INTRODUCTION

TOP ABSTRACT INTRODUCTION METHODS RESULTS DISCUSSION REFERENCES

Trefoil factor family (TFF)-domain peptides (formerly P-domain peptides, trefoil factors [1]) are typical secretory products of mucous epithelia (2). Three TFF peptides are known in humans: TFF1 (formerly pS2), TFF2 (formerly hSP), and TFF3 (formerly hP1.B/hITF). Their expression patterns vary characteristically and were studied particularly in the gastrointestinal tract. TFF1 is a product of gastric surface mucous cells together with the mucins MUC1 and MUC5AC, TFF2 is expressed in gastric mucous neck cells and cells at the bases of antral glands in conjunction with MUC6, and TFF3 is generated in intestinal goblet cells in combination with MUC2.

TFF peptides are aberrantly secreted together with epidermal growth factor (EGF) by the ulcer-associated cell lineage with a discrete spatial pattern during pathological conditions such as chronic inflammatory diseases (6, 7). TFF peptides appear with a defined kinetics in experimental ulcers (8). Furthermore, TFF peptides are secretory products of a variety of tumors (5).

The occurrence of TFF peptides as characteristic constituents of mucus gels together with the finding that TFF-domains form integral parts of frog integumentary mucins FIM-A.1 (9, 10) and FIM-C.1 (11) led to the hypothesis that TFF peptides may act by linking mucins and thereby influencing the rheological properties of the mucus (7). Preliminary studies seem to confirm this hypothesis; for example, TFF2 and TFF3 increased the viscosity of mucin preparations (12). The precise nature of the interaction between TFF domains and mucins has not been elucidated.

All three TFF peptides are also motogens modulating the migration of a variety of cell lines in wound healing assays besides their function as mucin-associated molecules (13, 14). Their action as motogens clearly enables this peptide family to regulate restitution processes (i.e., rapid repair via cell migration) at least within the gut (1). The molecular function concerning the motogenic effect probably involves the mitogen-activated protein (MAP) kinase pathway (15) and TFF3 can trigger the phosphorylation of -catenin and the EGF receptor in the HT-29 cell line (16). This dual concept is in line with results obtained from transgenic mice lacking TFF1 (17) or TFF3 (18) which show impaired mucosal healing. All homozygous TFF1 mutants developed pyloric adenoma.

Practically no information is available on the expression of TFF peptides in mucous epithelia other than the gut even though TFF peptides play a key role for maintenance of the surface integrity of mucous epithelia. For example, a small amount of TFF3 is expressed in the uterus (7) and Northern blot analysis suggested limited expression in the lung (19). Here, we present the first localization studies of TFF3 in the human respiratory epithelium.

	METHODS

TOP ABSTRACT INTRODUCTION METHODS RESULTS DISCUSSION REFERENCES

Antisera and Western Blot Analysis

TFF3 was monitored with one of the following immunoreactive antisera: a polyclonal rabbit antiserum (termed anti-rTFF3-1) against the C-terminus of the rat sequence as described (20) or different polyclonal antisera against the peptide FKPLQEAECTF representing the C-terminus of human TFF3 (7). In the latter, the synthetic peptide (kindly provided by C. Hoffmann, Max-Planck-Institut für Psychiatrie, Martinsried, Germany) was coupled to keyhole limpet hemocyanin (KLH) with glutaraldehyde and injected into a chicken (Davids Biotechnologie, Regensburg, Germany); the corresponding antiserum was termed anti-hTFF3-1.

Alternatively, the peptide FKPLQEAECTF was coupled to KLH with m-maleimidobenzoyl-N-hydroxysuccinimide ester and a rabbit immunized as described (21). This resulted in the antiserum anti-hTFF3-2 which reacted particularly well on Western blot analyses. The sensitivity and specifity of this antiserum was improved by affinity purification as follows: The peptide FKPLQEAECTF was coupled to bovine serum albumin (BSA) via glutaraldehyde in a manner similar to that described previously (20), diluted in phosphate-buffered saline (PBS) to a protein concentration of 20 µg/ml, and the BSA conjugate was loaded onto nitrocellulose membranes (Schleicher & Schuell, Dassel, Germany) for 5 h at room temperature. The membranes were washed in PBS and residual protein binding capacity was blocked by incubation with 5% normal goat serum (NGS) in PBS for 30 min. Loaded membranes were incubated with antiserum anti-hTFF3-2 diluted 1:50 in 5% NGS in PBS supplemented with 0.1% sodium azide overnight at room temperature. Thereafter, membranes were washed again in PBS and bound antibodies were eluted with 0.2 M glycine- HCl buffer/pH 2.5 containing 150 mM NaCl and 1 mg/ml BSA for 30 min. Eluted antibodies were neutralized by adding 1/10 of volume 2 M Tris-base (pH 8.0) and dialyzed against PBS overnight at 4° C. Finally, purified antibodies were concentrated by ultrafiltration using Vivaspin 100 tubes (Vivascience, Binbrook, UK). The affinity-purified antiserum anti-hTFF3-2 was tested via ELISA for reactivity against the BSA conjugate or synthetic TFF3.

Tissue extraction of human lungs resected for carcinoma and subsequent Western blot analysis was done in a manner similar to that described previously (22) using the antiserum anti-hTFF3-2 in a 1:500 dilution. Tissue was collected only from regions that did not contain a tumor. Additionally, sputum samples were analyzed from patients with chronic bronchitis.

RNA Extraction and Reverse Transcription-Polymerase Chain Reaction (RT-PCR) Analysis

Tissue freshly excised during lung surgery was immediately frozen in liquid nitrogen. Total RNA was extracted by a guanidinium thiocyanate protocol (23). Approximately 0.5 g frozen tissue was suspended in 5 ml of 4 M guanidinium thiocyanate, 5 mM sodium citrate/pH 7.0, 0.1 M -mercaptoethanol, and 0.5% sodium dodecyl sulfate (SDS) and then homogenized with an Ultra-Turrax (IKA Labortechnik, Staufen, Germany). RNA was purified by subsequent CsCl ultracentrifugation.

Two micrograms total RNA, (dT)18 primed, was used for first strand complementary DNA (cDNA) synthesis (SuperscriptII-RNAse H; GIBCO/BRL, Karlsruhe, Germany). TFF3 expression was analyzed with TFF3-specific primers d(GTGCCAGCCAAGGACAG) and d(CGTTAAGACATCAGGCTCCAG) resulting in a 303 base pair product. Expression of TFF1 or TFF2 was monitored using the primer pairs d(TTTGGAGCAGAGAGGAGG)/d(TTGAGTAGTCAAAGTCAGAGCAG) or d(AGTGAGAAACCCTCCCCC)/d(AACACCCGGTGAGCCAG), respectively (resulting length of the PCR products: 438 or 366 base pairs). RNA integrity and the success of the reverse transcription reaction was monitored by parallel PCR amplification of glyceraldehyde-3-phosphate dehydrogenase (GAPDH) transcripts [primer pair d(GCTGGATCCTTCATTGACCTCAACTAC)/ d(CGAGAATTCATACCAGGAAATC) resulting in an 834 base pair product]. All PCR reactions were accomplished using the same program, essentially 30 cycles: 94° C for 30 s, 57° C for 30 s, 72° C for 30 s. The PCR products were separated on agarose gels and stained with ethidium bromide and visualized under ultraviolet light (254 nm).

General Histology and Immunohistochemistry

Human material was obtained after lung surgery because of carcinomas. Pieces of tissue were fixed in HEPES-buffered 4% paraformaldehyde overnight at 4° C, dehydrated in a series of graded ethanols, and embedded in Technovit 7100 (Heraeus Kulzer GmbH, Wehrheim, Germany). Two-micrometer sections were cut on a rotation microtome (Leica RM 2155; Beusheim, Germany), put on Polysine microslides (Menzel-Gläser, Braunschweig, Germany) and dried for 2 h.

Mucins were stained using a combination of alcian blue 8GX at pH 2.5 and the periodic acid-Schiff (PAS) reaction as described (22). Nuclei were counterstained with hematoxylin.

For immunohistochemistry the fixed sections were treated with 0.1% papain (Merck, Darmstadt, Germany) for 15 min at room temperature, blocked with 1% BSA for 20 min at 37° C, and then incubated with the primary antibody in 0.5% BSA (dilutions: anti-hTFF3-1 1:1,000, anti-rTFF3-1 1:500) for 2 h at 37° C. The secondary antibodies, fluorescein-labeled anti-chicken IgG (Sigma, Deisenhofer, Germany) or CY3-labeled anti-rabbit IgG (Sigma), were incubated for 1 h at 37° C. DNA within the nuclei was stained with 4',6-diamidino-2-phenylindole (DAPI; Sigma) and the sections were covered with fluorescent mounting medium (Dako Ltd.) after being washed in PBS and water. The labeled streptavidin biotin immunostaining protocol (LSAB Kit; Dako GmbH, Hamburg, Germany) was alternatively used for detection. Photomicrographs were taken on Kodak Ektachrome EPJ 320T.

	RESULTS

TOP ABSTRACT INTRODUCTION METHODS RESULTS DISCUSSION REFERENCES

Western Blot Analysis, PCR

As shown in Figure 1, Western blot analysis with the antiserum against human TFF3 detected a band in tissue extracts of human surgical material which comigrated with recombinant TFF3. This band was not visible after staining with preimmune serum and could be blocked by competition with the synthetic peptide used for immunization. Two characteristic regions of the lung, bronchi and lobe, which were analyzed initially exhibited a normal morphology and were not affected by the nearby tumor. Generally, larger amounts of TFF3 were present in the bronchi when compared with peripheral portions of the lobes (data not illustrated). TFF3 is also present in sputum samples of various patients suffering from chronic bronchitis (Figure 2).

View larger version (50K): [in this window] [in a new window]   Figure 1.   Sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) (15%) and subsequent Western blot analysis. An extract of human lung (E lanes ) or recombinant human TFF3 peptide (P lanes) was analyzed using the following sera: preimmune serum (A), affinity-purified antiserum anti-hTFF3-2 (B), or affinity-purified antiserum anti-hTFF3-2 after blockage with the synthetic peptide FKPLQEAECTF (C ).

View larger version (25K): [in this window] [in a new window]   Figure 2.   SDS-PAGE (15%) and subsequent Western blot analysis. 15 µl of sputum samples from patients with chronic bronchitis (lanes b-f  ) were analyzed for TFF3 using the polyclonal antiserum anti-hTFF3-2. As a positive control, TFF3 was shown in human colon extract (lane a).

RNA was isolated from human lungs of various patients and cDNA was amplified by the use of specific primer pairs in sensitive tests for TFF1, TFF2, or TFF3 transcripts (Figure 3). As a control, GAPDH transcripts were amplified. A TFF3-specific amplification product was clearly visible after separation on an agarose gel. In contrast, TFF1 and TFF2 transcripts were hardly detectable.

View larger version (57K): [in this window] [in a new window]   Figure 3.   RT-PCR analysis. TFF1, TFF2, or TFF3 expression was monitored in surgical material from human lungs of six different patients (lanes 1-6). Total RNA from human stomach or colon was analyzed as positive controls for TFF1, TFF2, or TFF3 transcripts, respectively (lane c). The integrity of the cDNAs of the six different patients was tested by monitoring the GAPDH transcripts.

Immunohistochemistry

Subsequent search for cellular localization of TFF3 revealed a characteristic pattern in tissue obtained from human bronchi. The major source for TFF3 are acini of submucosal glands (Figure 4) where TFF3 is stored in secretory granules of mucous cells (Figures 5C and 5D). These cells are alcian blue positive in contrast to serous cells (24). Additionally, goblet cells in the acini of submucosal glands and at the surface epithelium contain varying amounts of TFF3 (Figures 5A, 5B, and 6). Preimmune serum did not stain submucosal glands (Figure 4B) and the specifity of the staining was tested by competitive inhibition of the immunoreactivity with the synthetic peptide used for coupling (data not illustrated).

View larger version (155K): [in this window] [in a new window]   Figure 4.   Differential interference-contrast photographs of submucosal glands from human bronchi after LSAB immunostaining (antiserum anti-hTFF3-1) and counterstaining with hematoxylin. TFF3 is located in a population of submucosal cells (A) whereas no staining is observed with a preimmune serum in a parallel section (B). Scale bars: 100 µm.

View larger version (107K): [in this window] [in a new window]   Figure 5.   TFF3 in goblet cells (A, B) and submucosal glands (C, D) from human bronchi. (B) Immunohistochemical localization of TFF3 in goblet cells of the surface epithelium (using antiserum anti-rTFF3-1 and immunofluorescence with CY3 label) and counterstaining with DAPI. (A) Phase contrast picture of the same section. A weakly stained goblet cell is indicated by an arrow. Scale bars: 30 µm. (D) Immunohistochemical localization of TFF3 in submucosal glands (using antiserum anti-rTFF3-1 and immunofluorescence with CY3 label) and counterstaining with DAPI. (C ) Parallel section stained with PAS/alcian blue. Scale bars: 100 µm.

	DISCUSSION

TOP ABSTRACT INTRODUCTION METHODS RESULTS DISCUSSION REFERENCES

The respiratory epithelium is a typical site for specialized synthesis of various mucins. It is generally accepted that they are secreted by surface epithelial goblet cells and submucosal glands (25, 26). The goblet cells are regularly found in the tracheobronchial tree but rarely in bronchioles of less than 1 mm in diameter; submucosal glands are relatively numerous in the lower respiratory tract from the larynx to the small bronchi. Goblet cells of the lower respiratory tract discharge predominantly the mucin MUC5AC and small amounts of both mucins MUC2 and MUC8 in response to direct irritations, e.g., gases, whereas submucosal glands are under neuronal control and secrete mainly MUC5B but also MUC7 and MUC8 (27- 31). MUC4 is highly expressed continuously over the surface epithelium (27, 29).

The results presented in Figures 4-6 clearly indicate for the first time that TFF3 is a secretory peptide of the bronchial tract and that its localization matches that of mucins. It is noteworthy that TFF3 is cosecreted with different mucins depending on the particular cell type. In mucous cells of submucosal glands TFF3 is mainly colocalized with MUC5B and MUC8 (27, 29, 30), whereas in respiratory goblet cells the pair TFF3/MUC5AC is observed. This combination has also been found in conjunctival goblet cells (32). In contrast, intestinal goblet cells secrete MUC2 (27) together with TFF3. However, most of the mucins cosecreted with TFF3 (i.e., MUC2, MUC5AC, and MUC5B) share homologies with von Willebrand factor and the frog integumentary mucin FIM-B.1 (10).

View larger version (120K): [in this window] [in a new window]   Figure 6.   Varying amounts of TFF3 in goblet cells of the surface epithelium from human bronchi. (A) Immunohistochemical localization of TFF3 (using antiserum anti-rTFF3-1 and immunofluorescence with CY3 label) and counterstaining with DAPI. (B) Phase contrast picture of the same section. (C ) Parallel section stained with PAS/alcian blue. Scale bars: 100 µm.

It is not known at present why goblet cells of the respiratory tract differ in their TFF3 content. TFF3-containing goblet cells often seem to be concentrated in the ducts of submucosal glands or in areas of the surface epithelium close to the ducts. The immunohistochemical localization of TFF3 fits with the observation that there is a preponderance for TFF3 to occur in the bronchi when compared with peripheral portions of the lobes which lack submucosal glands.

There are similarities in the secretory products of submucosal glands from the human respiratory epithelium and mucous glands from frog skin, which has been described as a model for investigating the relationship between mucus secretion and salt and water transport (33). Both types of glands secrete TFF domains, mucins, and chloride, which seem to contribute essentially to the formation of a mucus gel. However, two remarkable differences developed during evolution: (1) in frog skin, TFF domains and mucins appear as covalently linked functional units, i.e., the frog integumentary mucins FIM-A.1 and FIM-C.1 (10), whereas in the human system both functional modules are represented by separate molecules, i.e., TFF3 and mostly MUC5B; (2) in frog skin, chloride secretion via the cystic fibrosis conductance regulator (CFTR) and mucin secretion occur in the same cells (33), whereas in mammals the CFTR is found in serous cells only (34). It will be a future challenge to elucidate the molecular interaction of TFF domains, mucins, and chloride in order to clarify the complex molecular architecture and rheological properties of mucus gels. Hypothetically, chloride, together with Na⁺, could modify the postulated interaction of TFF domains and mucins.

The secretion of TFF3 in the respiratory tract may have the same dual functions as in the gastrointestinal tract: protection of the delicate epithelium together with mucins, and influence on cell migration processes. The first can be expected because TFF3 is a characteristic constituent of mucus, e.g., in patients with chronic bronchitis (Figure 2). However, it is not known if the rheological properties of the airway mucus are directly influenced by TFF3. Preliminary results of sputum samples from patients with chronic bronchitis, asthma, cystic fibrosis, and bronchiectasis did not show significantly altered TFF3 levels in comparison with provoked sputum from healthy individuals (data not shown). Whether mucus-bacteria interactions are affected by TFF3 remains also an open question at present.

The synthesis of TFF3 in the airway epithelium could also be important for restitution processes. This rapid repair mechanism via cell migration has been described for the respiratory epithelium (35, 36) and is important, for example, in inflammatory diseases such as asthma after epithelial shedding and denudation of the basement membrane. However, there is no experimental evidence so far that TFF3 plays a role for restitution of the airway epithelium.