, Control and Protection. ASM Press, Washington DC. 459-484.

4. Sibille, Y., and H. Y. Reynolds. 1990. Macrophages and polymorphonuclear neutrophils in lung defense and injury. Am. Rev. Respir. Dis. 141: 471-501 [Medline].

5. Oppenheim, J. J., C. O. Zachariae, N. Mukaida, and K. Matsushima. 1991. Properties of the novel proinflammatory supergene intercrine cytokine family. Annu. Rev. Immunol. 9: 617-648 [Medline].

6. Mosman, T. R., and R. L. Coffman. 1987. Two types of mouse helper T cell clone: implications for immune regulations. Immunol. Today 8: 223-227 .

7. Gajewski, T. F., and F. W. Fitch. 1988. Anti-proliferative effect of IFN-gamma in immune regulation: I. IFN-gamma inhibits the proliferation of Th2 but not Th1 murine helper T lymphocyte clones. J. Immunol. 140: 4245-4252 [Abstract].

8. Mosman, T. R., and K. W. Morre. 1991. The role of IL-10 in cross regulations of Th1 and Th2 responses. Immunoparasitol. Today 12: A49-A53 .

9. Antony, V. B., J. W. Hott, S. L. Kunkel, S. W. Godbey, M. D. Burdick, and R. M. Strieter. 1995. Pleural mesothelial cell expression of C-C (monocyte chemotactic peptide) and C-X-C (interleukin-8) chemokines. Am. J. Repsir. Cell Mol. Biol. 12: 581-588 .

10. Nasreen, N., D. L. Hartman, K. A. Mohammed, and V. B. Antony. 1998. Talc induced expression of C-C and C-X-C chemokines and intercellular adhesion molecule-1 in mesothelial cells. Am. J. Respir. Crit. Care Med. 158: 971-978 [Abstract/Free Full Text].

11. Scott, P., P. Natovitz, R. L. Coffman, E. Pearce, and A. Sher. 1988. Immunoregulation of cutaneous leishmaniasis: T-cell lines that transfer protective immunity or exacerbation belong to different T helper subsets and respond to distinct parasite antigens. J. Exp. Med. 168: 1675-1684 [Abstract/Free Full Text].

12. Bermudez, E., J. Everitt, and C. Walker. 1990. Expression of growth factor and growth factor receptor RNA in rat pleural mesothelial cells in culture. Exp. Cell Res. 190: 91-98 [Medline].

13. Andrews, P. M., and K. R. Porter. 1973. The ultrastructural morphology and possible functional significance of mesothelial microvilli. Anat. Rec. 177: 409-426 [Medline].

14. Connell, N. D., and J. G. Rheinwald. 1983. Regulation of cytoskeleton in mesothelial cells: reversible loss of keratin and increase in vimentin during rapid growth in culture. Cell 34: 245-253 [Medline].

15. Kamholz, S. L. 1996. Pleural tuberculosis. In W. N. Rom and S. M. Garay, editors. Tuberculosis. Little, Brown & Co., Boston. 483-491.

16. Trinchieri, G.. 1993. Interleukin-12 and its role in the generation of Th1 cells. Immunol. Today 14: 335-338 [Medline].

17. Swain, S. L., A. D. Weinberg, M. English, and G. Huston. 1994. IL-4 directs the development of Th-2 like helper effectors. J. Immunol. 145: 3796-3806 [Abstract].

18. Manetti, R., P. Parronchi, M. G. Guidizi, M. P. Piccinni, E. Maggi, G. Trinchieri, and S. Romagnani. 1993. Natural killer cell stimulatory factor interleukin-12 induces T helper type-1 (Th1)-specific immune responses and inhibits the development of IL-4 producing Th cells. J. Exp. Med. 177: 1199-1204 [Abstract/Free Full Text].

19. Robinson, D. S., S. Ying, I. K. Taylor, A. Wangoo, D. M. Mitchell, A. B. Kay, Q. Hamid, and R. J. Shaw. 1994. Evidence for a Th1-like bronchoalveolar T-cell subset and predominance of interferon-gamma gene activation in pulmonary tuberculosis. Am. J. Respir. Crit. Care Med. 149: 989-993 [Abstract].

20. Klein, S. A., J. M. Dobmeyer, T. S. Dobmeyer, M. Pape, O. G. Ottmann, E. B. Helm, D. Hoelzer, and R. Rossol. 1997. Demonstration of the Th1 to Th2 cytokine shift during the course of HIV-1 infection using cytoplasmic cytokine detection on single cell level by flow cytometry. AIDS 11: 1111-1118 [Medline].

21. Friedland, J. S., R. J. Shattock, and G. E. Griffin. 1993. Phagocytosis of Mycobacterium tuberculosis or particulate stimuli by human monocytic cells induces equivalent monocyte chemotactic protein-1 gene expression. Cytokine 5: 150-156 [Medline].

22. Friedland, J. S., D. G. Remick, R. Shattock, and G. E. Griffin. 1992. Secretion of interleukin-8 following phagocytosis of Mycobacterium tuberculosis by human monocyte cell lines. Eur. J. Immunol. 22: 1373-1378 [Medline].

23. Sadek, M. I., E. Sada, Z. Toossi, S. K. Schwander, and E. A. Rich. 1998. Chemokines induced by infection of mononuclear phagocytes with mycobacteria and present in lung alveoli during active pulmonary tuberculosis. Am. J. Respir. Cell Mol. Biol. 19: 513-521 [Abstract/Free Full Text].

24. Kurashima, K., N. Mukaida, M. Fujimura, M. Yasui, Y. Nakazumi, T. Matsuda, and K. Matsushima. 1997. Elevated chemokine levels in bronchoalveolar lavage fluid in tuberculosis patients. Am. J. Respir. Crit. Care Med. 155: 1474-1477 [Abstract].

25. Rhoades, E. R., A. M. Cooper, and I. M. Orme. 1995. Chemokine response in mice infected with Mycobacterium tuberculosis. Infect. Immun. 63: 3871-3877 [Abstract].

26. Kunkel, S. L.. 1996. Th1 and Th2 type cytokines regulate chemokine expression. Biol. Signals 5: 197-202 [Medline].

27. Barnes, P. F., S. J. Fong, P. J. Brennan, P. E. Twomey, A. Mazumdar, and R. L. Modlin. 1990. Local production of tumor necrosis factor and IFN-gamma in tuberculous pleuritis. J. Immunol. 145: 149-154 [Abstract].

28. Wang, P., P. Wu, M. I. Siegel, R. W. Egan, and M. M. Billah. 1995. Interleukin (IL)-10 inhibits nuclear factor kappa B (NF-kappa B) activation in human monocytes. IL-10 and IL-4 suppress cytokines synthesis by different mechanisms. J. Biol. Chem. 270: 9558-9563 [Abstract/Free Full Text].

29. Schreiber, S., T. Heinig, U. Panzer, R. Reinking, A. Bouchard, P. D. Stahl, and A. Raedler. 1995. Impaired response of activated mononuclear phagocytes to interleukin-4 in inflammatory bowel disease. Gastroenterology 108: 21-33 [Medline].

30. Rathnaswami, P., M. Hachicha, T. J. Schall, and S. R. McColl. 1993. Expression of the cytokines RANTES in human rheumatoid synovial fibroblasts. Differential regulation of RANTES and interleukin-8 genes by inflammatory cytokines. J. Biol. Chem. 268: 5834-5839 [Abstract/Free Full Text].

31. Schmouder, R. L., R. M. Strieter, and S. L. Kunkel. 1993. Interferon-gamma regulation of human renal cortical epithelial cell-derived monocyte chemotactic peptide-1. Kidney Int. 44: 43-49 [Medline].

32. Degiannis, D., N. Hornung, D. Luke-Gustites, J. Raskova, and K. Raska Jr.. 1993. IL-4 receptor expression by SAC-activated B-lymphocytes: its role in B-cell proliferation and the effect of cylcosporine, prednisolone and verapamil. Int. J. Immunopharmacol. 15: 829-832 [Medline].

33. Kamijo, R., J. Le, D. Shapiro, E. A. Havell, S. Huang, M. Aguet, M. Bosland, and J. Vilcek. 1993. Mice that lack the interferon-gamma receptor have profoundly altered responses to infection with bacillus Calmette-Guérin and subsequent challenge with lipopolysaccharide. J. Exp. Med. 178: 1435-1440 [Abstract/Free Full Text].

34. Feldman, G. M., and D. S. Finbloom. 1990. Induction and regulation of IL-4 receptor expression on murine macrophage cell lines and bone marrow-derived macrophages by IFN-gamma . J. Immunol. 145: 857-859 .

35. Renz, H., J. Dominco, and E. W. Gelfand. 1991. IL-4 dependent up-regulation of IL-4 receptor expression in murine T and B cells. J. Immunol. 146: 3049-3055 [Abstract].





This article has been cited by other articles:


Home page
Infect. Immun.Home page
M. C. Souza, C. Penido, M. F. S. Costa, and M. G. Henriques
Mechanisms of T-Lymphocyte Accumulation during Experimental Pleural Infection Induced by Mycobacterium bovis BCG
Infect. Immun., December 1, 2008; 76(12): 5686 - 5693.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
T. Hussain, N. Nasreen, Y. Lai, B. F. Bellew, V. B. Antony, and K. A. Mohammed
Innate immune responses in murine pleural mesothelial cells: Toll-like receptor-2 dependent induction of {beta}-defensin-2 by staphylococcal peptidoglycan
Am J Physiol Lung Cell Mol Physiol, September 1, 2008; 295(3): L461 - L470.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Respir. Crit. Care Med.Home page
J. F. Cailhier, D. A. Sawatzky, T. Kipari, K. Houlberg, D. Walbaum, S. Watson, R. A. Lang, S. Clay, D. Kluth, J. Savill, et al.
Resident Pleural Macrophages Are Key Orchestrators of Neutrophil Recruitment in Pleural Inflammation
Am. J. Respir. Crit. Care Med., March 1, 2006; 173(5): 540 - 547.
[Abstract] [Full Text] [PDF]


Home page
ChestHome page
M. Okamoto, Y. Hasegawa, T. Hara, N. Hashimoto, K. Imaizumi, K. Shimokata, and T. Kawabe
T-Helper Type 1/T-Helper Type 2 Balance in Malignant Pleural Effusions Compared to Tuberculous Pleural Effusions
Chest, December 1, 2005; 128(6): 4030 - 4035.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
C. Penido, A. Vieira-de-Abreu, M. T. Bozza, H. C. Castro-Faria-Neto, and P. T. Bozza
Role of Monocyte Chemotactic Protein-1/CC Chemokine Ligand 2 on {gamma}{delta} T Lymphocyte Trafficking during Inflammation Induced by Lipopolysaccharide or Mycobacterium bovis Bacille Calmette-Guerin
J. Immunol., December 15, 2003; 171(12): 6788 - 6794.
[Abstract] [Full Text] [PDF]


Home page
Infect. Immun.Home page
S. Babayan, M.-N. Ungeheuer, C. Martin, T. Attout, E. Belnoue, G. Snounou, L. Renia, M. Korenaga, and O. Bain
Resistance and Susceptibility to Filarial Infection with Litomosoides sigmodontis Are Associated with Early Differences in Parasite Development and in Localized Immune Reactions
Infect. Immun., December 1, 2003; 71(12): 6820 - 6829.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Respir. Cell Mol. Bio.Home page
H. Katayama, A. Yokoyama, N. Kohno, K. Sakai, K. Hiwada, H. Yamada, and K. Hirai
Production of Eosinophilic Chemokines by Normal Pleural Mesothelial Cells
Am. J. Respir. Cell Mol. Biol., April 1, 2002; 26(4): 398 - 403.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Respir. Crit. Care Med.Home page
K. Oshikawa, K. Yanagisawa, S. Ohno, S.-I. Tominaga, and Y. Sugiyama
Expression of ST2 in Helper T Lymphocytes of Malignant Pleural Effusions
Am. J. Respir. Crit. Care Med., April 1, 2002; 165(7): 1005 - 1009.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Respir. Cell Mol. Bio.Home page
C. Penido, H. C. Castro-Faria-Neto, A. Vieira-de-Abreu, R. T. Figueiredo, A. Pelled, M. A. Martins, P. J. Jose, T. J. Williams, and P. T. Bozza
LPS Induces Eosinophil Migration via CCR3 Signaling Through a Mechanism Independent of RANTES and Eotaxin
Am. J. Respir. Cell Mol. Biol., December 1, 2001; 25(6): 707 - 716.
[Abstract] [Full Text] [PDF]


Home page
ChestHome page
D. Jones, T. Lieb, M. Narita, E. S. Hollender, A. E. Pitchenik, and D. Ashkin
Mesothelial Cells in Tuberculous Pleural Effusions of HIV-Infected Patients*
Chest, January 1, 2000; 117(1): 289 - 291.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by MOHAMMED, K. A.
Right arrow Articles by ANTONY, V. B.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by MOHAMMED, K. A.
Right arrow Articles by ANTONY, V. B.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Proc. Am. Thorac. Soc. Am. J. Respir. Cell Mol. Biol.
Copyright © 1999 American Thoracic Society