Am. J. Respir. Crit. Care Med.,
Volume 159, Number 5, May 1999, 1624-1628
1-Antitrypsin Genotypes and the Acute-phase
Response to Open Heart Surgery
ANDREW J.
SANDFORD,
TABASSUM
CHAGANI,
JOHN J.
SPINELLI,
and
PETER D.
PARÉ
University of British Columbia Pulmonary Research Laboratory, St. Paul's Hospital, Vancouver; Department of Health Care
and Epidemiology, University of British Columbia, Vancouver; and Health Research Centre, St. Paul's Hospital, Vancouver,
British Columbia, Canada
 |
ABSTRACT |
A mutation in the 3' region of the 
1-antitrypsin (1-AT) gene is associated with chronic obstructive
pulmonary disease (COPD). However, the reason for this association is unknown. The mutation does
not cause 1-AT deficiency but in vitro studies suggest it could attenuate the rise in 1-AT levels during the acute-phase response. Therefore, we sought an association between the 3' mutation and a reduced rise in 1-AT levels following open heart surgery, a known trigger of the acute-phase response.
We genotyped 198 patients and identified 31 with the 3' mutation. Their 1-AT rise was compared
with the remaining 167 wild type subjects. Multiple linear regression analysis identified sex, urgency
of surgery, and surgical pump time as significant independent predictors of the rise in 1-AT. However, we found no association between the 3' mutation and a reduced rise in 1-AT. We also identified patients who had the Z and S 1-AT deficiency mutations and found a significant reduction in the
rise in 1-AT in individuals who were heterozygous for the Z mutation compared with wild type subjects. However, when the rise in 1-AT was expressed as a percentage of the basal level, there was no
significant difference between individuals who had the S or Z mutations compared with wild type.
Therefore, an attenuated 1-AT acute-phase response does not explain previous associations of the 3'
and S mutations with COPD. However, a deficient acute-phase rise in 1-AT may contribute to the
susceptibility to COPD associated with the Z mutation.
| |
INTRODUCTION |
1-Antitrypsin (1-AT) provides the major protection to the
lung from digestion by neutrophil elastase. Mutations that result in low levels of 1-AT leave the lung vulnerable to proteases and the individual susceptible to the development of
chronic obstructive pulmonary disease (COPD). Previous
studies have shown that a point mutation in the 3' region of
the 1-AT gene is associated with COPD (1, 2), and that individuals who are homozygous for this mutation develop airway
obstruction at an early age (2). The mutation is a G
A transition at position 1,236 in the 1-AT gene sequence (3), and is
present in approximately 5% of white individuals (1, 2). Because the mutation is not in the coding sequence of the gene
and has not been linked to 1-AT deficiency, the reason for its
association with COPD remains unclear.
It has been suggested that the 3' mutation affects the increase in 1-AT expression that occurs during the acute-phase
response (1). The acute-phase response is a coordinated series
of systemic physiological and biochemical changes that occur
in response to tissue injury (4). Triggers of an acute-phase response include infections, surgical trauma, and neoplasms.
During the response, alterations in hepatic protein synthesis
result in changes in the serum levels of several proteins,
known as acute-phase proteins. The major regulator of acute-phase protein synthesis is interleukin-6 (IL-6) (5), but a subset of plasma proteins is also affected by tumor necrosis factor-alpha (TNF-) (8) and interleukin-1 (IL-1) (9). 1-AT is an
acute-phase protein whose serum levels increase by 100 to
200% in response to host injury (10). IL-6 has been shown
to induce an increase in 1-AT messenger RNA (mRNA) levels and protein synthesis in vitro (6, 13), although TNF- and
IL-1 have no effect on transcription (8, 9). IL-6 mediates its effect on 1-AT gene expression via the transcription factors nuclear factor-IL-6 and nuclear factor-IL-6
(14, 15) that bind to
IL-6-responsive elements in the 1-AT promoter.
The 1-AT gene 3' region contains sequence motifs for
DNA binding proteins (3), and binds several nuclear factors in
vitro (16). Furthermore, the 3' mutation is less effective at increasing reporter gene expression than the wild type (16).
Binding of transcription factors to the region containing the 3'
mutation may affect binding to adjacent sites. There is a sequence motif close to the 3' mutation site that may interact
with factors stimulated by IL-6. Further in vitro experiments
demonstrated that IL-6-induced upregulation of gene expression is diminished by the presence of the 3' mutation (17).
Therefore, the 3' mutation may be associated with COPD because it results in a deficient upregulation of 1-AT gene expression in response to IL-6 during the acute-phase response.
Regulation of the acute-phase response could be an important factor in the pathogenesis of COPD because of the need
to elevate levels of 1-AT in response to cigarette smoke or
during exacerbations caused by pulmonary infections. Thus,
individuals with the 3' mutation may have normal baseline
levels of 1-AT but their lungs would be more vulnerable to
neutrophil elastase and other proteolytic enzymes during periods when the greatest amount of tissue damage occurs.
We have investigated the rise in 1-AT serum levels after
open heart surgery to determine whether the 3' mutation is associated with altered 1-AT gene expression during the acute-phase response. Surgery is a predictable traumatic event that
is known to elicit an acute-phase response of 1-AT and other
serum proteins (10). Surgery is also known to increase the
concentration of IL-6 in the serum (18). Concentrations of 1-AT in the blood peak approximately 4 d after surgery. Blood
was drawn from 198 patients before and 4 or 5 d after open
heart surgery for measurement of 1-AT concentrations. The
subjects were genotyped for the 3' mutation, and the rise in 1-AT in 31 patients with the mutation was compared with that in
167 wild type individuals. We also measured the serum IL-6 levels pre- and postoperatively in a subset of patients (n = 19) to confirm that there was an increase in the concentration of this cytokine.
In addition, we determined whether the acute-phase increase in 1-AT concentration was affected by the Z and S
variants of the 1-AT gene. These variants are both point mutations and each results in a single amino acid substitution in
the 1-AT protein. Although these mutations are known to be
associated with lower baseline levels of 1-AT (19, 20), their
effect on the acute-phase response has not been established.
| |
METHODS |
Subjects
We recruited 198 patients undergoing either elective or urgent open
heart surgery (coronary artery bypass grafting, valve replacement, or
both). Any subject with a history of liver disease or alcoholism was excluded from the study. In addition, a random sample of individuals
from a blood donor clinic was recruited in order to assess the prevalence of the 3' mutation in the general population.
Measurement of 1-AT
Blood samples for measurement of 1-AT levels were obtained preoperatively and 4 or 5 d postoperatively. Serum samples from each patient were stored at 
70° C prior to measurement of 1-AT by
nephelometric analysis using a Beckman assay systems 1-AT-specific test kit (Beckman Coulter, Fullerton, CA). Analyses were performed twice on all samples.
Measurement of IL-6
The level of IL-6 in the serum of 19 of the patients was measured pre-
and postoperatively. Concentrations of IL-6 were quantified using a
monoclonal anti-human IL-6 antibody in an ELISA, as described by
the manufacturer (R&D Systems, Minneapolis, MN).
Genotyping
Study subjects were genotyped for the 3', Z, and S mutations in the
1-AT gene using polymerase chain reaction (PCR)-based restriction
enzyme assays. Genotyping was performed on 2 µl of whole (ethylenediaminetetraacetic acid [EDTA]) blood which had been pretreated by microwave irradiation (Emersen [Mississauga, ON, Canada] MW8625WC/600 Watt microwave on high power) for 5 min prior
to amplification (21).
PCR primers were as follows: 3' mutation 5'CTACCAGGAATGGCCTTGTCC3' and 5'CTCTCAGGTCTGGTGTCATCC3'; S allele
5'GAGGGGAAACTACAGCACCTCG3' and 5'ACCCTCAGGTTGGGGAATCACC3'; Z allele 5'TAAGGCTGTGCTGACCATCGTC3' and 5'GGAGACTTGGTATTTTGTTCAATC3'. PCR was
carried out in a 20 µl volume containing 2 µl whole blood, 2.0 mM
MgCl2, 1 µM each primer, 200 µM each of deoxyguanosine triphosphate (dGTP), deoxycytidine triphosphate (dCTP), deoxythymidine
triphosphate (dTTP), and deoxyadenosine triphosphate (dATP), and
1 unit Taq DNA polymerase. Amplification conditions were 35 cycles
of 94° C for 30 s, 59° C for 30 s, and 72° C for 30 s.
The 3' mutation PCR produced a 311 bp product that was digested
with 10 units TaqI restriction enzyme. The wild type band was cut into
182 and 129 bp fragments at a naturally occurring TaqI site, but the
mutant band remained uncut (Figure 1A). The S allele PCR produced
a 98 bp product, and introduced a TaqI restriction site into the wild
type M allele but not into the S allele. The PCR product was digested
with TaqI and the M allele was cut into 78 and 20 bp bands, but the S
allele remained uncut as a 98 bp band (Figure 1B). The Z allele amplification produced a 144 bp product, and introduced a TaqI site into
the M but not into the Z allele. After digestion with TaqI the M allele
was cut into 123 bp and 21 bp bands, whereas the Z allele remained as
a 144 bp band (Figure 1C).
View larger version (42K):
[in this window]
[in a new window]
|
Figure 1.
Analysis of the 1-AT 3', S, and Z mutations using restriction enzyme digestion. (A) TaqI digestion of PCR products amplified from the 3' region yields a 311 bp fragment from the mutant
allele and 182 and 129 bp fragments from the wild type allele. (B)
TaqI digestion of PCR products amplified from exon III yields a 78 bp fragment from the M allele and a 98 bp fragment from the Z
allele. (C ) TaqI digestion of PCR products amplified from exon V
yields a 123 bp fragment from the M allele and a 144 bp fragment
from the Z allele. M = 100 bp DNA ladder.
|
|
The genotyping protocol was confirmed by direct sequencing of a
sample of PCR products by Ampli Taq FS polymerase cycle sequencing with dye-labeled dideoxyterminators (Perkin Elmer Applied Biosystems, Foster City, CA).
Statistical Analysis
To estimate the sample size required for the study, we measured 1-AT levels pre- and postoperatively in 20 individuals who were homozygous wild type for the 3' mutation. The mean percentage increase (± SD) in 1-AT 4 d postoperatively was 136 ± 47. A power analysis determined that 30 heterozygous subjects each matched with
four wild type controls would allow the detection of a 20% attenuation in 1-AT increase after surgery with 80% power, assuming that
the variance of 1-AT levels associated with the mutant allele was
equal to the wild type.
The effects of the 3', Z, and S mutations on the preoperative 1-AT concentration and percentage change in 1-AT were examined using t tests and linear regression. No systematic variation in the two
1-AT measurements was detected, so average values from the two
measurements were used in the analyses. Because of the skewness in
the preoperative 1-AT measurement, the data were natural log transformed prior to analysis.
Other possible predictors examined were age, sex, preoperative
status (urgent versus elective), the type of operation (coronary artery
bypass grafting versus valve replacement versus both), the length of
operation, and pump time during the operation. Stepwise analyses
were conducted to determine significant predictors and the presence
of interactions. The significant clinical and anthropometric variables
and interactions were included in the model to determine the adjusted
effects of the 1-AT mutations.
| |
RESULTS |
There were no significant differences in age, sex, and type of
surgery for the subjects with the 3' mutation compared with those who were wild type at this locus (Table 1). The frequencies of the 3', Z, and S 1-AT mutations in the study group are
shown in Table 2. All three polymorphisms were in Hardy-Weinberg equilibrium.
The genotypes of two wild type homozygotes, two heterozygotes, and one mutant homozygote for the 3' mutation
were confirmed by DNA sequence analysis. For the 3' mutation, 15% of the subjects were heterozygous and 0.5% (1 of
198) were homozygous mutant which are higher prevalences
than previously reported (1, 2). To determine whether this increased prevalence was typical of the general population of
Vancouver or resulted from the selection of patients with
heart disease, we genotyped a random sample of subjects from
a blood donor clinic. The prevalence of heterozygotes in this
population was 13 of 104 (12%) which was not significantly different from our study group (p = 0.49). The frequencies of heterozygotes for the Z and S mutations were in agreement
with those reported for other white populations (22, 23).
Preoperative concentrations and the rise in 1-AT following surgery in the different genotypic groups are shown in Table 3. The rise in 1-AT in individuals with the 3' mutation
(104%) was less than that for the homozygous wild type individuals (108%) but this difference was not significant. The MZ
and MS genotypes were associated with lower baseline values
of 1-AT. The MZ genotype resulted in a baseline value that
was 60% of the concentration of the normal MM genotype,
and the MS genotype baseline value was 85% of normal.
These data are in agreement with previous studies (19, 20).
The S mutation was associated with an absolute rise in 1-AT
that was 85% of the wild type response, but this rise was not
significantly less than the wild type response. The Z mutation
resulted in an absolute increase in 1-AT that was 58% of normal response (p = 0.005). However, neither genotype was associated with a significant difference in the percentage rise of
1-AT after surgery.
There was one individual in the study group who was homozygous for the 3' mutation. The preoperative 1-AT concentration in this individual was 1.84 g/L which increased to
3.29 g/L after surgery. This corresponds to a percentage increase in 1-AT of 79%. Thus the baseline level in this subject
is above the mean for wild type subjects, but the increase after
surgery is less than that for wild type subjects (Table 3).
There was an increase in the serum levels of IL-6 in response to surgery. The preoperative concentration of IL-6 was
3.8 ± 7.6 pg/ml (mean ± SD) which increased significantly to
14.6 ± 12.3 pg/ml after surgery (p = 0.0003).
Multiple linear regression analysis identified sex, urgency
of surgery, and pump time during the operation as significant independent predictors of the percentage change in 1-AT
(Table 4). A significant age-sex interaction was also observed,
and this interaction term added to the regression model. In
women, the acute-phase rise in 1-AT increased as a function
of age, although this did not reach statistical significance. In
younger subjects, the rise in 1-AT was significantly greater in
men than in women. However, the rise in 1-AT decreased
significantly with age in men so that by age 70 there was no
sex-related difference. Both the urgency of surgery and the
pump time during surgery had significant negative coefficients, indicating an attenuated acute-phase response.
After adjustment for these factors, the 3' mutation did not
significantly affect the acute-phase increase in 1-AT ( = 7.3, 95% confidence intervals [CI] = 23.6, 8.7, p = 0.51). The
coefficient is the estimated difference in the percentage
change between the mutant and wild type groups. By comparison, the estimated difference in the percentage change in 1-AT unadjusted for the other predictors was 3.4 (p = 0.71).
The Z and S mutations, along with urgency of surgery were
significant independent predictors of the preoperative 1-AT
(natural log transformed). After adjustment for the urgency of
surgery, the coefficients for the Z and S mutations were
0.48 (p < 0.001) and 0.20 (p = 0.03), respectively. The results show that even after adjusting for the urgency of surgery,
the presence of Z and S mutations significantly lowered the
preoperative 1-AT concentrations. Preoperative 1-AT concentrations were not significantly modified by the 3' mutation
( = 0.02, p = 0.63).
| |
DISCUSSION |
We have investigated whether the 3' mutation of the 1-AT
gene was associated with a diminished 1-AT acute-phase response in vivo, by measuring the rise in 1-AT in patients
undergoing open heart surgery. We were unable to detect a
significant attenuation in the acute-phase response in those
individuals who were heterozygous for the 3' mutation compared with the wild type. The observed difference in the percentage change between mutant and wild type groups ( = 7.3, 95% CI = 23.6, 8.7) can be interpreted as providing evidence (with 95% confidence) that the true attenuation in
1-AT is not more than 23.6%. Smaller differences cannot be
ruled out from this study. This result suggests that the 3' mutation is not associated with a clinically important deficiency in
the 1-AT acute-phase response after surgery.
Previous studies have shown that the 1-AT acute-phase
response is mediated primarily by IL-6 (6, 8, 9, 13). In addition, in vitro data indicated that a promoter containing the 3'
mutation may be less responsive to IL-6 (17). However, in this
study the 3' mutation was not associated with a diminished 1-AT acute-phase response even though the concentration of
IL-6 in the serum increased approximately 4-fold.
The basal levels of 1-AT in MZ and MS individuals were
reduced, as expected from previous studies (19, 20). These individuals had an impaired acute-phase increase in 1-AT in response to surgery compared with wild type. However, when
expressed as a percentage change, the MZ and MS heterozygotes showed a very similar increase to the normal MM subjects. This result does not support the conclusions of previous
studies that investigated the acute-phase response of the Z
allele induced by typhoid vaccine (24) and diethylstilbestrol (25). The percentage increase in 1-AT in MZ individuals in these studies was less than MM subjects, which suggests that
the Z allele was not upregulated to the same extent as the M
allele. In addition, the increase in 1-AT in response to danazol and tamoxifen in ZZ individuals has been shown to be heterogeneous (26, 27). Many subjects showed no increase in 1-AT in response to these drugs suggesting that upregulation of
the Z gene was deficient. However, it is possible that we did
not find a diminished percentage increase in 1-AT owing to
the small numbers of S and Z heterozygotes in the study group.
The impaired increase in 1-AT concentrations associated
with the Z allele during acute stress could be a contributing
factor to the increased susceptibility to COPD in subjects who
have lower than normal baseline levels. Individuals who have
the ZZ genotype have mean baseline 1-AT levels of 15% of
normal and have increased susceptibility to COPD (28). In addition, SZ individuals with a baseline 1-AT level below 11 µM
are also at increased risk for COPD (29). The issue of whether
MZ individuals have increased susceptibility to COPD is controversial because many studies have found no increase in risk
for COPD associated with the MZ genotype (28). The proteolytic destruction of the lung that results in loss of lung recoil and emphysema may occur particularly during episodes of
acute respiratory infection or exacerbations of lung inflammation. An impaired ability to increase 1-AT concentrations in
response to these challenges could be as important as decreased basal levels.
Serum levels of 1-AT are known to increase with age (30,
31), and are also elevated during pregnancy (32) and the administration of exogenous estrogen compounds (33). However, the factors that affect the acute-phase rise in 1-AT have
not previously been investigated. We have determined that
the 1-AT percentage increase is affected by age, which includes a significant interaction with sex. The 1-AT acute-phase response increases by 0.55% per year in women but decreases by 1.95% per year in men.
The rise in 1-AT was reduced by 36.4% in patients undergoing urgent surgery compared with elective surgery. This difference may be explained if the urgent patients' acute-phase
response had already commenced before the preoperative
blood sample was taken. Because there is presumably an upper limit to the increase in 1-AT, the acute-phase response
would be reduced in these patients compared with the elective
patients. In support of this hypothesis, the mean value of 1-AT preoperatively was significantly higher in those undergoing urgent surgery (1.95 ± 0.5 g/L) than those undergoing
elective surgery (1.63 ± 0.4 g/L) (p = 0.0001). The mean value
of 1-AT postoperatively was 3.41 ± 0.5 g/L in the elective patients and 3.34 ± 0.5 g/L in the urgent patients (p = 0.45).
These data are supported by a previous study which showed that individuals with the highest baseline concentration of 1-AT had the smallest acute-phase increase in 1-AT (25). It is
unclear how a longer pump time could exert an independent
influence decreasing the acute-phase 1-AT rise.
The data presented here suggest that it is unlikely that the
3' mutation predisposes individuals to COPD by virtue of a
deficient 1-AT acute-phase response. However, it is possible
that the mutation affects 1-AT gene expression in mononuclear phagocytes, but not in hepatocytes. Alveolar macrophages are known to express the 1-AT gene (34) and if the 3'
mutation decreased this expression the resultant attenuated
1-AT concentrations in the microenvironment of the lung
could predispose to lung destruction but remain undetectable by measuring serum levels. Alternatively, the association of
the 3' mutation with COPD may be explained by linkage disequilibrium. For example, the 1-antichymotrypsin gene has
been mapped to within 220 kb of the 1-AT locus (35), and
may contain an allele that increases susceptibility to COPD.
| |
Footnotes |
Correspondence and requests for reprints should be addressed to Dr. A. J. Sandford, UBC Pulmonary Research Laboratory, St. Paul's Hospital, 1081 Burrard
Street, Vancouver, BC, V6Z 1Y6 Canada. E-mail: asandford{at}prl.pulmonary.ubc.ca
(Received in original form November 4, 1997 and in revised form November 18, 1998).
Dr. Sandford is an Astra-MRC Fellow.
Acknowledgments:
Supported by a Miles (Bayer)/Canadian Red Cross Society Research and Development Award.
| |
References |
1.
Kalsheker, N. A.,
G. L. Watkins,
S. Hill,
K. Morgan,
R. A. Stockley, and
R. B. Fick.
1990.
Independent mutations in the flanking sequence of
the 1-antitrypsin gene are associated with chronic obstructive airways
disease.
Dis. Markers
8:
151-157
[Medline].
2.
Poller, W.,
C. Meisen, and
K. Olek.
1990.
DNA polymorphisms of the
1-antitrypsin gene region in patients with chronic obstructive pulmonary disease.
Eur. J. Clin. Invest.
20:
1-7
[Medline].
3.
Morgan, K.,
G. Scobie, and
N. Kalsheker.
1992.
The characterization of
a mutation of the 3' flanking sequence of the 1-antitrypsin gene commonly associated with chronic obstructive airways disease.
Eur. J. Clin. Invest.
22:
134-137
[Medline].
4.
Kushner, I., and
D. L. Rzewnicki.
1994.
The acute-phase response: general aspects.
Baillieres Clin. Rheumatol.
8:
513-530
[Medline].
5.
Nijsten, M. W. N.,
E. R. de Groot,
H. J. ten Duis,
H. J. Klasen,
C. E. Hack, and
L. A. Aarden.
1987.
Serum levels of interleukin-6 and
acute-phase responses.
Lancet
2:
921
[Medline].
6.
Castell, J. V.,
M. J. Gomez-Lechon,
M. David,
T. Andus,
T. Geiger,
R. Trullenque,
R. Fabra, and
P. C. Heinrich.
1989.
Interleukin-6 is the
major regulator of acute-phase protein synthesis in adult human hepatocytes.
FEBS Lett.
242:
237-239
[Medline].
7.
Marinkovic, S.,
G. P. Jahreis,
G. G. Wong, and
H. Baumann.
1989.
IL-6
modulates the synthesis of a specific set of acute-phase plasma proteins in vivo.
J. Immunol.
142:
808-812
[Abstract].
8.
Perlmutter, D. H.,
C. A. Dinarello,
P. I. Punsal, and
H. R. Colten.
1986.
Cachectin/tumor necrosis factor regulates hepatic acute-phase gene
expression.
J. Clin. Invest.
78:
1349-1354
.
9.
Darlington, G. J.,
D. R. Wilson, and
L. B. Lachman.
1986.
Monocyte-
conditioned medium, interleukin-1, and tumor necrosis factor stimulate the acute-phase response in human hepatoma cells in vitro.
J. Cell
Biol.
103:
787-793
[Abstract/Free Full Text].
10.
Voulgari, F.,
P. Cummins,
T. I. Gardecki,
N. J. Beeching,
P. C. Stone, and
J. Stuart.
1982.
Serum levels of acute-phase and cardiac proteins
after myocardial infarction, surgery, and infection.
Br. Heart J.
48:
352-356
[Abstract/Free Full Text].
11.
Aronsen, K. F., G. Ekelund, C. O. Kindmark, and C. B. Laurell. 1972. Sequential changes of plasma proteins after surgical trauma. Scand. J. Clin. Lab. Invest. 29(Suppl. 124):127-136.
12.
Cruickshank, A. M.,
D. T. Hansell,
H. J. Burns, and
A. Shenkin.
1989.
Effect of nutritional status on acute-phase protein response to elective
surgery.
Br. J. Surg.
76:
165-168
[Medline].
13.
Perlmutter, D. H.,
L. T. May, and
P. B. Sehgal.
1989.
Interferon 2/interleukin 6 modulates synthesis of 1-antitrypsin in human mononuclear
phagocytes and in human hepatoma cells.
J. Clin. Invest.
84:
138-144
.
14.
Akira, S.,
H. Isshiki,
T. Sugita,
O. Tanabe,
S. Kinoshita,
Y. Nishio,
T. Nakajima,
T. Hirano, and
T. Kishimoto.
1990.
A nuclear factor for IL-6
expression (NF-IL6) is a member of a C/EBP family.
EMBO J.
9:
1897-1906
[Medline].
15.
Ramji, D. P.,
A. Vitelli,
F. Tronche,
R. Cortese, and
G. Ciliberto.
1993.
The two C/EBP isoforms, IL-6 DBP/NF-IL-6 and C/EBP 
/NF-IL-6 ,
are induced by IL-6 to promote acute-phase gene transcription via different mechanisms.
Nucleic Acids Res.
21:
289-294
[Abstract/Free Full Text].
16.
Morgan, K.,
G. Scobie, and
N. A. Kalsheker.
1993.
Point mutation in a 3'
flanking sequence of the 1-antitrypsin gene associated with chronic
respiratory disease occurs in a regulatory sequence.
Hum. Mol. Genet.
2:
253-257
[Abstract/Free Full Text].
17.
Morgan, K.,
G. Scobie,
P. Marsters, and
N. A. Kalsheker.
1997.
Mutation in an 1-antitrypsin enhancer results in an interleukin-6 deficient
acute-phase response due to loss of cooperativity between transcription factors.
Biochim. Biophys. Acta
1362:
67-76
[Medline].
18.
Cruickshank, A. M.,
W. D. Fraser,
H. J. Burns,
J. Van Damme, and
A. Shenkin.
1990.
Response of serum interleukin-6 in patients undergoing elective surgery of varying severity.
Clin. Sci.
79:
161-165
[Medline].
19.
Lieberman, J.,
L. Gaidulis,
B. Garoutte, and
C. Mittman.
1972.
Identification and characteristics of the common 1-antitrypsin phenotypes.
Chest
62:
557-564
.
20.
Brantly, M. L.,
J. T. Wittes,
C. F. Vogelmeier,
R. C. Hubbard,
G. A. Fells, and
R. G. Crystal.
1991.
Use of a highly purified 1-antitrypsin
standard to establish ranges for the common normal and deficient 1-antitrypsin phenotypes.
Chest
100:
703-708
[Abstract/Free Full Text].
21.
Ohhara, M., Y. Kurosu, and M. Esumi. 1994. Direct PCR of whole blood
and hair shafts by microwave treatment. Biotechniques 17:726, 728.
22.
Fagerhol, M. K..
1967.
Serum Pi types in Norwegians.
Acta Pathol. Microbiol. Scand.
70:
421-428
[Medline].
23.
Dykes, D. D.,
S. A. Miller, and
H. F. Polesky.
1984.
Distribution of 1-antitrypsin variants in a US white population.
Hum. Hered.
34:
308-310
[Medline].
24.
Kueppers, F..
1968.
Genetically determined differences in the response of
1-antitrypsin levels in human serum to typhoid vaccine.
Humangenetik
6:
207-214
[Medline].
25.
Lieberman, J., and
C. Mittman.
1973.
Dynamic response of 1-antitrypsin variants to diethylstilbestrol.
Am. J. Hum. Genet.
25:
610-617
[Medline].
26.
Wewers, M. D.,
J. E. Gadek,
B. A. Keogh,
G. A. Fells, and
R. G. Crystal.
1986.
Evaluation of danazol therapy for patients with PiZZ 1-antitrypsin deficiency.
Am. Rev. Respir. Dis.
134:
476-480
[Medline].
27.
Wewers, M. D.,
M. L. Brantly,
M. A. Casolaro, and
R. G. Crystal.
1987.
Evaluation of tamoxifen as a therapy to augment 1-antitrypsin concentrations in Z homozygous 1-antitrypsin deficient subjects.
Am.
Rev. Respir. Dis.
135:
401-402
[Medline].
28.
Sandford, A. J.,
T. D. Weir, and
P. D. Pare.
1997.
Genetic risk factors for
chronic obstructive pulmonary disease.
Eur. Respir. J.
10:
1380-1391
[Abstract].
29.
Turino, G. M.,
A. F. Barker,
M. L. Brantly,
A. B. Cohen,
R. P. Connelly,
R. G. Crystal,
E. Eden,
M. D. Schluchter, and
J. K. Stoller.
1996.
Clinical features of individuals with PI*SZ phenotype of 1-antitrypsin deficiency: 1-Antitrypsin Deficiency Registry Study Group.
Am. J. Respir. Crit. Care Med.
154:
1718-1725
[Abstract].
30.
Petridou, E.,
C. Chapuis-Cellier,
K. Roukas,
S. J. Lan,
A. Tzonou, and
D. Trichopoulos.
1993.
Tobacco smoking and other factors in relation
to serum 1-antitrypsin.
Hum. Biol.
65:
425-432
[Medline].
31.
Milman, N.,
N. Graudal, and
H. C. Andersen.
1988.
Acute-phase reactants in the elderly.
Clin. Chim. Acta
176:
59-62
[Medline].
32.
Faarvang, H. J., and
H. C. Lauritsen.
1963.
Increase of trypsin inhibitor
in serum during pregnancy.
Nature
199:
290-292
.
33.
Laurell, C. B.,
S. Kullander, and
J. Thorell.
1968.
Effect of administration of a combined estrogen-progestin contraceptive on the level of
individual plasma proteins.
Scand. J. Clin. Lab. Invest.
21:
337-343
[Medline].
34.
Mornex, J. F.,
A. Chytil-Weir,
Y. Martinet,
M. Courtney,
J. P. LeCocq, and
R. G. Crystal.
1986.
Expression of the 1-antitrypsin gene in
mononuclear phagocytes of normal and 1-antitrypsin-deficient individuals.
J. Clin. Invest.
77:
1952-1961
.
35.
Billingsley, G. D.,
M. A. Walter,
G. L. Hammond, and
D. W. Cox.
1993.
Physical mapping of four serpin genes: 1-antitrypsin, 1-antichymotrypsin, corticosteroid-binding globulin, and protein C inhibitor,
within a 280-kb region on chromosome I4q32.1.
Am. J. Hum. Genet.
52:
343-353
[Medline].
TOP
ABSTRACT
INTRODUCTION
