help button home button
AJRCCM
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by TCHOU-WONG, K.-M.
Right arrow Articles by ROM, W. N.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by TCHOU-WONG, K.-M.
Right arrow Articles by ROM, W. N.
Am. J. Respir. Crit. Care Med., Volume 159, Number 4, April 1999, 1323-1329

Activation of NF-kappa B in Mycobacterium tuberculosis- induced Interleukin-2 Receptor Expression in Mononuclear Phagocytes

KAM-MENG TCHOU-WONG, OSAMU TANABE, CHUANXIANG CHI, TING-AN YIE, and WILLIAM N. ROM

Division of Pulmonary and Critical Care Medicine, Departments of Medicine, Microbiology, and Environmental Medicine, New York University Medical Center, New York, New York

    ABSTRACT
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES

Soluble interleukin-2 receptor-alpha (IL-2Ralpha ) has been reported to be increased in the sera of patients with advanced tuberculosis, and levels decline after therapy in accordance with improvement of radiologic findings. We investigated expression of the IL-2Ralpha in bronchoalveolar lavage (BAL) cells in active pulmonary tuberculosis, and evaluated the mechanism Mycobacterium tuberculosis induces in the IL-2Ralpha using the THP-1 mononuclear phagocyte cell line. We found IL-2Ralpha expression to be increased in BAL cells from involved sites of active pulmonary tuberculosis. Expression of the alpha -chain of IL-2Ralpha on peripheral blood monocytes (PBM) was induced by M. tuberculosis by flow cytometry evaluation. Northern analysis demonstrated increased IL-2Ralpha gene expression after stimulation with M. tuberculosis which was further induced by interferon-gamma (IFN-gamma ). The IL-2Ralpha promoter containing the nuclear factor kappa B (NF-kappa B) site was transcriptionally induced by M. tuberculosis and this NF-kappa B site could confer inducibility to a heterologous herpes thymidine kinase (TK) promoter by M. tuberculosis. Electrophoretic mobility shift assays (EMSAs) revealed specific binding of nuclear protein to the NF-kappa B site upon induction with M. tuberculosis. Using antibodies against the p50 and p65 subunits of NF-kappa B in EMSAs, the involvement of both p50 and p65 proteins was further demonstrated. Functional expression of the IL-2Ralpha on mononuclear phagocytes in M. tuberculosis infection may play an important immunomodulatory role in the host response.

    INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES

Tuberculosis (TB) has been labeled a global emergency by the World Health Organization because of the large number of infected persons and the reduced host defenses among those with human immunodeficiency virus-1 (HIV-1) infection. Successful control of Mycobacterium tuberculosis in animal models has been characterized by CD4+ lymphocytes releasing interleukin-2 (IL-2) and interferon-gamma (IFN-gamma ) (1, 2). IL-2 activity in response to purified protein derivative (PPD) and expression of IL-2 receptors (IL-2R) on peripheral blood mononuclear cells (PBMC) of TB patients have been found to be reduced (3); in contrast, expression of IL-2 on adherent cells isolated from TB patients is markedly increased (4). In addition, soluble IL-2R are increased in the sera of patients with TB, and levels decline after antituberculous therapy (5).

Blood monocytes from patients with TB express functional IL-2R constitutively, and the functional expression of IL-2R on monocytes has been proposed by Toossi and coworkers (4) to limit the availability of IL-2 for T-cells, leading to depression of T-cell immune responses. In this context, the lack of a delayed skin test reaction to the mycobacterial antigen tuberculin PPD has been observed in some patients with active tuberculosis (6, 7), and is associated with the failure of T cells to proliferate in response to M. tuberculosis antigens (8). Peripheral blood monocytes (PBM) from patients with active pulmonary TB have also been shown to selectively depress lymphocyte responses to PPD (8, 9). Depletion of adherent monocytes increased IL-2 activity of supernatants of PPD-stimulated T-cell cultures. We have demonstrated that PBMC of TB patients had 10-fold fewer IL-2-responsive cells than that of control subjects (3). In addition to the immunomodulatory role of monocyte IL-2R expression, interactions of IL-2 with its receptors may also play a role in microbicidal host defenses because intracellular killing of M. avium complex by monocytes has been demonstrated to be enhanced in the presence of tumor necrosis factor-alpha (TNF-alpha ) and IL-2 (10).

Activation of human PBM results in induction of expression of the gene encoding the alpha  chain of interleukin-2 receptor (IL-2Ralpha ) (11). IL-2R is composed of three distinct membrane components: the alpha , beta , and gamma  chains (16). IL-2Rbeta and IL-2Rgamma are constitutively expressed on freshly isolated human monocytes and are sufficient to trigger activation of monocytes by IL-2 (17). The alpha  chain is not constitutively expressed in monocytes but can be induced by lipopolysaccharide (LPS) or IFN-gamma but not by IL-2 (11, 21). LPS and IFN-gamma were additive in augmenting IL-2Ralpha expression (12). Expression of IL-2Ralpha is important for the formation of high-affinity binding sites for IL-2 (16). Expression of IL-2Ralpha may therefore function as an on-off switch that determines whether monocytes will respond to the low concentration of IL-2 found in vivo in the monocyte microenvironments. IL-2, originally described as a T-cell growth factor, is a powerful activator of human monocytes which respond to IL-2 with microbicidal and tumoricidal activities, cytokine production, and expression of growth factor receptors (22, 23).

The transcription factor, nuclear factor kappa B (NF-kappa B) is a protein complex that enables a variety of genes to be rapidly induced in response to extracellular stimuli (24). NF-kappa B is activated by antigens, viruses, bacteria, prooxidants, and inflammatory lymphokines and participates in the transcriptional initiation of diverse genes important in immune and inflammatory responses such as IL-1, -2, -6, -8, IL-2Ralpha , adhesion molecules, major histocompatibility class I molecules, and immunoglobulin kappa  light chain (25). NF-kappa B is formed by the noncovalent association of the p50 and p65 subunits which, upon cellular activation, translocates to the nucleus and binds to the NF-kappa B enhancer element. Transcriptional stimulation of the IL-2Ralpha gene can be induced upon T-cell activation and the role of NF-kappa B in the positive regulation of IL-2Ralpha expression in T cells has been well established (26). Activation of NF-kappa B by IL-2 in human blood monocytes also results in functional activation of a heterologous promoter containing the IL-2Ralpha enhancer element (29). Because increased release of soluble IL-2Ralpha has been demonstrated in TB patients, we studied the molecular mechanism of IL-2Ralpha gene regulation by M. tuberculosis.

    METHODS
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES

Study Population

Bronchoalveolar lavage (BAL) was performed on five patients with active pulmonary TB confirmed by culture of M. tuberculosis in the sputum or pleural fluid. The protocol was approved by Human Subjects Review Committees at New York University Medical Center and Bellevue Hospital. We also evaluated two normal volunteers with normal chest radiographs, pulmonary function tests, and physical examinations. Both were nonsmokers; their mean age was 36 and 38 yr respectively; both were HIV-negative, and the normal controls were PPD-negative. All TB patients were PPD-positive and HIV-negative. BAL was performed in involved and uninvolved lobes as previously described in two patients (30). Cytospins revealed > 80% macrophages in all lavages.

Cell Culture and Reagents

PBMCs from healthy PPD-negative volunteers were isolated by sedimentation over Lymphocyte Separation Medium (Organon Teknika, West Chester, PA). PBM were isolated by plastic adherence on plastic dish for 1 h at 37° C. After removing nonadherent cells, the adherent cells were washed twice with phosphate-buffered saline (PBS) and dislodged by gentle scraping and resuspended in RPMI 1640 supplemented with 10% heat-inactivated fetal calf serum (FCS) plus penicillin and streptomycin, and were > 95% monocytes by esterase staining. The human myelomonocytic leukemic cell line THP-1 was purchased from American Type Culture Collection (Rockville, MD) and cultured in RPMI 1640 medium supplemented with 10% FCS. Cells were stimulated with heat-killed M. tuberculosis H37Ra (Difco, Detroit, MI) which had been tested to be endotoxin-free (< 5 pg/ml) by amebocyte lysate assay (E-Toxate kit; Sigma, St. Louis, MO) or live M. tuberculosis H37Rv. LPS 055 was purchased from Sigma and IFN-gamma was a gift from Genentech, Inc. (South San Francisco, CA). Anti-p50 and anti-p65 antibodies were purchased from Santa Cruz (Santa Cruz, CA).

Measurement of Surface IL-2 Receptor Expression

2 × 106 PBM were incubated for 48 h in the presence or absence of inducing agents. Cells were washed with PBS, resuspended in RPMI 1640 with 1% fetal bovine serum (FBS), 15 mM HEPES (pH 7.9), and 0.1% sodium azide and incubated with fluorescein isothiocyanate (FITC)-conjugated CD25 antibody (anti-IL-2Ralpha ) (Becton Dickinson, San Jose, CA) on ice for 30 min. Cells were washed and analyzed by FACScan (Becton Dickinson). Surface IL-2Ralpha expression was quantitated and represented as mean fluorescence intensities (MFIs).

Northern Blot Analysis

PBM were stimulated with H37Ra in the presence or absence of IFN-gamma for 12 h. Cytoplasmic RNA from BAL cells from TB patients or normal control subjects was isolated by the guanidine thiocyanate-cesium chloride (CsCl2) centrifugation method. Equal amounts of RNA were fractionated by electrophoresis through 0.8% agarose/formaldehyde gel and transferred onto nylon membrane (Hybond N; Amersham, Arlington Heights, IL). The membrane was hybridized at 65° C in Church buffer (7% sodium dodecylsulfate [SDS], 1% bovine serum albumin [BSA], 1 mM ethylenediaminetetraacetic acid [EDTA], 0.25 M Na2HPO4) containing the IL-2Ralpha or pHe7 complementary DNA (cDNA) radiolabeled by random priming with radioactive phosphorus-deoxycytidine triphosphate ([alpha -32P]dCTP). The filter was washed in 2× saline sodium citrate (SSC)-0.5% SDS at room temperature for 5 min, 2 × SSC-0.1% SDS at room temperature for 15 min, and 0.1× SSC- 0.5% SDS at 65° C for 30 min. The filter was exposed to radiographic film at -80° C.

Plasmid Construction

The -281 to +110 region of the IL-2Ralpha promoter was cloned by polymerase chain reaction (PCR) amplification of the 435 plasmid containing the -473 to +110 region of the IL-2Ralpha promoter linked to the chloramphenicol acetyltransferase (CAT) reporter gene. The -281 to +110 fragment of the IL-2Ralpha promoter was subcloned upstream of the CAT reporter gene for functional testing of the NF-kappa B site in the context of the IL-2Ralpha promoter. To further define the role of the NF-kappa B site, oligonucleotides containing the wild-type or mutant NF-kappa B site of the IL-2Ralpha promoter were subcloned into the polylinker site upstream of the herpes virus thymidine kinase (TK) promoter linked to the CAT reporter gene. The oligonucleotide AGCTTTGGGGAATCTCCCTCTCCTTTTATGGGGATCC used to construct the 268W plasmid contained both an NF-kappa B site (underlined/bold) and CArG site (italics). The 268S oligonucleotide AGCTTGGGGAATCTCCCTCTGGATCC contained only an NF-kappa B site, whereas the 268MI oligonucleotide AGCTTGCCTCTTTCTT TTCTGGATCC contained mutant NF-kappa B site (underlined). All plasmids were verified by DNA sequencing and purified through CsCl2 centrifugation for transfections.

Transient Transfection and CAT Assays

THP-1 cells were transfected with DNA plasmids by the diethylaminoethyl (DEAE)-dextran method. 107 cells were washed with Tris-buffered saline solution (S-TBS; 25 mM Tris [pH 7.5], 137 mM NaCl, 5 mM KCl, 1 mM Na2HPO4, 1.4 mM CaCl2, 1 mM MgCl2), incubated with 10 µg plasmids in S-TBS containing 500 µg/ml DEAE-dextran for 1 h at 37° C, and then shocked with 10% dimethyl sulfoxide (DMSO) for 5 min. Transfected cells were cultured in RPMI 1640 containing 2.5% FCS for 48 h. Cells were then incubated with inducing agents for another 24 h and lysed by three cycles of freezing-thawing. Equal amounts of protein were incubated with 0.1 µCi of [14C]chloramphenicol-250 mM Tris (pH 7.5)-120 µM of acetyl coenzyme A at 37° C for 5 h. After extraction with ethyl acetate, samples were spotted on thin-layer chromatography plate and separated in 95% chloroform and 5% methanol. The plate was air-dried and exposed to X-ray film.

Electrophoretic Mobility Shift Assays (EMSAs)

THP-1 cells were stimulated with H37Ra or LPS for 4 h and nuclear extracts were prepared from THP-1 cells as described previously (31). Briefly, cells were lysed in buffer A (10 mM HEPES, pH 7.9, 1.5 mM MgCl2, 10 mM KCl, 0.5 mM dithiothreitol [DTT]) containing 0.1% Nonidet P-40 (NP-40) and 0.5 mM phenylmethylsulfonyl fluoride (PMSF) and centrifuged at 1,000 × g for 10 min at 4° C. The nuclei were extracted in buffer C (20 mM HEPES, pH 7.9, 25% glycerol, 0.42 M NaCl, 1.5 mM MgCl2, 0.2 mM EDTA, 0.5 mM DTT, 0.5 mM PMSF) on ice for 30 min with shaking. The extracted nuclear proteins were frozen at -80° C until EMSA were performed. Double-stranded oligonucleotides were annealed and labeled with [alpha -32P]dCTP by Klenow fragment. Labeled probes (2 × 104 cpm) were incubated with 20 µg of nuclear extracts in binding buffer [10 mM Tris, pH 7.5, 10 mM HEPES, pH 7.9, 50 mM KCl, 5 mM MgCl2, 1 mM EDTA, 1.25 mM DTT, 2 µg of poly(dI-dC), 0.25 mM PMSF, and 10% glycerol] on ice for 15 min in the presence or absence of antibodies or excess cold oligonucleotide. The DNA-protein complexes were electrophoresed on a 5% polyacrylamide gel and analyzed by autoradiography.

    RESULTS
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES

Induction of IL-2Ralpha Expression in TB and in PBM by M. tuberculosis

Northern analysis of BAL cells lavaged from two normal control subjects and three patients with pulmonary TB revealed a striking upregulation of IL-2-Ralpha messenger RNA (mRNA) level (Figure 1A). In two patients in whom we were able to lavage an uninvolved lobe to compare with a radiographically involved lobe, the IL-2Ralpha mRNA was increased only in the involved lobes (Figure 2B). To control for RNA loading, the filters were hybridized with beta -actin, a housekeeping gene.


View larger version (40K):
[in this window]
[in a new window]
 
Figure 1.   Northern analysis of BAL cells from five patients with pulmonary TB and two normal control subjects. (A) Comparison of IL-2Ralpha gene expression between two normals and three TB patients. (B) Comparison of uninvolved to involved (+) lobes in two TB patients. The same filters were probed with beta -actin to control for RNA loading.


View larger version (16K):
[in this window]
[in a new window]
 
Figure 2.   Inducibility of surface expression of IL-2Ralpha in human PBM. Adherent monocytes were stimulated with heat-killed M. tuberculosis H37Ra (0.5 µg/ml), and LPS (2 µg/ml), and IFN-gamma (500 U/ml), for 2 d. Surface expression of IL-2Ralpha was analyzed by FACS analysis using FITC-conjugated CD25 antibody and expressed as MFI.

To examine the effects of stimulation by mycobacterial components and heat-killed M. tuberculosis on the surface expression of IL-2Ralpha on PBMs, unstimulated and stimulated cells were incubated with anti-IL-2Ralpha (CD25) antibody conjugated to FITC and analyzed by fluorescent-activated cell sorter (FACS) analysis. Stimulation with heat-killed M. tuberculosis H37Ra resulted in a high level of surface expression of IL-2Ralpha , comparable to that induced with LPS (Figure 2). Costimulation of H37Ra or LPS with IFN-gamma resulted in a further increase in IL-2Ralpha expression. Treatment with IFN-gamma alone did not result in the induction of surface expression of IL-2Ralpha as compared with untreated cells. As controls for the nonspecific binding of Fc receptor, untreated and treated cells were incubated with FITC-conjugated IgG and analyzed by FACScan. MFI ranged from 14.3 to 19.2, similar to that of untreated and IFN-gamma -treated cells stained with FITC-CD25 antibody (MFI of 17.2 and 19.7, respectively).

To examine if induction of IL-2Ralpha expression occurred at the mRNA level, PBM were stimulated with H37Ra in the presence or absence of IFN-gamma and total RNA were analyzed by Northern analysis. The expression of IL-2Ralpha mRNA (3.5 kb and 1.5 kb) in PBM was induced 12 h after stimulation with H37Ra (Figure 3). Consistent with the enhancing effect of IFN-gamma on H37Ra-induced surface expression of IL-2Ralpha , induction of IL-2Ralpha mRNA expression was further enhanced by costimulation with H37Ra and IFN-gamma . The same filter was then probed with cDNA encoding the housekeeping gene pHe7 to control for RNA loading.


View larger version (38K):
[in this window]
[in a new window]
 
Figure 3.   Northern blot analysis of IL-2Ralpha gene expression in monocytes after stimulation. Monocytes were stimulated with H37Ra in the absence or presence of IFN-gamma for 12 h. The filter was probed with the IL-2Ralpha cDNA or the pHe7 housekeeping gene to control for RNA loading.

Role of NF-kappa B in the Induction of IL-2Ralpha in THP-1 Cells

Because NF-kappa B has been shown to be important for regulation of expression of the IL-2Ralpha gene in T cells, we were interested in investigating the role of NF-kappa B as an enhancer of the IL-2Ralpha promoter in monocytic cells. IL-2 has previously been shown to act on PBM to enhance the binding activity of NF-kappa B to the consensus sequence in the 5' regulatory region of the IL-2Ralpha promoter (27). To demonstrate the role of NF-kappa B in the induction of IL-2Ralpha by M. tuberculosis, the -281 to +110 region of the IL-2Ralpha promoter containing the NF-kappa B site was cloned upstream of the CAT reporter gene. This IL-2Ralpha -CAT construct was transfected into the human monocytic leukemia cell line THP-1 and assayed for CAT activities. As shown in Figure 4, stimulation with heat-killed M. tuberculosis H37Ra (lane 2) strongly enhanced CAT activity as compared with unstimulated cells (lane 1). Stimulation with live M. tuberculosis H37Rv at a 1:1 ratio (bacteria:cell) also increased CAT activity (lane 3) which was more enhanced by stimulation with live M. tuberculosis H37Rv at a 10:1 ratio (lane 4). Hence, both heat-killed and live M. tuberculosis induced the IL-2Ralpha promoter.


View larger version (100K):
[in this window]
[in a new window]
 
Figure 4.   Induction of IL-2Ralpha promoter by live and heat-killed M. tuberculosis H37Ra. THP-1 cells were transfected with IL-2Ralpha promoter linked to the CAT reporter gene. Transfected cells were unstimulated or stimulated with heat-killed M. tuberculosis H37Ra (2 µg/ml) (lane 2); live M. tuberculosis H37Rv at 1:1 ratio (bacteria:cell) (lane 3); and live M. tuberculosis H37Rv at 10:1 ratio (lane 4). Cytosolic extracts were assayed for CAT activities.

To further define the the role of the NF-kappa B site, oligonucleotides containing the wild-type or mutant NF-kappa B site were cloned upstream of the heterologous herpes TK promoter linked to the CAT reporter gene. These constructs were transfected into THP-1 cells and assayed for CAT activities. The role of the CArG motif which binds serum response factor (SRF) was also investigated because Kuang and coworkers (32) demonstrated that the SRF- and NF-kappa B-binding elements together caused preferential expression of the IL-2R enhancer element in T cells. In addition, mutations of the CArG motif also resulted in decreased activity of the IL-2Ralpha promoter (33).

Transfection of the 268W construct (-268 to -243) which contained both an NF-kappa B site and CArG motif conferred inducibility of CAT activities in response to stimulation with H37Ra or LPS (Figure 5). To further define the role of NF-kappa B, the 268S construct (-268 to -254) which contained only the NF-kappa B site was transfected into THP-1 cells. CAT activities were similarly enhanced upon stimulation with H37Ra or LPS. Hence, the CArG motif does not function as an enhancer in monocytic cells in response to stimulation by H37Ra or LPS. In contrast, inducibility of CAT activities by H37Ra or LPS was strongly reduced when the 268MI construct which contained mutations in the NF-kappa B site was transfected into THP-1 cells, demonstrating that the NF-kappa B site mediates induction in response to stimulation by M. tuberculosis or LPS.


View larger version (55K):
[in this window]
[in a new window]
 
Figure 5.   The NF-kappa B site confers responsiveness of a heterologous TK promoter to stimulation by M. tuberculosis. THP-1 cells were transfected with the 268W, 268S, or 268MI plasmid containing the NF-kappa B and CArG sites, NF-kappa B site alone, and mutant NF-kappa B site, respectively. Transfected cells were stimulated with H37Ra or LPS. Cytosolic extracts were assayed for CAT activities.

EMSA Analysis of the NF-kappa B Protein-DNA Complexes

To investigate the protein-DNA complexes that bind to the NF-kappa B enhancer element, EMSA were performed. Nuclear proteins isolated from unstimulated and stimulated THP-1 cells were incubated with end-labeled, double-stranded oligonucleotides containing the wild-type or mutant NF-kappa B site in the presence or absence of cold competitors. After stimulation with LPS or H37Ra, enhanced binding of nuclear protein to the 268S probe containing the wild-type NF-kappa B site was observed (Figure 6). To examine the specificity of binding of these nuclear proteins to the 268S oligonucleotide, competition experiments were performed by addition of excess cold oligonucleotides containing the wild-type or mutant NF-kappa B site. Binding of nuclear protein to the 268S probe was completely abolished by competition with excess cold 268S oligonucleotide but not with cold 268MI oligonucleotide containing the mutant NF-kappa B site. The specificity of binding of these nuclear proteins was further demonstrated by the absence of protein-DNA complexes when the 268MI probe was used in EMSA.


View larger version (48K):
[in this window]
[in a new window]
 
Figure 6.   Induction of binding of nuclear proteins to the NF-kappa B site of the IL-2Ralpha promoter. THP-1 cells were unstimulated or stimulated with LPS or H37Ra and EMSA were performed by incubating nuclear extracts with labeled 268S probe containing the wild-type NF-kappa B site or labeled 268MI probe containing mutant NF-kappa B site. For the 268S probe, competition was performed by preincubation with excess unlabeled 268MI or 268S probe.

To further evaluate the involvement of the NF-kappa B family of proteins, EMSAs were performed in the presence of antibodies directed against the p50 and p65 subunits. As shown in Figure 7, when EMSAs were performed in the absence of antibody, LPS or H37Ra induced the formation of two protein- DNA complexes (I and II). Preincubation of nuclear extracts with anti-p50 antibody reduced the formation of complex I and supershifted complex II to a slower-migrating protein- DNA complex. In contrast, addition of anti-p65 antibody reduced the formation of complex I without affecting the formation of complex II. These data suggest that complex II only contained p50 protein, probably as p50 homodimers, whereas complex I might be composed of both p50 and p65 proteins.


View larger version (41K):
[in this window]
[in a new window]
 
Figure 7.   Induction of binding of NF-kappa B proteins to the NF-kappa B site of the IL-2Ralpha promoter. Unstimulated or LPS- and H37Ra-stimulated THP-1 nuclear extracts were incubated with labeled 268S probe with or without preincubation with anti-p50 or anti-p65 antibody.

    DISCUSSION
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES

Soluble IL-2Ralpha has been reported to be increased in sera of patients with TB, especially those with advanced pulmonary radiologic lesions, and concentrations decline after antituberculous therapy (5, 34). Significantly increased levels are found in the pleural fluid compared with the sera in patients with tuberculous pleuritis (5). These investigators found no relationship between lack of response to PPD and soluble IL-2Ralpha levels. CD4+ cells from the pleural space of patients with tuberculous pleurisy secrete greater quantities of IFN-gamma and IL-2 when stimulated with PPD of M. tuberculosis than the peripheral blood lymphocytes of the respective individuals (35). These data suggest active migration of T lymphocytes from the peripheral blood, and are consistent with cellular activation. In this context, BAL cells obtained from five TB patients had increased IL-2Ralpha gene expression compared with two normal control subjects.

Blood monocytes freshly isolated from patients with active pulmonary TB have been demonstrated to express functional IL-2R on their surface, perhaps due to exposure of monocytes to mycobacterial products. Toossi and coworkers (4) proposed that constitutive expression of functional IL-2R on monocytes from patients with TB and the increased release of IL-2R after exposure to mycobacterial products may contribute to antigen-specific suppression by adherent cells and depression of delayed-type hypersensitivity, as assessed by tuberculin skin tests. Interactions of IL-2 with monocyte IL-2R may also limit the availability of IL-2 for T cells, leading to depression of T-cell immune responses. However, interleukin-10 and transforming growth factor-beta may also contribute to depressed cellular immune responses in TB (36, 37). When monocytes are cultured with IL-2, both superoxide generation and cytotoxicity against the extracellular protozoa Giardia lamblia are enhanced (15). In addition, intracellular killing of M. avium complex by monocytes is potentiated when IL-2 is added along with TNF, suggesting that interactions of IL-2 with IL-2R may contribute to microbicidal host defenses (10).

Because expression of IL-2Ralpha is important for the formation of high-affinity IL-2 binding sites, induction of expression of IL-2Ralpha may be critical for monocytes to respond to the low concentration of IL-2 that may be found in vivo in the microenvironments. Hence, studying the molecular mechanism of IL-2Ralpha gene regulation by in vitro stimulation with M. tuberculosis is important for understanding the immunomodulatory role and effector function of monocytes during tuberculosis. We have previously shown that both NF-kappa B and NF-IL6 sites are involved in mediating response of the IL-6 promoter to stimulation by cell wall components of mycobacteria (38). We have shown here that expression of both IL-2Ralpha mRNA and protein can be induced by M. tuberculosis. We have also shown that, similar to that in T cells (39), NF-kappa B plays an important role in the positive regulation of IL-2Ralpha gene expression in monocytes stimulated by M. tuberculosis. Mutations of the NF-kappa B site abolished both response to stimulation by M. tuberculosis and specific binding of nuclear proteins to the NF-kappa B site. Using antibodies directed against p50 and p65 proteins, binding of the p50 homodimer and p50/p65 heterodimer to the NF-kappa B site was also demonstrated. It is likely that the constitutive expression of IL-2R on monocytes from patients with tuberculosis may be due to activation of NF-kappa B by mycobacterial products in vivo.

An essential role for NF-kappa B in preventing TNF-alpha -induced apoptosis has recently been described (40). Intracellular infection by Leishmania donovani has been shown to inhibit macrophage apoptosis (43). Because M. tuberculosis can activate NF-kappa B and induction of apoptosis of infected monocytes resulted in killing of intracellular bacillus Calmette-Guérin and reduced viability of M. avium-M. intracellulare (44, 45), activation of NF-kappa B may be a protective mechanism for the survival of M. tuberculosis. Further studies to test this hypothesis in vivo would be of interest.

We recently demonstrated that a subgroup of pulmonary TB patients have an enrichment of CD4+ cells with a T helper cell, type 1 (Th1) response in the involved segments (46, 47). BAL cells from this subgroup released IFN-gamma , and not IL-4. At presentation, these patients had less clinically and radiographically advanced TB (smear-negative, noncavitary disease). Treatment of five patients with multidrug-resistant TB by aerosolized IFN-gamma converted sputum acid-fast bacillus smears from positive to negative (48). Because IL-2 release is also part of the Th1 response, IL-2 has been administered subcutaneously to multidrug-resistant TB patients or acquired immunodeficiency syndrome (AIDS) patients to augment the Th1 response (49, 50). Clinical responses included reduction of bacillary load accompanied by radiographic improvement in multidrug-resistant TB patients and prevention of opportunistic infections in AIDS patients. This was a result of increased IL-2R on T cells (increased CD25+ cells), increased natural killer cells (CD56+ cells), and enhanced expression of the IFN-gamma gene (49, 50). Exogenous administration of Th1 cytokines likely increases IL-2R augmenting the Th1 response, leading toward a more propitious clinical response to mycobacterial infection (51).

    Footnotes

Correspondence and requests for reprints should be addressed to Kam-Meng Tchou-Wong, Ph.D., New York University Medical Center, Division of Pulmonary and Critical Care Medicine, 550 First Avenue, MSB 147, New York, NY 10016.

(Received in original form October 31, 1997 and in revised form October 8, 1998).

O. Tanabe is currently at the Jikei University School of Medicine, Department of Internal Medicine, Tokyo, Japan

Acknowledgments: The authors thank Natalie Little for editorial assistance.

Supported by Grants MO1 00096, HL59832, HL62055, and CDC CCU210075 to W.R., and ES09161 and an American Lung Association Research grant to K-M.T-W.

    References
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES

1. Orme, I. M., A. D. Roberts, J. P. Griffin, and J. S. Abrams. 1993. Cytokine secretion by CD4 T lymphocytes acquired in response to Mycobacterium tuberculosis infection. J. Immunol. 151: 518-525 [Abstract].

2. Cooper, A. M., D. K. Dalton, T. A. Stewart, J. P. Griffin, D. G. Russell, and I. M. Orme. 1993. Disseminated tuberculosis in interferon gamma  gene disrupted mice. J. Exp. Med. 173: 2243-2247 .

3. Schauf, V., W. N. Rom, K. A. Smith, W. P. Sampaio, P. A. Meyn, J. M. Tramontana, Z. A. Cohn, and G. Kaplan. 1993. Cytokine gene activation and modified responsiveness to interleukin-2 in the blood of tuberculosis patients. J. Infect. Dis. 168: 1056-1059 [Medline].

4. Toossi, Z., J. R. Sedor, J. P. Lapurga, R. J. Ondash, and J. J. Ellner. 1990. Expression of functional interleukin 2 receptors by peripheral blood monocytes from patients with active pulmonary tuberculosis. J. Clin. Invest. 85: 1777-1784 .

5. Takahashi, S., Y. Setoguchi, T. Nukiwa, and S. Kira. 1991. Soluble interleukin-2 receptor in sera of patients with pulmonary tuberculosis. Chest 99: 310-314 [Abstract/Free Full Text].

6. Holden, M., M. R. Dublin, and P. H. Diamond. 1971. Frequency of negative intermediate-strength tuberculin sensitivity in patients with active tuberculosis. N. Engl. J. Med. 285: 1506-1509 .

7. Nash, D. R., and J. E. Douglas. 1980. Anergy in active pulmonary tuberculosis. Chest 77: 32-37 [Abstract/Free Full Text].

8. Ellner, J. J.. 1978. Suppressor adherent cells in human tuberculosis. J. Immunol. 121: 2573-2579 [Abstract/Free Full Text].

9. Toossi, Z., M. E. Kleinheinz, and J. J. Ellner. 1986. Defective interleukin 2 production and responsiveness in human pulmonary tuberculosis. J. Exp. Med. 163: 1162-1172 [Abstract/Free Full Text].

10. Bermudez, L. E. M., and L. S. Young. 1988. Tumor necrosis factor, alone or in combination with IL-2, but not IFN-gamma , is associated with macrophage killing of Mycobacterium avium complex. J. Immunol. 140: 3006-3013 [Abstract].

11. Herrmann, J., S. A. Cannistra, H. Levine, and J. D. Griffin. 1985. Expression of interleukin 2 receptors and binding of interleukin 2 by gamma interferon-induced human leukemic and normal monocytic cells. J. Exp. Med. 162: 1111-1116 [Abstract/Free Full Text].

12. Holter, W., C. K. Goldman, L. Casabo, D. L. Nelson, W. C. Greene, and T. A. Waldmann. 1987. Expression of functional IL 2 receptors by lipopolysaccharide and interferon-gamma stimulated human monocytes. J. Immunol. 138: 2917-2922 [Abstract].

13. Holter, W., R. Grunow, H. Stockinger, and W. Knapp. 1986. Recombinant interferon-gamma induces interleukin 2 receptors on human peripheral blood monocytes. J. Immunol. 136: 2171-2175 [Abstract].

14. Rambaldi, A., D. C. Young, F. Herrmann, S. A. Cannistra, and J. D. Griffin. 1987. Interferon-gamma induces expression induction of the interleukin 2 receptor gene in human monocytes. Eur. J. Immunol. 17: 153-156 [Medline].

15. Wahl, S. M., N. McCartney-Francis, D. A. Hunt, P. D. Smith, L. M. Wahl, and I. M. Katona. 1987. Monocyte interleukin 2 receptor gene expression and interleukin 2 augmentation of microbicidal activity. J. Immunol. 139: 1342-1347 [Abstract].

16. Taniguchi, T., and Y. Minami. 1993. The IL-2/IL-2 receptor system: a current overview. Cell 73: 5-8 [Medline].

17. Bosco, M. C., I. Espinoza-Delgado, M. Schwabe, S. M. Russell, W. J. Leonard, D. L. Longo, and L. Varesio. 1994. The gamma subunit of the IL-2R is expressed in human monocytes and modulated by IL-2, IFN-gamma, and TGF beta. Blood 83: 3462-3467 [Abstract/Free Full Text].

18. Espinoza-Delgado, I., D. L. Longo, G. L. Gusella, and L. Varesio. 1992. Regulation of IL-2 receptor subunit genes in human monocytes: differential effects of IL-2 and IFN-gamma . J. Immunol. 149: 2961-2968 [Abstract].

19. Espinoza-Delgado, I., J. R. Ortaldo, R. Winkler-Pickett, K. Sugamura, L. Varesio, and D. L. Longo. 1990. Expression and role of p75 interleukin 2 receptor on human monocytes. J. Exp. Med. 171: 1821-1826 [Abstract/Free Full Text].

20. Malkovsky, M., B. Loveland, M. North, L. Asherson, L. Gao, P. Ward, and W. Fiers. 1987. Recombinant interleukin-2 directly augments the cytotoxicity of human monoctyes. Nature 325: 262-265 [Medline].

21. Kniep, E. M., and M.-L. Lohmann-Matthes. 1992. The monocyte interleukin-2 receptor light chain: production of cell-associated and soluble interleukin-2 receptor by monocytes. Immunol. 75: 299-304 [Medline].

22. Espinoza-Delgado, I., M. C. Bosco, T. Musso, G. L. Gusella, D. L. Longo, and L. Varesio. 1995. Interleukin-2 and human monocyte activation. J. Leuk. Biol. 57: 13-19 [Abstract].

23. Smith, K. A.. 1988. Interleukin-2: inception, impact, and implications. Science 240: 1169-1176 [Abstract/Free Full Text].

24. Lenardo, M. J., and D. Baltimore. 1989. NF-kappa B: a pleiotropic mediator of inducible and tissue-specific gene control. Cell 58: 227-229 [Medline].

25. Baeuerle, P. A., and T. Henkel. 1994. Function and activation of NF-kappa B in the immune system. Annu. Rev. Immunol. 12: 141-179 [Medline].

26. Böhnlein, E., J. W. Lowenthal, M. Siekevitz, D. W. Ballard, B. R. Franza, and W. C. Greene. 1988. The same inducible nuclear proteins regulates mitogen activation of both the interleukin-2 receptor-alpha gene and type 1 HIV. Cell 53: 827-836 [Medline].

27. Cross, S. L., N. F. Halden, M. J. Lenardo, and W. J. Leonard. 1989. Functionally distinct NF-kappa B binding sites in the immunoglobulin kappa  and IL-2 receptor alpha  chain genes. Science 244: 466-469 [Abstract/Free Full Text].

28. Lin, B. B., S. L. Cross, N. F. Halden, D. G. Roman, M. B. Toledano, and W. J. Leonard. 1990. Delineation of an enhancer-like positive regulatory element in the interleukin-2 receptor alpha -chain gene. Mol. Cell. Biol. 10: 850-853 [Abstract/Free Full Text].

29. Brach, M. A., H.-J. Gruss, D. Riedel, R. Mertelsmann, and F. Herrmann. 1992. Activation of NF-kappa B by interleukin 2 in human blood monocytes. Cell Growth Different. 3: 421-427 . [Abstract]

30. Zhang, Y., M. Broser, H. Cohen, M. Bodkin, K. Law, J. Reibman, and W. N. Rom. 1995. Enhanced interleukin-8 release and gene expression in macrophages after exposure to Mycobacterium tuberculosis and its components. J. Clin. Invest. 95: 586-592 .

31. Zhang, Y., and W. N. Rom. 1993. Regulation of the interleukin-1beta (IL-1beta ) gene by mycobacterial components and lipopolysaccharide is mediated by two nuclear factor-IL6 motifs. Mol. Cell. Biol. 13: 3831-3837 [Abstract/Free Full Text].

32. Kuang, A. A., K. D. Novak, S. M. Kang, K. Bruhn, and M. J. Lenardo. 1993. Interaction between NF-kappa B and serum response factor-binding elements activates an interleukin-2 receptor alpha-chain enhancer specifically in T lymphocytes. Mol. Cell. Biol. 13: 2536-2545 [Abstract/Free Full Text].

33. Toledano, M. B., D. G. Roman, N. F. Hulden, B. B. Lin, and W. J. Leonard. 1990. The same target sequences are differentially important for activation of the interleukin 2 receptor alpha -chain gene in two distinct T-cell lines. Proc. Natl. Acad. Sci. U.S.A. 87: 1830-1834 [Abstract/Free Full Text].

34. Choi, S. J., Y. S. Moon, B. C. Lee, and D. S. Kim. 1990. Serum levels of soluble interleukin-2 receptor in pulmonary tuberculosis. Korean J. Int. Med. 5: 44-50 .

35. Riberd, E., I. Ocana, J. M. Martinez-Vazquez, M. Rosell, T. Espanol, and A. Ruibal. 1988. High level of interferon gamma in tuberculosis pleural effusion. Chest 93: 308-311 [Abstract/Free Full Text].

36. Toosi, Z., P. Gozate, H. Shiratsuchi, T. Young, and J. J. Ellner. 1995. Enhanced production of TGF-beta by blood monocytes from patients with active tuberculosis and presence of TGF-beta in tuberculous granulomatous lung lesions. J. Immunol. 154: 465-473 [Abstract].

37. Hirsch, C. S., R. Hussain, Z. Toosi, G. Dawood, F. Shahid, and J. J. Ellner. 1996. Cross-modulation by transforming growth factor beta  in human tuberculosis: suppression of antigen driven blastogenesis and interferon-gamma production. Proc. Natl. Acad. Sci. U.S.A. 93: 3193-3198 [Abstract/Free Full Text].

38. Zhang, Y., M. Broser, and W. N. Rom. 1994. Activation of the interleukin 6 gene by Mycobacterium tuberculosis or lipopolysaccharide is mediated by nuclear factors NF-IL6 and NF-kappa B. Proc. Natl. Acad. Sci. U.S.A. 91: 2225-2229 [Abstract/Free Full Text].

39. Pimentel-Muiños, J. X., J. Mazana, and M. Fresno. 1994. Regulation of interleukin-2 receptor alpha  chain expression and nuclear factor kappa B activation by protein kinase C in T lymphocytes: autocrine role of tumor necrosis factor alpha . J. Biol. Chem. 269: 24424-24429 [Abstract/Free Full Text].

40. Beg, A. A., and D. Baltimore. 1996. An essential role for NF-kappa B in preventing TNF-alpha -induced cell death. Science 274: 782-784 [Abstract/Free Full Text].

41. Van Antwerp, D. J., S. J. Martin, T. Kafri, D. R. Green, and I. M. Verma. 1996. Suppression of TNFalpha -induced apoptosis by NF-kappa B. Science 274: 787-789 [Abstract/Free Full Text].

42. Wang, C.-Y., M. W. Mayo, and A. S. Baldwin Jr.. 1996. TNF- and cancer therapy-induced apoptosis: potentiation by inhibition of NF-kappa B. Science 274: 784-787 [Abstract/Free Full Text].

43. Moore, K. J., and G. Matlashewski. 1994. Intracellular infection by Leishmania donovani inhibits macrophage apoptosis. J. Immunol. 152: 2930-2937 [Abstract].

44. Laochumroonvorapong, P., S. Paul, K. B. Elkon, and G. Kaplan. 1996. H2O2 induces monocyte apoptosis and reduces viability of Mycobacterium avium-M. intracellulare within cultured human monocytes. Infect. Immun. 64: 452-459 [Abstract/Free Full Text].

45. Molloy, A., P. Laochumroonvorapong, and G. Kaplan. 1994. Apoptosis, but not necrosis, of infected monocytes is coupled with killing of intracellular bacillus Calmette-Guérin. J. Exp. Med. 180: 1499-1509 [Abstract/Free Full Text].

46. Law, K. F., J. Jagirdar, M. Weiden, M. Bodkin, and W. N. Rom. 1996. Tuberculosis in HIV positive patients: cellular response and immune activation in the lung. Am. J. Respir. Crit. Care Med. 153: 1377-1384 [Abstract].

47. Condos, R., W. N. Rom, Y. M. Liu, and N. W. Schluger. 1998. Local immune responses correlate with presentation and outcome in tuberculosis. Am. J. Respir. Crit. Care Med. 157: 729-735 [Abstract/Free Full Text].

48. Condos, R., W. N. Rom, and N. W. Schluger. 1997. Treatment of multidrug-resistant pulmonary tuberculosis with interferon-gamma via aerosol. Lancet 349: 1513-1515 [Medline].

49. Johnson, B. J., L.-G. Bekker, R. Rickman, S. Brown, M. Lesser, S. Ress, P. Willcox, L. Steyn, and G. Kaplan. 1997. rhu IL-2 adjunctive therapy in multidrug resistant tuberculosis: a comparison of two treatment regimens and placebo. Tubercle Lung Dis. 78: 195-203 [Medline].

50. Khatri, V. P., T. A. Fehniger, R. A. Baiocchi, F. Yu, M. H. Shah, D. S. Schiller, M. Gould, R. T. Gazzinelli, Z. P. Bernstein, and M. A. Caligiuri. 1998. Ultra low dose interleukin-2 therapy promotes a type 1 cytokine profile in vivo in patients with AIDS, and AIDS-associated malignancies. J. Clin. Invest. 101: 1373-1378 [Medline].

51. Schluger, N. W., and W. N. Rom. 1998. State of the art: the human host response to M. tuberculosis. Am. J. Respir. Crit. Care Med. 157: 679-691 .





This article has been cited by other articles:


Home page
Am. J. Respir. Crit. Care Med.Home page
V. Guyot-Revol, J. A. Innes, S. Hackforth, T. Hinks, and A. Lalvani
Regulatory T Cells Are Expanded in Blood and Disease Sites in Patients with Tuberculosis
Am. J. Respir. Crit. Care Med., April 1, 2006; 173(7): 803 - 810.
[Abstract] [Full Text] [PDF]


Home page
Biol. Reprod.Home page
S. J. Renaud, L.-M. Postovit, S. K. Macdonald-Goodfellow, G. T. McDonald, J. D. Caldwell, and C. H. Graham
Activated Macrophages Inhibit Human Cytotrophoblast Invasiveness In Vitro
Biol Reprod, August 1, 2005; 73(2): 237 - 243.
[Abstract] [Full Text] [PDF]


Home page
Infect. Immun.Home page
C.-H. Song, J.-S. Lee, H.-J. Kim, J.-K. Park, T.-H. Paik, and E.-K. Jo
Interleukin-8 Is Differentially Expressed by Human-Derived Monocytic Cell Line U937 Infected with Mycobacterium tuberculosis H37Rv and Mycobacterium marinum
Infect. Immun., October 1, 2003; 71(10): 5480 - 5487.
[Abstract] [Full Text] [PDF]


Home page
CVIHome page
P. Mendez-Samperio, H. Ayala, and A. Vazquez
NF-{kappa}B Is Involved in Regulation of CD40 Ligand Expression on Mycobacterium bovis Bacillus Calmette-Guerin-Activated Human T Cells
Clin. Vaccine Immunol., May 1, 2003; 10(3): 376 - 382.
[Abstract] [Full Text] [PDF]


Home page
Infect. Immun.Home page
S. Prabhakar, Y. Qiao, Y. Hoshino, M. Weiden, A. Canova, E. Giacomini, E. Coccia, and R. Pine
Inhibition of Response to Alpha Interferon by Mycobacterium tuberculosis
Infect. Immun., May 1, 2003; 71(5): 2487 - 2497.
[Abstract] [Full Text] [PDF]


Home page
Infect. Immun.Home page
J. A. Gutierrez-Pabello, D. N. McMurray, and L. G. Adams
Upregulation of Thymosin {beta}-10 by Mycobacterium bovis Infection of Bovine Macrophages Is Associated with Apoptosis
Infect. Immun., April 1, 2002; 70(4): 2121 - 2127.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Respir. Crit. Care Med.Home page
K. M. EDWARDS, M. H. CYNAMON, R. K. R. VOLADRI, C. C. HAGER, M. S. DESTEFANO, K. T. THAM, D. L. LAKEY, M. R. BOCHAN, and D. S. KERNODLE
Iron-cofactored Superoxide Dismutase Inhibits Host Responses to Mycobacterium tuberculosis
Am. J. Respir. Crit. Care Med., December 15, 2001; 164(12): 2213 - 2219.
[Abstract] [Full Text] [PDF]


Home page
Infect. Immun.Home page
J. Warwick-Davies, A. J. Watson, G. E. Griffin, S. Krishna, and R. J. Shattock
Enhancement of Mycobacterium tuberculosis-Induced Tumor Necrosis Factor Alpha Production from Primary Human Monocytes by an Activated T-Cell Membrane-Mediated Mechanism
Infect. Immun., November 1, 2001; 69(11): 6580 - 6587.
[Abstract] [Full Text] [PDF]


Home page
Infect. Immun.Home page
H. Yamada, S. Mizuno, M. Reza-Gholizadeh, and I. Sugawara
Relative Importance of NF-kappa B p50 in Mycobacterial Infection
Infect. Immun., November 1, 2001; 69(11): 7100 - 7105.
[Abstract] [Full Text] [PDF]


Home page
Infect. Immun.Home page
B. Raju, C. F. Tung, D. Cheng, N. Yousefzadeh, R. Condos, W. N. Rom, and D. B. Tse
In Situ Activation of Helper T Cells in the Lung
Infect. Immun., August 1, 2001; 69(8): 4790 - 4798.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by TCHOU-WONG, K.-M.
Right arrow Articles by ROM, W. N.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by TCHOU-WONG, K.-M.
Right arrow Articles by ROM, W. N.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Proc. Am. Thorac. Soc. Am. J. Respir. Cell Mol. Biol.
Copyright © 1999 American Thoracic Society