,
Granulocyte-Macrophage Colony-stimulating
Factor, and Interferon- Release from Alveolar
Macrophages in Asthma
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| |
ABSTRACT |
|---|
|
|
|---|
We determined the effect of inhaled corticosteroid, budesonide, on the release of the anti-inflammatory cytokine, interleukin-10 (IL-10), and of pro-inflammatory cytokines, macrophage inflammatory protein-1
(MIP-1
), interferon-
(IFN-
), and granulocyte-macrophage colony-stimulating factor
(GM-CSF), from blood monocytes and alveolar macrophages of mild asthmatic subjects in a double-blind, cross-over, placebo-controlled study. Budesonide reduced bronchial hyperresponsiveness and
improved baseline FEV1. Alveolar macrophages were obtained by bronchoalveolar lavage performed
at the end of each treatment phase. IL-10 from blood monocytes was not altered, but both IL-10 mRNA and protein expression from alveolar macrophages stimulated by lipopolysaccharide and IL-1
were increased after corticosteroid therapy. By contrast, alveolar macrophages released significantly less MIP-1
, IFN-
, and GM-CSF after steroid treatment. In comparison to alveolar macrophages from
normal nonasthmatic volunteers, those from asthmatic patients released more MIP-1
, IFN-
, and
GM-CSF but lower amounts of IL-10 particularly at baseline and after IL-1
stimulation. The ability of
steroids to inhibit pro-inflammatory cytokines but to enhance the anti-inflammatory cytokine such as IL-10 may contribute to their beneficial actions in asthma. Asthma is characterized by alveolar macrophages exhibiting both an enhanced capacity to release pro-inflammatory cytokines and a reduced
capacity to produce IL-10.
| |
INTRODUCTION |
|---|
|
|
|---|
Macrophages are widely recognized as cells that play a central
role in the regulation of immune and inflammatory activities as well as in tissue remodeling. The fulfillment of these activities is mediated by complex and multifactorial processes involving products derived from macrophages (1). Macrophages
usually elaborate powerful suppressive signals to limit the proliferative potential of T cells, thus maintaining local immunologic homeostasis (2). In asthma, macrophages may be stimulated by specific allergen to augment T-cell proliferation (3),
which may result from a different profile of cytokines released
from these macrophages. For example, increased release of granulocyte-macrophage colony-stimulating factor (GM-CSF) may
inhibit the immunosuppressive effect of macrophages (4). Indeed, macrophages from asthmatic subjects release increased amounts of several pro-inflammatory cytokines, including interleukin (IL)-1
, tumor necrosis factor-
(TNF
), interferon-
(IFN-
), IL-6, and GM-CSF (5).
Inhaled steroids used for the treatment of asthma reduce
the number of infiltrating eosinophils, T cells, macrophages,
and mast cells in the airways submucosa (8). Suppression of
pro-inflammatory cytokine release such as GM-CSF, IL-4,
IL-5, and RANTES from many inflammatory and resident airway cells is a likely mechanism of steroid action (9). Pro-inflammatory cytokine expression by macrophages may also
be inhibited such as the release of GM-CSF, IL-6, and MIP-1
,
as has been demonstrated in vitro (12, 13). However, it is not
clear how anti-inflammatory cytokines such as IL-10 are modulated by corticosteroids in vivo. IL-10, a product of alveolar
macrophages and T cells (14, 15), inhibits the release of several pro-inflammatory cytokines such as TNF
, IL-1
, IL-6,
IL-8, macrophage inflammatory protein-1
(MIP-1
), and
GM-CSF from monocytes and macrophages (14, 16) and
T-cell proliferation (19, 20). While topical corticosteroids can
inhibit pro-inflammatory cytokine expression, it is not known
whether they can modulate the production and expression of
the anti-inflammatory cytokine IL-10 in asthma. We have
therefore investigated the effect of inhaled steroid therapy on
the release of IL-10 and the pro-inflammatory cytokines GM-CSF, IFN-
, and MIP-1
from alveolar macrophages of mild
asthmatic patients ex vivo.
| |
METHODS |
|---|
|
|
|---|
Patients
Twelve subjects with mild stable asthma (Table 1) who were receiving
treatment with only the inhaled
2-adrenergic agonist aerosol, albuterol, for intermittent relief of wheeze were recruited. All patients
demonstrated > 15% improvement in FEV1 following 200 µg of albuterol and in airway hyperresponsiveness to methacholine with a
provocative concentration of methacholine producing a 20% fall in
FEV1 (PC20) of < 4 mg/ml. All patients were atopic as defined by two
or more positive skin prick tests to common allergens. None of the
subjects studied had received oral or inhaled corticosteroids for the
preceding 12 mo or any other treatment apart from inhaled
2 agonists. Current smokers or ex-smokers of > 5 pack-years and patients
with FEV1 < 80% predicted were excluded.
|
In order to compare the responses of monocytes and alveolar macrophages obtained from asthmatic subjects during placebo and budesonide treatment, we studied seven normal nonatopic nonsmoking volunteers (Table 1), who gave no history of asthma or of any respiratory disease and who had normal lung function and airway responsiveness to methacholine (PC20 > 16 mg/ml).
Study Design
The study was a 12-wk, double-blind, randomized, cross-over study comparing the effects of inhaled corticosteroid, budesonide (800 µg twice daily), to that of placebo. Each treatment was administered for 4 wk, separated by a 4-wk wash-out phase. All patients were reviewed at Day 14 of each treatment limb, and at Day 26, spirometry and airway responsiveness to methacholine were measured. At Day 28, venous blood samples were obtained and fiberoptic bronchoscopy was performed. The study was approved by the Royal Brompton Hospital Ethics Committee, and all patients gave their informed consent.
Fiberoptic Bronchoscopy
Subjects attended our bronchoscopy suite at 8:30 A.M. after having
fasted from midnight and were pretreated with atropine (0.6 mg intravenously) and midazolam (5 to 10 mg intravenously). Using local anesthesia with lidocaine (4%) to the upper airways and larynx, a fiberoptic bronchoscope (Olympus BF10; Southend-on-Sea, Essex, UK)
was passed through the nasal passages into the trachea. Bronchoalveolar lavage (BAL) was performed from the right middle lobe using
four successive aliquots of 60 ml of 0.9% NaCl. BAL cells were spun
(500 × g; 10 min) and washed twice with Hanks' buffered salt solution
(HBSS). Cytospins were prepared and stained with May-Grünwald
stain for differential cell counts. Cell viability was assessed using the
trypan blue exclusion method. Cells (5 × 105) were placed in guanidinium thiocyanate and left at
70° C for later RNA extraction.
Materials
IL-1
was purchased from R&D Laboratories (Oxford, UK). Human
recombinant MIP-1
and anti-MIP-1
antibody was a gift from T. J. Schall (DNAX, Palo Alto, CA). Complete culture medium contained RPMI-1640 (ICN-Flow, High Wycombe, UK), 10% heat-inactivated
fetal calf serum (Sera Lab, Crawley, UK) 2 mM L-glutamine, and penicillin (100 U/ml)-streptomycin (100 µg/ml) (both from ICN-Flow).
Culture plates were from Falcon (London, UK). Lipopolysaccharide
(Escherichia coli), avidin-peroxidase, and ABTS were from Sigma
(Poole, UK). [32P]dCTP, [125I]NA, and hybond N-filters were from
Amersham International (Amersham, UK). Ficoll-Hypaque was from
Pharmacia Biotech (Hertfordshire, UK). Round-bottom, 96-well plates
were from Greiner Labortechnik Ltd (London, UK).
Isolation of Peripheral Blood Monocytes
Peripheral venous blood was mixed with acid-citrate dextrose (1:6, vol/vol) and sedimented on dextran (6% in 0.9% NaCl) for 40 min. Mononuclear cells were separated by Ficoll-Hypaque density centrifugation. Cells were washed twice with HBSS and plated at a concentration of 5 × 106 monocytes/2 ml in 6-well plates for Northern analysis or 1 × 106/ml in 24-well plates for reverse-transcription polymerase chain reaction (RT-PCR) and collection of supernatants for cytokine assays. After adherence at 37° C for 90 min, cells were washed twice with HBSS prior to stimulation. Cell viability was consistently > 96%, as assessed by trypan blue exclusion; after adherence, > 95% of these cells were monocytes, as assessed by nonspecific esterase staining.
Isolation of Alveolar Macrophages
BAL fluid was filtered through sterile gauze and centrifuged at 500 × g for 10 min. Cells were washed twice in HBSS, counted, and plated in complete media at a concentration of 1 × 106/ml in a 24-well plate. In normal subjects, the total cell yield was 12 ± 7 × 106 cells with a differential cell count of 93 ± 2% macrophages, 6.6 ± 2% lymphocytes, and 0.4 ± 1% neutrophils. In asthmatic subjects, the yield was 11 ± 4.4 × 106 cells with 88.6 ± 3.1% macrophages, 8.6 ± 2.6% lymphocytes, 1.1 ± 0.4% neutrophils, and 1.6 ± 1.0% eosinophils. Cells were > 85% viable, as assessed by trypan blue exclusion.
RT-PCR for IL-10
RNA was extracted using a modification of the method of Chomczynski and Sacchi (21) and its purity assessed by spectrophotometry. Reverse transcription of 1 µg of total RNA was performed using AMV-reverse transcriptase (15 U), 10 mM of dATP, dCTP, dGTP, and dTTP, oligo dT15 primer (0.2 µg), RNase inhibitor (30 U), and 5× AMV buffer in a total volume of 8.5 µl (all from Promega, Southampton, UK). RNA was denatured at 65° C for 10 min. The remaining ingredients were then added as a master mix, and samples were incubated at 42° C for 60 min followed by 4 min at 90° C. The cDNA was subsequently diluted to a final volume of 100 µl in nuclease-free water. For PCR, 5 µl of the cDNA solutions were used. PCR was performed using 0.5 µg/µl of forward and reverse primers, dATP, dGTP, dTTP, and dCTP, at a concentration of 10 mM each, Taq polymerase (0.5 U), and buffer A in a final volume of 25 µl (all from Promega) set for 29 cycles for IL-10 and 28 cycles for GAPDH at a denaturing temperature of 94° C for 30 s, specific annealing temperature of 65° C for IL-10 and 58° C for GAPDH, and extension temperature of 72° C for 30 s. Primers for IL-10 were 5' ATGCCCCAAGCTGAGAACCAAGACCCA and 3' TCTCAAGGGGCTGGGTCAGCTATCCCA, giving a product of 351 base pairs. Primers for GAPDH were 5' TCTAGACGGCAGGCTAGGTCCACC and 3' CCACCCATGGCAAATTCCATGGCA, giving a product of 598 base pairs. PCR was carried out in a Techne multiwell thermocycler (Techne, Cambridge, UK). The number of cycles was chosen after determination of the linear phase of the product amplification curve from serial sampling with increasing cycles of amplification. Products were distinguished by electrophoresis on a 1.5% agarose, ethidium bromide-stained gel and then visualized using ultraviolet luminescence.
Southern blot analysis was performed. The 1.5% agarose gels were denatured, neutralized, and blotted onto nylon membranes. DNA was cross-linked to the membrane by ultraviolet light. Membranes were incubated for 4 h at 65° C in buffer D (6× SSC, 5× Denhardt's solution, 20 mM NaH2PO4, 0.1% wt/vol SDS, 250 µg/ml sonicated salmon sperm DNA) and hybridized at 65° C overnight in the same buffer with 32P-radiolabeled gene-specific internal oligonucleotide probes directed against a sequence internal to the specific PCR product. Filters were washed twice in 3× SSC/0.1% SDS for 15 min at 65° C, once with 1× SSC/0.1% SDS for 30 min at 65° C, and finally twice with 0.1× SSC/0.1% SDS for 30 min at 65° C. Each filter was then exposed for 6 to 24 h to Kodak (Rochester, NY) X-OMAT film and developed. In addition, 5 µl of each PCR product was dot-blotted and hybridized according to the above-described method to allow quantitation by Cerenkov counting of the filters. Data are expressed as the ratio of IL-10 to GAPDH cDNA.
Radioimmunoassay for MIP-1
Recombinant MIP-1
was iodinated (2.5 µg) using iodogen as previously described (22). The competitive binding assay was as previously
described for the complement activation product C5a (23). Briefly,
cell culture supernatant fluid (100 µl) was mixed with 11% polyethylene
glycol 6,000 containing 0.5% protamine sulfate (100 µl), [125I]ligand
(6 fmol in 50 µl), and antibody (50 µl of rabbit anti-MIP-1
antibody
diluted 1:50). After 24 h of incubation at room temperature, radioactivity was precipitated using 25 µl of goat anti-rabbit IgG (Nordik, UK).
The lower limit of adequate measurement (the concentration required
to inhibit [125I]ligand binding by 20%) was 12 pM. This assay was specific for MIP-1
and did not cross-react with other chemokines, including MIP-1
, RANTES, and monocyte chemoattractant protein-1
(MCP-1).
Enzyme-linked Immunosorbent Assays for
IL-10, IFN-
, and GM-CSF
These cytokines were assayed using a quantitative sandwich enzyme
immunoassay technique. For IL-10 and IFN-
, commercially available
kits were used (Quantikine; R&D Systems, Abingdon, Oxon, UK).
Briefly, monoclonal anti-IL-10 or anti-IFN-
antibody was coated
onto a microtiter plate, to which standards and samples were added.
An enzyme-linked polyclonal antibody specific for IL-10 or IFN-
was added to the wells to sandwich-immobilized IL-10 or IFN-
. Addition of a stabilized chromogen and hydrogen peroxide allowed a
color development in proportion to the amount of IL-10 or IFN-
assayed by measurement of optical density using a spectrophotometer
set to 450 nm. The lower limit of detection was 1.5 and 2 pg/ml for IL-10 and IFN-
, respectively.
For GM-CSF assay, round-bottom plates were coated overnight at 4° C with a rat anti-human GM-CSF monoclonal antibody of (50 µl of 2 µg/ml). After washing with phosphate-buffered saline (PBS)/Tween, the antibody was blocked with PBS/10% fetal calf serum (200 µl; 2 h). GM-CSF standard and samples were added to the plate overnight at 4° C and washed with PBS/Tween (four times). A biotinylated secondary anti-GM-CSF antibody (100 µl of 2 µg/ml in PBS/10% fetal calf serum) was added for 45 min followed by 1:400 avidin-peroxidase solution (100 µl). After washing, GM-CSF was measured colometrically at 405 nm and quantified by interpolation from a standard curve. The lower limit of detection was 16 pg/ml.
Data Analysis
Data are reported as mean ± SEM. Data obtained within the asthmatic group during the placebo and active periods were compared using the nonparametric Wilcoxon's test. To compare the data between asthmatics and normal volunteers, the nonparametric Mann-Whitney test was used. A p value of < 0.05 was considered to be significant.
| |
RESULTS |
|---|
|
|
|---|
Effect of Budesonide on FEV1, Bronchial Responsiveness, and BAL Cells
There was no significant difference in FEV1 and PC20 between
the start and the end of the placebo period. However, mean
FEV1 improved from 3.60 ± 0.15 L to 3.80 ± 0.22 L (p < 0.05)
and log PC20 from
0.40 ± 0.16 to 0.30 ± 0.21 (p < 0.005) after 1 mo of steroid treatment. There was no significant effect
of steroid treatment on total BAL cell counts, but eosinophil
counts were significantly reduced from 1.6 ± 1.0% to 0.6 ± 0.3% following budesonide (p < 0.05).
Time Course of IL-10 mRNA Expression and Protein Release
To determine the time course of IL-10 mRNA expression and protein production, peripheral blood monocytes and alveolar macrophages from normal subjects were plated and stimulated with LPS (1 µg/ml). There was a time-dependent increase of IL-10 protein and mRNA peaking at 24 h in both monocytes and macrophages. Expression of IL-10 mRNA and protein release was higher in monocytes than in macrophages (Figure 1).
|
Effects of Budesonide on IL-10 Expression and Release
There was no significant difference in IL-10 mRNA expression and protein release between the steroid-treated and placebo-treated periods and between the blood monocytes from
normal subjects compared with asthmatics (Figure 2). However, in alveolar macrophages, IL-10 mRNA was significantly
lower during placebo treatment compared with budesonide
treatment at baseline and 24 h after stimulation with LPS and
IL-1
(Figure 3). Significantly lower IL-10 protein was released
during the placebo treatment compared with the budesonide treatment at baseline and 24 h after stimulation with LPS and IL-1
. Compared with the control group of normal volunteers, placebo-treated asthmatics showed a significantly lower
IL-10 protein release at baseline and after IL-1
stimulation,
although the difference after LPS stimulation did not reach
statistical significance (Figure 3).
|
|
Effects of Budesonide on MIP-1
, GM-CSF,
and IFN-
Release
Blood monocytes. Inhaled budesonide had no effect on MIP-1
mRNA expression as assessed by Northern analysis or on
MIP-1
protein release. There was no significant difference in
mRNA expression and protein release between the placebo
and budesonide treatments and between the asthmatic and
normal control groups at baseline and after 24 h of stimulation
with LPS and IL-1
. However, there was a significantly higher
amount of GM-CSF release from blood monocytes of the placebo period after stimulation with LPS and IL-1
compared
with the budesonide treatment period and with the normal
group. IFN-
release was not detectable from supernatants of
monocytes from asthmatic or normal subjects.
Alveolar macrophages. MIP-1
protein release was significantly higher in the placebo period compared with the budesonide period and also compared with the normal control
group, at baseline and after 24 h of stimulation with LPS and
IL-1
(Figure 4). Similar results were obtained with the release of GM-CSF and IFN-
. IFN-
release was not detectable
in supernatants from alveolar macrophages of normal subjects. MIP-1
and GM-CSF release was higher from macrophages compared with monocytes.
|
Effect of Dexamethasone on Stimulated IL-10 Release from Macrophages In Vitro
To determine the effect of corticosteroids on IL-10 release
from human alveolar macrophages, we stimulated macrophages (1 × 106) obtained from six normal volunteers with
LPS (1 µg/ml), with and without prior addition of dexamethasone (10
6 M) for 2 h in 24-well plates. Supernatants were harvested 24 h after addition of LPS. LPS alone induced release
of IL-10 of 486 ± 76 pg/ml, whereas after dexamethasone incubation the release was significantly inhibited to 85.8 ± 24.1 pg/ml (p < 0.01).
| |
DISCUSSION |
|---|
|
|
|---|
We have shown that alveolar macrophages of patients with
mild asthma release significantly less IL-10 than those of normal nonasthmatic subjects at baseline and following stimulation by exogenous stimuli such as LPS and IL-1
. In addition,
they express a lesser amount of IL-10 mRNA, indicating that
this difference in IL-10 release is due to a reduction in IL-10
transcription. These results are generally in line with recent
data indicating that IL-10 levels obtained from BAL fluid of
asthmatics are lower compared with those of normal subjects,
associated with reduced IL-10 mRNA levels in BAL cells (24).
On the other hand, the capacity for alveolar macrophages to produce pro-inflammatory cytokines MIP-1
, IFN-
, and GM-CSF
was increased in asthma, further indicating the overall pro-
inflammatory contribution of alveolar macrophages in asthma.
Chronic inhaled corticosteroid therapy led to an increased
capacity for alveolar macrophages to express IL-10 mRNA
and to release IL-10 from alveolar macrophages to levels observed from those obtained from normal subjects. By contrast,
the increased release of the pro-inflammatory cytokines MIP-1
,
IFN-
, and GM-CSF from alveolar macrophages of asthmatic
subjects was inhibited. Thus, overall, there was an anti-inflammatory effect of inhaled steroid therapy. IL-10 possesses inhibitory properties on macrophage function such as reducing
the release of pro-inflammatory cytokines, and the proliferation of T cells by preventing the production of IL-2. Our data
therefore indicate that one of the mechanisms by which inhaled
steroids inhibit asthmatic inflammation is to enhance IL-10 expression and release from alveolar macrophages. Conversely,
airway inflammation may be persistent in asthma through a reduction of IL-10 expression in alveolar macrophages.
The opposing relationships between IL-10 release on the
one hand and MIP-1
, IFN-
, and GM-CSF release on the
other hand suggest that these cytokines may have effects on
each other. One possibility is that endogenously released IL-10 can influence the release of pro-inflammatory cytokines.
An antibody to IL-10 has been shown to enhance the release
of MIP-1
, TNF
, IL-1
, and IL-6 from monocytes (14, 16,
18). Thus, IL-10 may act as an auto-regulatory brake on macrophages and have a modulating effect on the release of other
pro-inflammatory cytokines. Conversely, IFN-
and GM-CSF can also inhibit IL-10 release in blood monocytes (25).
Furthermore, the inhibition of IL-10 by IFN-
was associated
with induction of TNF
and IL-1
synthesis (26, 27). It is
more plausible that the pro-inflammatory cytokines may be
influencing the levels of IL-10, since the time course of expression of IL-10 is, as we have shown, delayed in relation to the
other pro-inflammatory cytokines such as MIP-1
and GM-CSF, which are expressed quickly with peak responses within
a few hours after cell stimulation (6, 12). Therefore, corticosteroids may primarily lead to suppression of pro-inflammatory
cytokine release such as IFN-
and GM-CSF, in turn causing a
secondary rise in IL-10 release. This possibility is also more
likely because corticosteroids directly inhibit IL-10 release from
monocytes (24) and alveolar macrophages (present study) in
vitro, indicating that up-regulation of IL-10 mRNA in vivo is
likely to be an indirect effect of corticosteroids. The changes
in IL-10 release secondary to corticosteroid therapy were mirrored by similar changes in IL-10 mRNA in both normal and
asthmatic alveolar macrophages, indicating that the corticosteroid effects occurred at the transcriptional level. Binding of
activated corticosteroid receptors to positive consensus glucocorticoid responsive elements present on the IL-10 promoter
may lead to increased IL-10 expression, but, on the other hand,
binding of activated corticosteroid receptors with consensus
sequences for transcription factors such as AP-1 present in the
IL-10 promoter (28) may underlie the in vitro inhibitory effects of corticosteroids on IL-10 expression. However, it is unclear why chronic steroid therapy should lead to one mechanism while acute in vitro exposure leads to another mechanism.
We observed several differences between monocytes and
macrophages. Monocytes produced more IL-10 and also more
of the pro-inflammatory cytokines MIP-1
and GM-CSF than
did macrophages. However, the differences between normal
and asthmatic subjects was only observed in the alveolar macrophage in terms of release of pro- and anti-inflammatory cytokines. The underlying mechanism for this increased release in
pro-inflammatory cytokines together with a decrease in IL-10 release is not known. It is possible that, as discussed above, there
is an overexpression of IFN-
and/or other pro-inflammatory cytokines that inhibit IL-10 expression and synthesis. In addition, the effect of corticosteroids in increasing IL-10 release was not observed in monocytes but in macrophages. This may not
be surprising because the effect of inhaled corticosteroids would be mostly on airway macrophages rather than on blood monocytes. However, we found that monocytes also demonstrated
decreased release of GM-CSF (but not of MIP-1
and IFN-
)
as observed in alveolar macrophages after corticosteroid therapy, which may reflect the actions of systemically absorbed
budesonide.
IL-10 has numerous anti-inflammatory effects that would
be beneficial in suppressing inflammatory mechanisms associated with asthma. In addition to inhibiting the production of
IFN-
and IL-2 by Th-1 lymphocytes (15), IL-10 also inhibits
pro-inflammatory cytokine production (such as IL-1
, IL-6,
and IL-8) by mononuclear phagocytes (14, 17, 18, 29) at the
level of cytokine gene transcription (30) and IL-4 and IL-5
production by Th-2 T cells (31). Corticosteroids convert the
cytokine response of the alveolar macrophage of the asthmatic subject into the range found in normal subjects, and this
may underlie the improved functional effects observed, such
as the attenuation of bronchial hyperresponsiveness.
In summary, we have shown that chronic inhaled corticosteroid therapy alters the balance of pro- and anti-inflammatory
cytokine expression and release from alveolar macrophages in
asthma by increasing the production of the anti-inflammatory
cytokine, IL-10, while reducing the production of the pro-inflammatory cytokines MIP-1
, GM-CSF, and IFN-
.
| |
Footnotes |
|---|
Correspondence and requests for reprints should be addressed to Dr. K. F. Chung, National Heart & Lung Institute, Dovehouse St., London SW3 6LY, UK.
(Received in original form March 19, 1997 and in revised form August 4, 1997).
Acknowledgments: Supported by a Program Grant from the British Medical Research Council (to K.F.C. and P.J.B.), a grant from Astra Draco, and fellowships from the Overseas German Academic Exchange Service (to M.J.) and Deutsche Forschungsgemeinschaft (to J.S.).
| |
References |
|---|
|
|
|---|
1. Nathan, C. F.. 1987. Secretory products of macrophages. J. Clin. Invest. 79: 319-326 .
2. Holt, P. G.. 1985. Downregulation of immune responses in the lower respiratory tract: role of alveolar macrophages. Clin. Exp. Immunol. 63: 261-270 .
3. Spiteri, M., R. A. Knight, J. Y. Jeremy, P. J. Barnes, and K. F. Chung. 1994. Alveolar macrophage-induced suppression of T-cell hyperresponsiveness in bronchial asthma is reversed by allergen exposure. Eur. Respir. J. 7: 1431-1438 [Abstract].
4.
Bilyk, N., and
P. G. Holt.
1993.
Inhibition of the immunosuppressive activity of resident pulmonary alveolar macrophages by granulocyte/macrophage colony-stimulating factor.
J. Exp. Med.
177:
1773-1777
5.
Spiteri, M. A.,
C. Prior,
M. Herold,
R. A. Knight,
S. W. Clarke, and
K. F. Chung.
1992.
Spontaneous release of IL-1, IL-6, TNF-
and GMCSF
by alveolar macrophages (AM) in bronchial asthma (abstract).
Am.
Rev. Respir. Dis.
145:
A239
.
6.
Hallsworth, M. P.,
C. P. C. Soh,
S. J. Lane,
J. P. Arm, and
T. H. Lee.
1994.
Selective enhancement of GM-CSF, TNF-
, IL-1
and IL-8 production by monocytes and macrophages of asthmatic subjects.
Eur. Respir. J.
7:
1096-1102
[Abstract].
7.
Cembrzynska-Norvak, M.,
E. Szklarz,
A. D. Inglot, and
J. A. Teodorczyk-Injeyan.
1993.
Elevated release of TNF-
and interferon-gamma
by bronchoalveolar leukocytes from patients with bronchial asthma.
Am. Rev. Respir. Dis.
147:
291-295
[Medline].
8. Djukanovic, R., J. W. Wilson, K. M. Britten, S. J. Wilson, A. F. Walls, W. R. Roche, P. H. Howarth, and S. T. Holgate. 1992. The effect of an inhaled corticosteroid on airway inflammation and symptoms in asthma. Am. Rev. Respir. Dis. 145: 669-674 [Medline].
9.
Robinson, D. S.,
Q. Hamid,
S. Ying,
A. M. Bentley,
B. Assoufi,
J. North,
M. Qui,
S. R. Durham, and
A. B. Kay.
1993.
Prednisolone treatment
in asthma is associated with modulation of bronchoalveolar lavage cell
IL-4, IL-5, and IFN-
cytokine gene expression.
Am. Rev. Respir. Dis.
148:
401-406
[Medline].
10. Wang, J. H., C. J. Trigg, L. L. Devalia, S. Jordan, and R. J. Davies. 1994. Effect of inhaled beclomethasone dipropionate on expression of proinflammatory cytokines and activated eosinophils in the bronchial epithelium of patients with mild asthma. J. Allergy Clin. Immunol. 94: 1025-1034 [Medline].
11. Davies, R. J., J. H. Wang, C. J. Trigg, and J. L. Devalia. 1995. Expression of granulocyte/macrophage-colony-stimulating factor, interleukin-8 and RANTES in the bronchial epithelium of mild asthmatics is down-regulated by inhaled beclomethasone dipropionate. Int. Arch. Allergy Immunol. 107: 428-429 [Medline].
12.
Berkman, N.,
P. Jose,
T. Williams,
P. J. Barnes, and
K. F. Chung.
1995.
Corticosteroid inhibition of macrophage inflammatory protein-1
expression in human monocytes and alveolar macrophages.
Am. J. Physiol.
269:
L443-L452
13.
Linden, M., and
R. Brattsand.
1994.
Effects of a corticosteroid, budesonide, on alveolar macrophage and blood monocyte secretion of cytokines: differential sensitivity of GM-CSF, IL-1
, and IL-6.
Pulm.
Pharmacol.
7:
43-47
[Medline].
14. de Waal Malefyt, R., J. Abrams, B. Bennett, C. G. Figdor, and J. E. De Vries. 1991. Interleukin 10 (IL-10) inhibits cytokine synthesis by human monocytes: an auto regulatory role of IL-10 produced by monocytes. J. Exp. Med. 179: 1209-1220 .
15.
Fiorentino, D. F.,
M. W. Bond, and
T. R. Mosmann.
1989.
Two types of
mouse helper T cells: IV. Th 2 clones secrete a factor that inhibits cytokine production by Th 1 clones.
J. Exp. Med.
170:
2081-2095
16.
Berkman, N.,
M. John,
G. Roesems,
P. J. Jose,
P. J. Barnes, and
K. F. Chung.
1995.
Inhibition of macrophage inflammatory protein-1
by
interleukin-10: differential sensitivities in human blood monocytes
and alveolar macrophages.
J. Immunol.
155:
4412-4418
[Abstract].
17.
Bogdan, C.,
Y. Vodovotz, and
C. Nathan.
1991.
Macrophage deactivation by interleukin 10.
J. Exp. Med.
174:
1549-1555
18. Fiorentino, D. F., A. Zlotnik, T. R. Mosmann, M. Howard, and A. O'Garra. 1991. IL-10 inhibits cytokine production by activated macrophages. J. Immunol. 147: 3815-3822 [Abstract].
19. de Waal Malefyt, R., H. Yssel, and J. E. DeVries. 1993. Direct effects of IL-10 on subsets of human CD4+ T cell clones and resting T cells. J. Immunol. 150: 4754-4765 [Abstract].
20. Del Prete, G., M. DeCarli, F. Almerigogna, M. G. Giudizi, R. Biagiotti, and S. Romagnani. 1993. Human IL-10 is produced by both type 1 helper (Th1) and type 2 helper (Th2) T cell clones and inhibits their antigen-specific proliferation and cytokine production. J. Immunol. 150: 353-360 [Abstract].
21. Chomczynski, P., and N. Sacchi. 1987. Single step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal. Biochem. 162: 156-160 [Medline].
22. Collins, P. D., P. J. Jose, and T. J. Williams. 1991. The sequential generation of neutrophil chemoattractant protein in acute inflammation in the rabbit in vivo: relationship between C5a and proteins with the characteristics of L-8/neutrophil activating protein. J. Immunol. 146: 677-684 [Abstract].
23.
Jose, P. J.,
I. K. Moss,
R. N. Maini, and
T. J. Williams.
1990.
Measurement of the chemotactic complement fragment C5a in rheumatoid
synovial fluids by radioimmunoassay: role of C5a in the acute inflammatory phase.
Ann. Rheum. Dis.
49:
747-752
24. Borish, L., A. Aarons, J. Rumbyrt, P. Cvietusa, J. Negri, and S. Wenzel. 1996. Interleukin-10 regulation in normal subjects and patients with asthma. J. Allergy Clin. Immunol. 97: 1288-1296 [Medline].
25. Bach, M. K., and J. R. Brashler. 1995. Evidence that granulocyte/macrophage-colony-stimulating factor and interferon-gamma maintain the viability of human peripheral blood monocytes in part by their suppression of IL-10 production. Int. Arch. Allergy Immunol. 107: 90-92 [Medline].
26.
Chomarat, P.,
M. C. Rissoan,
J. Banchereau, and
P. Miossec.
1993.
Interferon gamma inhibits interleukin 10 production by monocytes.
J. Exp.
Med.
177:
523-527
27. Donnelly, R. P., S. L. Freeman, and M. P. Hayes. 1995. Inhibition of IL-10 expression by IFN-gamma up-regulates transcription of TNF- alpha in human monocytes. J. Immunol. 155: 1420-1427 [Abstract].
28.
Platzer, C.,
C. Meisel,
K. Vogt,
M. Platzer, and
H. D. Volk.
1995.
Up-regulation of monocytic IL-10 by tumor necrosis factor-
and cAMP
elevating drugs.
Int. Immunol.
7:
517-523
29.
Oswald, I. P.,
T. A. Wynn,
A. Sher, and
S. L. James.
1992.
Interleukin 10 inhibits macrophage microbicidal activity by blocking the endogenous
production of tumor necrosis factor alpha required as a costimulatory
factor for interferon gamma-induced activation.
Proc. Natl. Acad. Sci.
U.S.A.
89:
8676-8680
30. Wang, P., P. Wu, M. I. Siegel, R. W. Egan, and M. M. Billah. 1994. IL-10 inhibits transcription of cytokine genes in human peripheral blood mononuclear cells. J. Immunol. 153: 811-816 [Abstract].
31. Moore, K. W., A. O'Garra, R. de Waal, Malefyt, P. Vieira, and T. R. Mosmann. 1993. Interleukin-10. Annu. Rev. Immunol. 11: 165-190 [Medline].
This article has been cited by other articles:
![]() |
S. V. Culpitt, D. F. Rogers, P. Shah, C. De Matos, R. E. K. Russell, L. E. Donnelly, and P. J. Barnes Impaired Inhibition by Dexamethasone of Cytokine Release by Alveolar Macrophages from Patients with Chronic Obstructive Pulmonary Disease Am. J. Respir. Crit. Care Med., January 1, 2003; 167(1): 24 - 31. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. Mattos, S. Lim, R. Russell, A. Jatakanon, K. F. Chung, and P. J. Barnes Matrix Metalloproteinase-9 Expression in Asthma: Effect of Asthma Severity, Allergen Challenge, and Inhaled Corticosteroids Chest, November 1, 2002; 122(5): 1543 - 1552. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Careau, J. Sirois, and E. Y. Bissonnette Characterization of Lung Hyperresponsiveness, Inflammation, and Alveolar Macrophage Mediator Production in Allergy Resistant and Susceptible Rats Am. J. Respir. Cell Mol. Biol., May 1, 2002; 26(5): 579 - 586. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. J. Smith, D. J. Cousins, Y.-K. Jee, D. Z. Staynov, T. H. Lee, and P. Lavender Suppression of Granulocyte-Macrophage Colony-Stimulating Factor Expression by Glucocorticoids Involves Inhibition of Enhancer Function by the Glucocorticoid Receptor Binding to Composite NF-AT/Activator Protein-1 Elements J. Immunol., September 1, 2001; 167(5): 2502 - 2510. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. P. O'GRADY, H. L. PREAS II, J. PUGIN, C. FIUZA, M. TROPEA, D. REDA, S. M. BANKS, and A. F. SUFFREDINI Local Inflammatory Responses following Bronchial Endotoxin Instillation in Humans Am. J. Respir. Crit. Care Med., June 1, 2001; 163(7): 1591 - 1598. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Crawley, S. Kon, and P. Woo Hereditary predisposition to low interleukin-10 production in children with extended oligoarticular juvenile idiopathic arthritis Rheumatology, May 1, 2001; 40(5): 574 - 578. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. M. GAUVREAU, L. J. WOOD, R. SEHMI, R. M. WATSON, S. C. DORMAN, R. P. SCHLEIMER, J. A. DENBURG, and P. M. O'BYRNE The Effects of Inhaled Budesonide on Circulating Eosinophil Progenitors and Their Expression of Cytokines after Allergen Challenge in Subjects with Atopic Asthma Am. J. Respir. Crit. Care Med., December 1, 2000; 162(6): 2139 - 2144. [Abstract] [Full Text] |
||||
![]() |
S. LIM, N. ROCHE, B. G. OLIVER, W. MATTOS, P. J. BARNES, and K. FAN CHUNG Balance of Matrix Metalloprotease-9 and Tissue Inhibitor of Metalloprotease-1 from Alveolar Macrophages in Cigarette Smokers . Regulation by Interleukin-10 Am. J. Respir. Crit. Care Med., October 1, 2000; 162(4): 1355 - 1360. [Abstract] [Full Text] [PDF] |
||||
![]() |
M J Plummeridge, L Armstrong, M A Birchall, and A B Millar Reduced production of interleukin 12 by interferon gamma primed alveolar macrophages from atopic asthmatic subjects Thorax, October 1, 2000; 55(10): 842 - 847. [Abstract] [Full Text] |
||||
![]() |
C. MARGUET, T. P. DEAN, and J. O. WARNER Soluble Intercellular Adhesion Molecule-1 (sICAM-1) and Interferon-Gamma in Bronchoalveolar Lavage Fluid from Children with Airway Diseases Am. J. Respir. Crit. Care Med., September 1, 2000; 162(3): 1016 - 1022. [Abstract] [Full Text] |
||||
![]() |
C. T. LEONARD, P. M. SOCCAL, L. SINGER, G. J. BERRY, J. THEODORE, P. G. HOLT, R. L. DOYLE, and G. D. ROSEN Dendritic Cells and Macrophages in Lung Allografts . A Role in Chronic Rejection? Am. J. Respir. Crit. Care Med., April 1, 2000; 161(4): 1349 - 1354. [Abstract] [Full Text] |
||||
![]() |
P. J. BARNES Endogenous Inhibitory Mechanisms in Asthma Am. J. Respir. Crit. Care Med., March 1, 2000; 161(3): S176 - 181. [Full Text] [PDF] |
||||
![]() |
C. M. Hogaboam, K. Blease, B. Mehrad, M. L. Steinhauser, T. J. Standiford, S. L. Kunkel, and N. W. Lukacs Chronic Airway Hyperreactivity, Goblet Cell Hyperplasia, and Peribronchial Fibrosis during Allergic Airway Disease Induced by Aspergillus fumigatus Am. J. Pathol., February 1, 2000; 156(2): 723 - 732. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. T. Umetsu and R. H. DeKruyff Interleukin-10 . The Missing Link in Asthma Regulation? Am. J. Respir. Cell Mol. Biol., November 1, 1999; 21(5): 562 - 563. [Full Text] |
||||
![]() |
K F Chung and P J Barnes Cytokines in asthma Thorax, September 1, 1999; 54(9): 825 - 857. [Full Text] |
||||
![]() |
P. J. Barnes, K. F. Chung, and C. P. Page Inflammatory Mediators of Asthma: An Update Pharmacol. Rev., December 1, 1998; 50(4): 515 - 596. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS |