INTRODUCTION

TOP ABSTRACT INTRODUCTION METHODS RESULTS DISCUSSION REFERENCES

Tuberculosis (TB) has been labeled a global emergency by the World Health Organization because of the large number of infected persons and the reduced host defenses among those with human immunodeficiency virus-1 (HIV-1) infection. Successful control of Mycobacterium tuberculosis in animal models has been characterized by CD4⁺ lymphocytes releasing interleukin-2 (IL-2) and interferon- (IFN-) (1, 2). IL-2 activity in response to purified protein derivative (PPD) and expression of IL-2 receptors (IL-2R) on peripheral blood mononuclear cells (PBMC) of TB patients have been found to be reduced (3); in contrast, expression of IL-2 on adherent cells isolated from TB patients is markedly increased (4). In addition, soluble IL-2R are increased in the sera of patients with TB, and levels decline after antituberculous therapy (5).

Blood monocytes from patients with TB express functional IL-2R constitutively, and the functional expression of IL-2R on monocytes has been proposed by Toossi and coworkers (4) to limit the availability of IL-2 for T-cells, leading to depression of T-cell immune responses. In this context, the lack of a delayed skin test reaction to the mycobacterial antigen tuberculin PPD has been observed in some patients with active tuberculosis (6, 7), and is associated with the failure of T cells to proliferate in response to M. tuberculosis antigens (8). Peripheral blood monocytes (PBM) from patients with active pulmonary TB have also been shown to selectively depress lymphocyte responses to PPD (8, 9). Depletion of adherent monocytes increased IL-2 activity of supernatants of PPD-stimulated T-cell cultures. We have demonstrated that PBMC of TB patients had 10-fold fewer IL-2-responsive cells than that of control subjects (3). In addition to the immunomodulatory role of monocyte IL-2R expression, interactions of IL-2 with its receptors may also play a role in microbicidal host defenses because intracellular killing of M. avium complex by monocytes has been demonstrated to be enhanced in the presence of tumor necrosis factor- (TNF-) and IL-2 (10).

Activation of human PBM results in induction of expression of the gene encoding the  chain of interleukin-2 receptor (IL-2R) (11). IL-2R is composed of three distinct membrane components: the , , and  chains (16). IL-2R and IL-2R are constitutively expressed on freshly isolated human monocytes and are sufficient to trigger activation of monocytes by IL-2 (17). The  chain is not constitutively expressed in monocytes but can be induced by lipopolysaccharide (LPS) or IFN- but not by IL-2 (11, 21). LPS and IFN- were additive in augmenting IL-2R expression (12). Expression of IL-2R is important for the formation of high-affinity binding sites for IL-2 (16). Expression of IL-2R may therefore function as an on-off switch that determines whether monocytes will respond to the low concentration of IL-2 found in vivo in the monocyte microenvironments. IL-2, originally described as a T-cell growth factor, is a powerful activator of human monocytes which respond to IL-2 with microbicidal and tumoricidal activities, cytokine production, and expression of growth factor receptors (22, 23).

The transcription factor, nuclear factor kappa B (NF-B) is a protein complex that enables a variety of genes to be rapidly induced in response to extracellular stimuli (24). NF-B is activated by antigens, viruses, bacteria, prooxidants, and inflammatory lymphokines and participates in the transcriptional initiation of diverse genes important in immune and inflammatory responses such as IL-1, -2, -6, -8, IL-2R, adhesion molecules, major histocompatibility class I molecules, and immunoglobulin  light chain (25). NF-B is formed by the noncovalent association of the p50 and p65 subunits which, upon cellular activation, translocates to the nucleus and binds to the NF-B enhancer element. Transcriptional stimulation of the IL-2R gene can be induced upon T-cell activation and the role of NF-B in the positive regulation of IL-2R expression in T cells has been well established (26). Activation of NF-B by IL-2 in human blood monocytes also results in functional activation of a heterologous promoter containing the IL-2R enhancer element (29). Because increased release of soluble IL-2R has been demonstrated in TB patients, we studied the molecular mechanism of IL-2R gene regulation by M. tuberculosis.

	METHODS

TOP ABSTRACT INTRODUCTION METHODS RESULTS DISCUSSION REFERENCES

Study Population

Bronchoalveolar lavage (BAL) was performed on five patients with active pulmonary TB confirmed by culture of M. tuberculosis in the sputum or pleural fluid. The protocol was approved by Human Subjects Review Committees at New York University Medical Center and Bellevue Hospital. We also evaluated two normal volunteers with normal chest radiographs, pulmonary function tests, and physical examinations. Both were nonsmokers; their mean age was 36 and 38 yr respectively; both were HIV-negative, and the normal controls were PPD-negative. All TB patients were PPD-positive and HIV-negative. BAL was performed in involved and uninvolved lobes as previously described in two patients (30). Cytospins revealed > 80% macrophages in all lavages.

Cell Culture and Reagents

PBMCs from healthy PPD-negative volunteers were isolated by sedimentation over Lymphocyte Separation Medium (Organon Teknika, West Chester, PA). PBM were isolated by plastic adherence on plastic dish for 1 h at 37° C. After removing nonadherent cells, the adherent cells were washed twice with phosphate-buffered saline (PBS) and dislodged by gentle scraping and resuspended in RPMI 1640 supplemented with 10% heat-inactivated fetal calf serum (FCS) plus penicillin and streptomycin, and were > 95% monocytes by esterase staining. The human myelomonocytic leukemic cell line THP-1 was purchased from American Type Culture Collection (Rockville, MD) and cultured in RPMI 1640 medium supplemented with 10% FCS. Cells were stimulated with heat-killed M. tuberculosis H37Ra (Difco, Detroit, MI) which had been tested to be endotoxin-free (< 5 pg/ml) by amebocyte lysate assay (E-Toxate kit; Sigma, St. Louis, MO) or live M. tuberculosis H37Rv. LPS 055 was purchased from Sigma and IFN- was a gift from Genentech, Inc. (South San Francisco, CA). Anti-p50 and anti-p65 antibodies were purchased from Santa Cruz (Santa Cruz, CA).

Measurement of Surface IL-2 Receptor Expression

2 × 10⁶ PBM were incubated for 48 h in the presence or absence of inducing agents. Cells were washed with PBS, resuspended in RPMI 1640 with 1% fetal bovine serum (FBS), 15 mM HEPES (pH 7.9), and 0.1% sodium azide and incubated with fluorescein isothiocyanate (FITC)-conjugated CD25 antibody (anti-IL-2R) (Becton Dickinson, San Jose, CA) on ice for 30 min. Cells were washed and analyzed by FACScan (Becton Dickinson). Surface IL-2R expression was quantitated and represented as mean fluorescence intensities (MFIs).

Northern Blot Analysis

PBM were stimulated with H37Ra in the presence or absence of IFN- for 12 h. Cytoplasmic RNA from BAL cells from TB patients or normal control subjects was isolated by the guanidine thiocyanate-cesium chloride (CsCl₂) centrifugation method. Equal amounts of RNA were fractionated by electrophoresis through 0.8% agarose/formaldehyde gel and transferred onto nylon membrane (Hybond N; Amersham, Arlington Heights, IL). The membrane was hybridized at 65° C in Church buffer (7% sodium dodecylsulfate [SDS], 1% bovine serum albumin [BSA], 1 mM ethylenediaminetetraacetic acid [EDTA], 0.25 M Na₂HPO₄) containing the IL-2R or pHe7 complementary DNA (cDNA) radiolabeled by random priming with radioactive phosphorus-deoxycytidine triphosphate ([-³²P]dCTP). The filter was washed in 2× saline sodium citrate (SSC)-0.5% SDS at room temperature for 5 min, 2 × SSC-0.1% SDS at room temperature for 15 min, and 0.1× SSC- 0.5% SDS at 65° C for 30 min. The filter was exposed to radiographic film at 80° C.

Plasmid Construction

The 281 to +110 region of the IL-2R promoter was cloned by polymerase chain reaction (PCR) amplification of the 435 plasmid containing the 473 to +110 region of the IL-2R promoter linked to the chloramphenicol acetyltransferase (CAT) reporter gene. The 281 to +110 fragment of the IL-2R promoter was subcloned upstream of the CAT reporter gene for functional testing of the NF-B site in the context of the IL-2R promoter. To further define the role of the NF-B site, oligonucleotides containing the wild-type or mutant NF-B site of the IL-2R promoter were subcloned into the polylinker site upstream of the herpes virus thymidine kinase (TK) promoter linked to the CAT reporter gene. The oligonucleotide AGCTTTGGGGAATCTCCCTCTCCTTTTATGGGGATCC used to construct the 268W plasmid contained both an NF-B site (underlined/bold) and CArG site (italics). The 268S oligonucleotide AGCTTGGGGAATCTCCCTCTGGATCC contained only an NF-B site, whereas the 268MI oligonucleotide AGCTTGCCTCTTTCTT TTCTGGATCC contained mutant NF-B site (underlined). All plasmids were verified by DNA sequencing and purified through CsCl₂ centrifugation for transfections.

Transient Transfection and CAT Assays

THP-1 cells were transfected with DNA plasmids by the diethylaminoethyl (DEAE)-dextran method. 10⁷ cells were washed with Tris-buffered saline solution (S-TBS; 25 mM Tris [pH 7.5], 137 mM NaCl, 5 mM KCl, 1 mM Na₂HPO₄, 1.4 mM CaCl₂, 1 mM MgCl₂), incubated with 10 µg plasmids in S-TBS containing 500 µg/ml DEAE-dextran for 1 h at 37° C, and then shocked with 10% dimethyl sulfoxide (DMSO) for 5 min. Transfected cells were cultured in RPMI 1640 containing 2.5% FCS for 48 h. Cells were then incubated with inducing agents for another 24 h and lysed by three cycles of freezing-thawing. Equal amounts of protein were incubated with 0.1 µCi of [¹⁴C]chloramphenicol-250 mM Tris (pH 7.5)-120 µM of acetyl coenzyme A at 37° C for 5 h. After extraction with ethyl acetate, samples were spotted on thin-layer chromatography plate and separated in 95% chloroform and 5% methanol. The plate was air-dried and exposed to X-ray film.

Electrophoretic Mobility Shift Assays (EMSAs)

THP-1 cells were stimulated with H37Ra or LPS for 4 h and nuclear extracts were prepared from THP-1 cells as described previously (31). Briefly, cells were lysed in buffer A (10 mM HEPES, pH 7.9, 1.5 mM MgCl₂, 10 mM KCl, 0.5 mM dithiothreitol [DTT]) containing 0.1% Nonidet P-40 (NP-40) and 0.5 mM phenylmethylsulfonyl fluoride (PMSF) and centrifuged at 1,000 × g for 10 min at 4° C. The nuclei were extracted in buffer C (20 mM HEPES, pH 7.9, 25% glycerol, 0.42 M NaCl, 1.5 mM MgCl₂, 0.2 mM EDTA, 0.5 mM DTT, 0.5 mM PMSF) on ice for 30 min with shaking. The extracted nuclear proteins were frozen at 80° C until EMSA were performed. Double-stranded oligonucleotides were annealed and labeled with [-³²P]dCTP by Klenow fragment. Labeled probes (2 × 10⁴ cpm) were incubated with 20 µg of nuclear extracts in binding buffer [10 mM Tris, pH 7.5, 10 mM HEPES, pH 7.9, 50 mM KCl, 5 mM MgCl₂, 1 mM EDTA, 1.25 mM DTT, 2 µg of poly(dI-dC), 0.25 mM PMSF, and 10% glycerol] on ice for 15 min in the presence or absence of antibodies or excess cold oligonucleotide. The DNA-protein complexes were electrophoresed on a 5% polyacrylamide gel and analyzed by autoradiography.

	RESULTS

TOP ABSTRACT INTRODUCTION METHODS RESULTS DISCUSSION REFERENCES

Induction of IL-2R Expression in TB and in PBM by M. tuberculosis

Northern analysis of BAL cells lavaged from two normal control subjects and three patients with pulmonary TB revealed a striking upregulation of IL-2-R messenger RNA (mRNA) level (Figure 1A). In two patients in whom we were able to lavage an uninvolved lobe to compare with a radiographically involved lobe, the IL-2R mRNA was increased only in the involved lobes (Figure 2B). To control for RNA loading, the filters were hybridized with -actin, a housekeeping gene.

View larger version (40K): [in this window] [in a new window]   Figure 1.   Northern analysis of BAL cells from five patients with pulmonary TB and two normal control subjects. (A) Comparison of IL-2R gene expression between two normals and three TB patients. (B) Comparison of uninvolved to involved (+) lobes in two TB patients. The same filters were probed with -actin to control for RNA loading.

View larger version (16K): [in this window] [in a new window]   Figure 2.   Inducibility of surface expression of IL-2R in human PBM. Adherent monocytes were stimulated with heat-killed M. tuberculosis H37Ra (0.5 µg/ml), and LPS (2 µg/ml), and IFN- (500 U/ml), for 2 d. Surface expression of IL-2R was analyzed by FACS analysis using FITC-conjugated CD25 antibody and expressed as MFI.

To examine the effects of stimulation by mycobacterial components and heat-killed M. tuberculosis on the surface expression of IL-2R on PBMs, unstimulated and stimulated cells were incubated with anti-IL-2R (CD25) antibody conjugated to FITC and analyzed by fluorescent-activated cell sorter (FACS) analysis. Stimulation with heat-killed M. tuberculosis H37Ra resulted in a high level of surface expression of IL-2R, comparable to that induced with LPS (Figure 2). Costimulation of H37Ra or LPS with IFN- resulted in a further increase in IL-2R expression. Treatment with IFN- alone did not result in the induction of surface expression of IL-2R as compared with untreated cells. As controls for the nonspecific binding of Fc receptor, untreated and treated cells were incubated with FITC-conjugated IgG and analyzed by FACScan. MFI ranged from 14.3 to 19.2, similar to that of untreated and IFN--treated cells stained with FITC-CD25 antibody (MFI of 17.2 and 19.7, respectively).

To examine if induction of IL-2R expression occurred at the mRNA level, PBM were stimulated with H37Ra in the presence or absence of IFN- and total RNA were analyzed by Northern analysis. The expression of IL-2R mRNA (3.5 kb and 1.5 kb) in PBM was induced 12 h after stimulation with H37Ra (Figure 3). Consistent with the enhancing effect of IFN- on H37Ra-induced surface expression of IL-2R, induction of IL-2R mRNA expression was further enhanced by costimulation with H37Ra and IFN-. The same filter was then probed with cDNA encoding the housekeeping gene pHe7 to control for RNA loading.

View larger version (38K): [in this window] [in a new window]   Figure 3.   Northern blot analysis of IL-2R gene expression in monocytes after stimulation. Monocytes were stimulated with H37Ra in the absence or presence of IFN- for 12 h. The filter was probed with the IL-2R cDNA or the pHe7 housekeeping gene to control for RNA loading.

Role of NF-B in the Induction of IL-2R in THP-1 Cells

Because NF-B has been shown to be important for regulation of expression of the IL-2R gene in T cells, we were interested in investigating the role of NF-B as an enhancer of the IL-2R promoter in monocytic cells. IL-2 has previously been shown to act on PBM to enhance the binding activity of NF-B to the consensus sequence in the 5' regulatory region of the IL-2R promoter (27). To demonstrate the role of NF-B in the induction of IL-2R by M. tuberculosis, the 281 to +110 region of the IL-2R promoter containing the NF-B site was cloned upstream of the CAT reporter gene. This IL-2R-CAT construct was transfected into the human monocytic leukemia cell line THP-1 and assayed for CAT activities. As shown in Figure 4, stimulation with heat-killed M. tuberculosis H37Ra (lane 2) strongly enhanced CAT activity as compared with unstimulated cells (lane 1). Stimulation with live M. tuberculosis H37Rv at a 1:1 ratio (bacteria:cell) also increased CAT activity (lane 3) which was more enhanced by stimulation with live M. tuberculosis H37Rv at a 10:1 ratio (lane 4). Hence, both heat-killed and live M. tuberculosis induced the IL-2R promoter.

View larger version (100K): [in this window] [in a new window]   Figure 4.   Induction of IL-2R promoter by live and heat-killed M. tuberculosis H37Ra. THP-1 cells were transfected with IL-2R promoter linked to the CAT reporter gene. Transfected cells were unstimulated or stimulated with heat-killed M. tuberculosis H37Ra (2 µg/ml) (lane 2); live M. tuberculosis H37Rv at 1:1 ratio (bacteria:cell) (lane 3); and live M. tuberculosis H37Rv at 10:1 ratio (lane 4). Cytosolic extracts were assayed for CAT activities.

To further define the the role of the NF-B site, oligonucleotides containing the wild-type or mutant NF-B site were cloned upstream of the heterologous herpes TK promoter linked to the CAT reporter gene. These constructs were transfected into THP-1 cells and assayed for CAT activities. The role of the CArG motif which binds serum response factor (SRF) was also investigated because Kuang and coworkers (32) demonstrated that the SRF- and NF-B-binding elements together caused preferential expression of the IL-2R enhancer element in T cells. In addition, mutations of the CArG motif also resulted in decreased activity of the IL-2R promoter (33).

Transfection of the 268W construct (268 to 243) which contained both an NF-B site and CArG motif conferred inducibility of CAT activities in response to stimulation with H37Ra or LPS (Figure 5). To further define the role of NF-B, the 268S construct (268 to 254) which contained only the NF-B site was transfected into THP-1 cells. CAT activities were similarly enhanced upon stimulation with H37Ra or LPS. Hence, the CArG motif does not function as an enhancer in monocytic cells in response to stimulation by H37Ra or LPS. In contrast, inducibility of CAT activities by H37Ra or LPS was strongly reduced when the 268MI construct which contained mutations in the NF-B site was transfected into THP-1 cells, demonstrating that the NF-B site mediates induction in response to stimulation by M. tuberculosis or LPS.

View larger version (55K): [in this window] [in a new window]   Figure 5.   The NF-B site confers responsiveness of a heterologous TK promoter to stimulation by M. tuberculosis. THP-1 cells were transfected with the 268W, 268S, or 268MI plasmid containing the NF-B and CArG sites, NF-B site alone, and mutant NF-B site, respectively. Transfected cells were stimulated with H37Ra or LPS. Cytosolic extracts were assayed for CAT activities.

EMSA Analysis of the NF-B Protein-DNA Complexes

To investigate the protein-DNA complexes that bind to the NF-B enhancer element, EMSA were performed. Nuclear proteins isolated from unstimulated and stimulated THP-1 cells were incubated with end-labeled, double-stranded oligonucleotides containing the wild-type or mutant NF-B site in the presence or absence of cold competitors. After stimulation with LPS or H37Ra, enhanced binding of nuclear protein to the 268S probe containing the wild-type NF-B site was observed (Figure 6). To examine the specificity of binding of these nuclear proteins to the 268S oligonucleotide, competition experiments were performed by addition of excess cold oligonucleotides containing the wild-type or mutant NF-B site. Binding of nuclear protein to the 268S probe was completely abolished by competition with excess cold 268S oligonucleotide but not with cold 268MI oligonucleotide containing the mutant NF-B site. The specificity of binding of these nuclear proteins was further demonstrated by the absence of protein-DNA complexes when the 268MI probe was used in EMSA.

View larger version (48K): [in this window] [in a new window]   Figure 6.   Induction of binding of nuclear proteins to the NF-B site of the IL-2R promoter. THP-1 cells were unstimulated or stimulated with LPS or H37Ra and EMSA were performed by incubating nuclear extracts with labeled 268S probe containing the wild-type NF-B site or labeled 268MI probe containing mutant NF-B site. For the 268S probe, competition was performed by preincubation with excess unlabeled 268MI or 268S probe.

To further evaluate the involvement of the NF-B family of proteins, EMSAs were performed in the presence of antibodies directed against the p50 and p65 subunits. As shown in Figure 7, when EMSAs were performed in the absence of antibody, LPS or H37Ra induced the formation of two protein- DNA complexes (I and II). Preincubation of nuclear extracts with anti-p50 antibody reduced the formation of complex I and supershifted complex II to a slower-migrating protein- DNA complex. In contrast, addition of anti-p65 antibody reduced the formation of complex I without affecting the formation of complex II. These data suggest that complex II only contained p50 protein, probably as p50 homodimers, whereas complex I might be composed of both p50 and p65 proteins.

View larger version (41K): [in this window] [in a new window]   Figure 7.   Induction of binding of NF-B proteins to the NF-B site of the IL-2R promoter. Unstimulated or LPS- and H37Ra-stimulated THP-1 nuclear extracts were incubated with labeled 268S probe with or without preincubation with anti-p50 or anti-p65 antibody.

	DISCUSSION

TOP ABSTRACT INTRODUCTION METHODS RESULTS DISCUSSION REFERENCES

Soluble IL-2R has been reported to be increased in sera of patients with TB, especially those with advanced pulmonary radiologic lesions, and concentrations decline after antituberculous therapy (5, 34). Significantly increased levels are found in the pleural fluid compared with the sera in patients with tuberculous pleuritis (5). These investigators found no relationship between lack of response to PPD and soluble IL-2R levels. CD4⁺ cells from the pleural space of patients with tuberculous pleurisy secrete greater quantities of IFN- and IL-2 when stimulated with PPD of M. tuberculosis than the peripheral blood lymphocytes of the respective individuals (35). These data suggest active migration of T lymphocytes from the peripheral blood, and are consistent with cellular activation. In this context, BAL cells obtained from five TB patients had increased IL-2R gene expression compared with two normal control subjects.

Blood monocytes freshly isolated from patients with active pulmonary TB have been demonstrated to express functional IL-2R on their surface, perhaps due to exposure of monocytes to mycobacterial products. Toossi and coworkers (4) proposed that constitutive expression of functional IL-2R on monocytes from patients with TB and the increased release of IL-2R after exposure to mycobacterial products may contribute to antigen-specific suppression by adherent cells and depression of delayed-type hypersensitivity, as assessed by tuberculin skin tests. Interactions of IL-2 with monocyte IL-2R may also limit the availability of IL-2 for T cells, leading to depression of T-cell immune responses. However, interleukin-10 and transforming growth factor- may also contribute to depressed cellular immune responses in TB (36, 37). When monocytes are cultured with IL-2, both superoxide generation and cytotoxicity against the extracellular protozoa Giardia lamblia are enhanced (15). In addition, intracellular killing of M. avium complex by monocytes is potentiated when IL-2 is added along with TNF, suggesting that interactions of IL-2 with IL-2R may contribute to microbicidal host defenses (10).

Because expression of IL-2R is important for the formation of high-affinity IL-2 binding sites, induction of expression of IL-2R may be critical for monocytes to respond to the low concentration of IL-2 that may be found in vivo in the microenvironments. Hence, studying the molecular mechanism of IL-2R gene regulation by in vitro stimulation with M. tuberculosis is important for understanding the immunomodulatory role and effector function of monocytes during tuberculosis. We have previously shown that both NF-B and NF-IL6 sites are involved in mediating response of the IL-6 promoter to stimulation by cell wall components of mycobacteria (38). We have shown here that expression of both IL-2R mRNA and protein can be induced by M. tuberculosis. We have also shown that, similar to that in T cells (39), NF-B plays an important role in the positive regulation of IL-2R gene expression in monocytes stimulated by M. tuberculosis. Mutations of the NF-B site abolished both response to stimulation by M. tuberculosis and specific binding of nuclear proteins to the NF-B site. Using antibodies directed against p50 and p65 proteins, binding of the p50 homodimer and p50/p65 heterodimer to the NF-B site was also demonstrated. It is likely that the constitutive expression of IL-2R on monocytes from patients with tuberculosis may be due to activation of NF-B by mycobacterial products in vivo.

An essential role for NF-B in preventing TNF--induced apoptosis has recently been described (40). Intracellular infection by Leishmania donovani has been shown to inhibit macrophage apoptosis (43). Because M. tuberculosis can activate NF-B and induction of apoptosis of infected monocytes resulted in killing of intracellular bacillus Calmette-Guérin and reduced viability of M. avium-M. intracellulare (44, 45), activation of NF-B may be a protective mechanism for the survival of M. tuberculosis. Further studies to test this hypothesis in vivo would be of interest.

We recently demonstrated that a subgroup of pulmonary TB patients have an enrichment of CD4⁺ cells with a T helper cell, type 1 (Th1) response in the involved segments (46, 47). BAL cells from this subgroup released IFN-, and not IL-4. At presentation, these patients had less clinically and radiographically advanced TB (smear-negative, noncavitary disease). Treatment of five patients with multidrug-resistant TB by aerosolized IFN- converted sputum acid-fast bacillus smears from positive to negative (48). Because IL-2 release is also part of the Th1 response, IL-2 has been administered subcutaneously to multidrug-resistant TB patients or acquired immunodeficiency syndrome (AIDS) patients to augment the Th1 response (49, 50). Clinical responses included reduction of bacillary load accompanied by radiographic improvement in multidrug-resistant TB patients and prevention of opportunistic infections in AIDS patients. This was a result of increased IL-2R on T cells (increased CD25⁺ cells), increased natural killer cells (CD56⁺ cells), and enhanced expression of the IFN- gene (49, 50). Exogenous administration of Th1 cytokines likely increases IL-2R augmenting the Th1 response, leading toward a more propitious clinical response to mycobacterial infection (51).