|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
 |
ABSTRACT |
|---|
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES
|
|---|
Interleukin-1 (IL-1) is a proinflammatory cytokine produced by blood-borne and resident inflammatory
lung tissue involved in the thrombotic occlusion of the pulmonary microcirculation and the increase
of the vascular permeability following a wide variety of injuries and sepsis. The locally accentuated,
organ-related activation of this cytokine seems to be responsible for the development of acute lung
injury. The present study was conducted to determine if IL-1
was produced in an ischemia-reperfusion (I/R) rat model subjected to lung injury. We measured sequential perfusate levels of IL-1 by
ELISA and we measured IL-1 gene expression in the rat lung tissue by a reverse-transcriptase polymerase chain reaction method. Little IL-1 gene expression was observed in normal rat lung tissue.
Perfusate IL-1 slightly increased 2 h after induced ischemia and 3 h after reperfusion. IL-1 gene expression rapidly increased as early as 30 min after ischemia and continued to increase for up to 120 min. IL-1 gene expression was dramatically upregulated during reperfusion after cessation of ischemia, reached a peak at 1 h, and then gradually decreased (2 to 3 h) to near baseline levels. During
ischemia, the increased IL-1 gene expression was not significantly different between the ventral and
dorsal sites of the lung. However, IL-1 gene expression markedly increased on the dorsal part (the dependent site for a rat in a supine position) after reperfusion. From these results, it appears that IL-1
may have an important role in I/R lung injury.
| |
INTRODUCTION |
|---|
|
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES
|
|---|
Microvascular injury produced by ischemia/reperfusion (I/R) is a pathophysiologic event with broad clinical relevance. It has been shown that I/R disrupts the microvascular endothelial membrane, which increases the permeability of this barrier to fluid, small solutes, and macromolecules. Tissue injury that accompanies I/R shares features with the host response in inflammation, suggesting that cytokines may act as mediators in this setting (1, 2),
Previously, we have successfully induced acute lung injury in Sprague-Dawley rats by the ischemia and reperfusion method (3). Hypoxia has been shown to induce endothelial cells to express and secrete a number of different cytokines, including endothelin (4), platelet-derived growth factor (5), and interleukin-1 (IL-1) (6).
In the lung, cytokines are produced either by local resident cells such as alveolar macrophages, pneumocytes, endothelial cells, and fibroblasts or by cells such as neutrophils, lymphocytes, and platelets reaching the lung in response to local or systemic stimuli (7).
IL-1 is a 17-kD polypeptide that is produced by a variety of cells and is believed to play a major role in host defense and inflammation (8, 9). Nearly every tissue examined produces IL-1, although the highest levels are found in the liver, spleen, and lung (10). Furthermore, IL-1 has been found to be elevated in bronchoalveolar lavage fluid and plasma from patients with adult respiratory distress syndrome (11).
Recombinant cDNA technology has permitted identification of the existence, structure, and functions of novel cytokines; made the cytokines available in sufficient quantity for detailed study; and prompted interest in the regulation of gene expression in the evolution and resolution of inflammation. New transcription of IL-1, by using a rabbit model, has been observed in various tissues as early as 15 min after an intravenous injection of a nonlethal dose of endotoxin. IL-1 has been measured in the bloodstream and tissues at 30 min after endotoxin injection, with peak levels at 2 to 4 h (10).
In the current studies, IL-1 expression in an I/R acute lung injury tissue model was determined and analyzed. Advances in our understanding of the pathogenesis of acute lung injury at the molecular level will provide clinicians with powerful new forms of treatment.
| |
METHODS |
|---|
|
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES
|
|---|
Acute Lung Injury Model
The procedure used for preparing the isolated perfused lungs from male Sprague-Dawley rats was similar to that previously described (3). Briefly, the rats, weighing 300 to 350 g, were deeply anesthetized in a supine position with an injection of phenobarbital sodium (30 mg intraperitoneally). After a tracheostomy was performed, the lungs were artificially ventilated (Model 131; Nemi Scientific Inc., MA) with room air. A midsternal thoracotomy was performed and heparin (1 U/ g) was administered intravenously. The blood was collected from the right ventricle until the lungs were uniformly pale and then discarded. Twenty milliliters of sterile Hanks' balanced salt solution ([in mM] NaCl, 136.9; KCl, 5.4; glucose, 5.6; KH2PO4, 0.4; and Na2HPO4, 0.3) was subsequently used to perfuse the isolated lungs. A cannula was placed in the pulmonary artery through a puncture in the right ventricle, and a tight ligature was placed around the main trunk of the pulmonary artery and the aorta to prevent loss of perfusate into the systemic circulation. A large catheter was inserted into the left atrium through the left ventricle and mitral valve, fixed by a ligature at the apex of the heart, and used to divert the pulmonary venous outflow into a reservoir. Another ligature was placed above the arterioventricular junction to prevent the perfusate from flowing into the ventricles (12). Perfusion was carried out by the use of a peristaltic pump (Minipuls 3; Gilson, Villiers Je Bel France) at a flow rate of 8 ml/min.
The isolated perfused lungs were left in situ, and the whole rat was placed on an electronic balance. In a pilot test, blood was added to the perfusate as a tracer. We found that it takes 7 s from the entrance of the right ventricle to the three-way switches outside the orifice of the left atrium after the pump was started. We thus used perfusate collected between 6 and 8 s (fluid supposed to be contained in the lungs) for assay.
A heat exchanger in a constant-temperature water bath maintained the perfusion fluid at 37 ± 0.5° C. After an initial hyperventilation to reverse atelectasis, the lungs were ventilated at 65 to 70 breaths/ min and a tidal volume of 2 ml. The end-expiratory pressure was set at 2 cm H2O.
Isolated lung preparations were used in this study only if they satisfied three criteria: absence of any leakage at the sites of cannula insertion, no evidence of hemostasis or edema, and an isogravimetric state.
Induction of Ischemia and Reperfusion
The lungs were subjected to different durations (30 to 120 min) of ischemia by stopping both ventilation and perfusion. Ventilation was stopped at the end of inspiration to keep the lungs inflated so as to facilitate reperfusion after ischemia. After the interval of ischemia, the lungs were reperfused for different durations (30 to 240 minutes) and ventilated with room air.
Perfusate Gas Analysis
Perfusate was collected at different time points after ischemia or I/R, and gas analysis was performed (Radiometer Copenhagen ABL3, NY).
Perfusate IL-1 Determination
About 0.5 ml of perfusate was collected and concentrated (2-fold
through a microconcentrator (Centricon 10; Amicon, MA). The IL-1
concentration was determined by ELISA (10 to 1,000 pg/ml; Genzyme, MA).
Determination IL-1 gene Expression in Lung Tissue
Extraction of RNA
The right lung was harvested through a median sternotomy for almost all the studies. To determine the effect of gravity on IL-1 gene expression induced by ischemia and I/R, the right lung tissue was separated lontitudinally from the apex to the base into two parts of almost the same weight. Lung tissue samples were homogenized in 5 ml of TRIzol reagent (total RNA isolation reagent; GIBCO BRL) using cutting and a sonicator (Micro Ultrasonic Cell Disrupter; Kontes). The homogenized samples were incubated for 5 min at room temperature to permit the complete dissociation of nucleoprotein complexes. One milliliter of chloroform was added to the tubes, and the tubes were shaken vigorously by hand for 15 s and incubated at room temperature for 2 to 3 min. The samples were centrifuged at 12,000 × g for 15 min at 4° C. After centrifugation, 3 ml of the aqueous phase (RNA remained) was collected and transferred to a fresh tube. A total of 2.5 ml of isopropyl alcohol was added and mixed well by hand to precipitate RNA. The supernate was removed, and the RNA pellet was washed once with 5 ml of 75% ethanol. The samples were mixed by vortexing and centrifuged at 7,500 × g for 5 min at 4° C. At the end of the procedure, the RNA pellet was air-dried for 5 min, 50 µl of diethyl pyrocarbonate (DEPC; Sigma, MO)-treated distilled water was added, and the RNA pellet was dissolved completely.
cDNA synthesis. The first-strand cDNA of IL- was synthesized
by the RT SuperScriptTM Preamplification System (Life Technologies). Briefly, 1 µl of oligo (dT) was added with DEPC-treated H2O to
12 µl. Each sample was incubated at 70° C for 10 min to denature the
RNA structure and then incubated on ice for 1 min. Seven microliters
of reaction mixture (2 µl of 10 × PCR buffer, 2 µl of 25 mM MgCl2, 1 µl
of 10 mM dNTP mix, 2 µl of 0.1 M DTT) was added to each RNA/
primer mixture, mixed gently, and collected by brief centrifugation. One microliter (200 U) of SuperScript II RT was then added to each
tube, mixed, and incubated at 42° C for 50 min. These reactions were
terminated at 70° C for 15 min and chilled on ice. The reactions were
collected by brief centrifugation. One microliter of RNase H was
added to each tube, and the tubes were incubated for 20 min at 37° C.
Amplification of the target cDNA. Two microliters of the first-strand cDNA obtained was amplified directly using polymerase chain
reaction (PCR) according to the method of Saiki and colleagues (13).
The following conditions were used: denaturation at 94° C for 45 s; annealing at 60° C for 45 s; extension at 72° C for 1.5 min, followed by
72° C for 10 min. The reaction was initiated by adding 2 U of TaqDNA
polymerase, after which 25 to 35 cycles were carried out, depending
upon the target gene (25 cycles for -actin and 35 cycles for IL-1).
DNA thermal cycler and Taq DNA polymerase were purchased from
Perkin-Elmer Cetus. The IL-1 primers sequences (14) used in this
experiment were: GACCTGTTCTTTGAGGCTGAC (sense) and TTCATCTCGAAGCCTGCAGTG (antisense) for IL-1 (15) and AGCTGAGAGGGAAATCGTGC (sense) and ACCAGACAGCACTGTGTTGG (antisense) for -actin (16).
DNA transfer. Ten-microliter PCR products and molecular weight markers (BioMarkerTM LOW; BioVentures, Inc., TN) plus 2 µl of running dye were subjected to electrophoresis on a 2.2% agarose gel for 1.5 h and visualized by means of ethidium bromide staining. The gel was first soaked with 0.25 N HCl at room temperature for 15 min for depurinenation, followed by two washes with DEPC-treated distilled water. The gel was then soaked with denaturation buffer (NaOH, 0.5 M; NaCl, 1 M) for 30 min at room temperature, followed by two washes with DEPC-treated distilled water. The gel was finally soaked with 5 × TRIS-borate (TBE) for 10 min at room temperature twice and then with 0.5 × TBE for 10 min. The DNA was transferred from the agarose gel to a nylon membrane (Qiabrane; Qiagen, Germany) by capillary blotting overnight and fixed by baking (120° C, 30 min) (17).
DNA detection. The BioNick labeling system was used (Life Technologies). The biotin-labeled DNA probes were made by nick translation using biotin-14-dATP. The hybridized biotinylated probe was detected by use of the Phototope Detection Kit (New England Biolabs, Inc., MA) with alkaline phosphatase-streptavidin complex and by soaking in the luminescent substrate (Lumigen-PPD reagent) for 5 min. The probes were then wrapped in a cassette and exposed to Kodak Scientific Imaging X-ray film (Eastman Kodak Co., NY). The exposure time was 3 min.
DNA quantitation. The blots were quantitated through the use of a computing densitometer (Molecular Dynamics, CA) with the program of ImageQuant. Relative percentages were demonstrated to represent the amount of gene expression.
Data Analyses. Values are expressed as mean ± SD. Comparisons within each group for a given parameter were made using paired or independent Student's t test as appropriate. A value of p < 0.05 was considered to be significant.
| |
RESULTS |
|---|
|
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES
|
|---|
Perfusate pH, PaO2, PaCO2, and IL-1 were measured directly
while ischemia or I/R was induced from zero to 240 min. Ischemia decreased oxygen tension in a time-dependent manner,
and reperfusion reversed the PaO2 quickly (by 30 min) and
consistently (Table 1). pH and PaCO2 did not change significantly either during ischemia or I/R; however, IL-1 levels
were significantly increased after 120 min of ischemia and after 210 and 240 min of reperfusion preceded by 30 min of ischemia (Figure 1).
|
|
To define changes in IL-1 gene expression in transient
lung ischemia, a semi-quantitative PCR procedure was carried
out. Products of the expected size were obtained by PCR using primers specific for IL-1 and -actin on rat lung tissue.
A significant increase of IL-1 gene expression occurred 30 min after ischemia when compared with baseline (5.4-fold increase; 19.4 ± 3.4% versus 3.6 ± 0.4%, p = 0.001), reached a
peak at 120 min (45.3 ± 6.1%), and then decreased (Figure 2).
PCR products of similar size were obtained from control (no
ischemia) rat lung, but the expression was much less.
|
Semi-quantitative PCR revealed that IL-1 gene expression rapidly increased as early as 30 min after reperfusion preceded by 60 min of ischemia when compared with 60 min of
ischemia without reperfusion (17.3 ± 1.1% versus 12.9 ± 1.5%,
p = 0.014), reached a peak after 1 h of reperfusion (18.7 ± 1.0%), and gradually decreased to near baseline levels (Figure 2).
IL-1 gene expression was dramatically upregulated to the
same level after 90 min of ischemia on both the dependent
(dorsal; 33.8 ± 2.5%) and independent (ventral; 34 ± 3.1%)
sites of lung tissue (Figure 3). However, 60 min of reperfusion
preceded by 30 min of ischemia demonstrated a significant difference (p = 0.001), with a dramatically upregulated IL-1 gene
expression on the dependent (dorsal; 24.1 ± 3.1%) site of lung
tissue (Figure 3) when compared with the independent (ventral; 8.3 ± 1.9%) site.
|
| |
DISCUSSION |
|---|
|
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES
|
|---|
In addition to its vital role in oxygenating blood and removing carbon dioxide, the pulmonary circulation has important metabolic activities. Acute lung injury leads to failure of both the gas-exchanging and metabolic functions of the pulmonary circulation. Histologically, lung injury is characterized by high-permeability pulmonary edema, endothelial damage, leukocyte accumulation, and severe hypoxemia in lung tissue (18, 19). Despite many potential different etiologies, hypoxemia is a common final pathway.
Previously, we have successfully induced acute lung injury by I/R and hypoxia/reoxygenation methods in Sprague-Dawley rats (3). Recent work has focused attention on the role of inflammatory cells in the tissue damage that occurs in ischemic syndrome (20). However, limited information is currently available about the direct influence of hypoxemia on cytokine synthesis and secretion.
Leukocytes and vascular cells interact closely in inflammation, thrombosis, and immunity (22). Cytokines are crucial mediators of the bi-directional interaction between leukocytes and endothelial cells. The inflammatory cytokines IL-1 and tumor necrosis factor (TNF) modulate the process of extravasation and localization of leukocytes at inflammatory sites, which involve adhesion and passage through endothelial linings of leukocytes in response to tissue-derived signals. IL-1 elicits a complex set of changes in endothelial cells that include the production of PGI2 (23), PAF (24), factors acting on coagulation and fibrinolysis, membrane adhesion molecules, and lymphokines (25). Cytokines such as IL-1 play a key role in mediating the host inflammatory response and are likely candidates to draw leukocytes to loci of hypoxic vascular injury.
I/R injury induces the production and release of hepatic-derived TNF-
(27). After a single episode of renal ischemic
injury, the expression of mRNA for IL-2, IL-10, and TNF-
was increased in wild-type mice (28). Gut also could be a cytokine-generating organ, with TNF- and IL-6 secretion in
rats subjected to hemorrhagic shock (29). IL-1 mRNA induction in experimental models of brain and retinal ischemia have
been reported (30, 31).
To investigate the involvement of IL-1 in I/R lung injury, we examined the time course of IL-1 gene expression using semi-quantitative PCR and clearly demonstrated that there was little expression of IL-1 mRNA in normal lung tissue and that it was highly upregulated after transient lung ischemia in a time-dependent manner. Marked upregulation of IL-1 gene expression was observed after reperfusion, beginning as early as 30 min after cessation of ischemia. This is an important finding that indicates probable involvement of IL-1 in lung damage during the early stage of reperfusion. However, we must interpret the significance of IL-1 gene expression shown in the present study with caution, because transcription without translation of IL-1 can be observed (32), although our results have demonstrated low levels of IL-1 in perfusate in the late phase of ischemia and reperfusion.
Oxidant stress plays a major role in the pathophysiologic processes associated with I/R injury (33, 34). Microvascular lung injury caused by I/R may occur via oxygen radicals as the initial proinflammatory event during I/R injury. In fact, our previous studies have demonstrated that dimenthylthiourea, a potent scavenger of hydroxy radical and hydrogen peroxide, ameliorates acute lung injury induced by phorbol myristate acetate in dogs (35). IL-1 is known to induce production of reactive oxygen species, which have been suggested to act as second messengers (36). That hydroxyl radical scavengers inhibit IL-1-induced cyclooxygenase expression suggests that antioxidants may reverse the cytokine-induced tissue injury.
Deeb and colleagues (37) induced rat lung injury, in the absence of circulating blood elements, when ischemic lungs were reperfused with physiologic salt solution alone. Reperfusion with whole blood or physiologic salt solution supplemented with rat neutrophils did not increase lung injury; thus, they suggested that neutrophils are not necessary for induction of I/R lung injury. Our studies, using Hanks' solution, demonstrated similar results. However, Seibert and associates (38) showed that isolated, buffer-perfused rat lungs are not free of endogenous leukocytes and that these in situ leukocytes contribute to I/R lung injury. There is some evidence that neutrophils contribute to I/R injury. Neutrophil depletion greatly attenuates post-ischemic cellular dysfunction in many organs (39, 40). Agents that prevent neutrophil activation or accumulation in reperfused tissues reduce I/R tissue injury (39), and immunoneutrolization of neutrophil adhesion molecules is effective in preventing I/R-induced neutrophil sequestration and increased microvascular permeability in involved tissues (39, 40). In addition, a recent review from Moore and colleagues (41) demonstrated that oxygen radicals are generated by neutrophils, which are sequestered and activated in the ischemic-reperfused pulmonary tissue, and by xanthine oxidase, which is upregulated by ischemia and/or activated neutrophils. These findings indicate that leukocytes (at least neutrophils) may still play the major role in I/R-induced microvascular injury.
This study supports the possibility that IL-1 is produced in the lung and may have an important role in the pathogenesis of I/R lung injury. Further study is warranted to ascertain the exact role of IL-1 in the pathogenesis of lung ischemia; for this purpose, for example, in situ hybridization of IL-1 to determine which cells are responding with increased IL-1 gene expression, and blockade IL-1 effects by antioxidants or IL-1 receptor antagonist will be useful. It may enable us to design new therapeutic approaches to the various ischemic disorders of the lung.
| |
Footnotes |
|---|
Correspondence and requests for reprints should be addressed to Deh-Ming Chang, M.D., Rheumatology/Immunology/Allergy, Tri-Service General Hospital, #8, Section 3, Ting-Chow Rd., Taipei, Taiwan, Republic of China.
(Received in original form February 21, 1997 and in revised form May 14, 1997).
Acknowledgments: The writers deeply thank Dr. Peter H. Schur for his critical review and advice.
Supported in part by Grants NSC 84-2331-B-016-032 and NSC 85-2331-B-016-078 M28.
| |
References |
|---|
|
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES
|
|---|
1. Casey, L. C. 1993. Role of cytokines in the pathogenesis of cardiopulmonary-induced multisystem organ failure. Ann. Thorac. Surg. 56(Suppl. 5):S92-S96.
2.
Colletti, L.,
D. Remick,
G. Burtch,
S. Kunkel,
R. Strieter, and
D. Campbell.
1990.
Role of tumor necrosis factor in the pathophysiologic alterations after hepatic ischemia/reperfusion in the rat.
J. Clin. Invest.
85:
1936-1943
.
3.
Hsu, K.,
D. Wang,
S. Y. Wu,
C. Y. Shen, and
H. I. Chen.
1994.
Ischemia-reperfusion lung injury attenuated by ATP-MgCl2 in rats.
J. Appl. Physiol.
76:
545-552
4. Kourembanas, S., P. A. Marsden, L. P. McQuillan, and D. V. Faller. 1991. Hypoxia induces endothelin gene expression and secretion in cultured human endothelium. J. Clin. Invest. 88: 1054-1057 .
5.
Kourembanas, S.,
R. L. Hannan, and
D. V. Faller.
1990.
Oxygen tension
regulates the expression of the platelet-derived growth factor- chain
gene in human endothelial cells.
J. Clin. Invest.
86:
670-674
.
6.
Shreeniwas, R.,
S. Koga,
M. Karakurum,
D. Pinsky,
E. Kaiser,
J. Brett, and
B. A. Wolitzky.
1992.
Hypoxia-mediated induction of endothelial
cell interleukin-1. An autocrine mechanism promoting expression of
leukocyte adhesion molecules on the vessel surface.
J. Clin. Invest.
90:
2333-2339
.
7. Kelly, J.. 1990. Cytokines of the lung. Am. Rev. Respir. Dis. 141: 765-788 [Medline].
8. Dinarello, C. A.. 1989. Interleukin-1 and its biologically related cytokines. Adv. Immunol. 44: 153-205 [Medline].
9. Arend, W. P., and J.-M. Dayer. 1990. Cytokines and cytokine inhibitors or antagonists in rheumatoid arthritis. Arthritis Rheum. 33: 305-315 [Medline].
10.
Clark, B. D.,
L. Bedrosian, and
R. J. Schindler.
1991.
Detection of interleukin-1 alpha and 1 beta in rabbit tissues during endotoxemia using
sensitive radioimmunoassays.
J. Appl. Physiol.
71:
2412-2418
11. Pugin, J., B. Ricou, K. P. Steinberg, P. M. Suter, and T. R. Martin. 1996. Proinflammatory activity in bronchoalveolar lavage fluids from patients with ARDS: a prominent role for interleukin-1. Am. J. Respir. Crit. Care Med. 153: 1850-1856 [Abstract].
12.
Wang, D.,
M. H. Li,
K. Hsu,
C. Y. Shen, and
H. I. Chen.
1992.
Air embolism-induced lung injury in isolated rat lungs.
J. Appl. Physiol.
72:
1235-1242
13.
Saiki, P. K.,
D. H. Gelfand, and
S. Stoffel.
1988.
Primer-directed enzymatic amplification of DNA with a thermostable DNA polymerase.
Science
239:
487-491
14.
Gray, P. W.,
D. Glaister,
E. Chen,
D. V. Goeddel, and
D. Pennica.
1986.
Two interleukin 1 genes in the mouse: cloning and expression of the cDNA for murine interleukin 1 .
J. Immunol.
137:
3644-3648
[Abstract].
15.
Nishida, T.,
T. Hirato, and
N. Nishino.
1988.
Cloning of the cDNA for
rat interleukin-1- and .
Prog. Leukocyte Biol.
8:
73-78
.
16.
Nudel, U.,
R. Zakut,
M. Shani,
S. Neuman,
Z. Levy, and
D. Yaffe.
1983.
The nucleotide sequence of the rat cytoplasmic -actin gene.
Nucleic Acids Res.
11:
1759-1771
17. Pollard-Knight, D., A. C. Simmonds, A. P. Schaap, H. Akhavan, and M. A. Brady. 1990. Nonradioactive DNA detection on Southern blots by enzymatically triggered chemiluminescence. Analy. Biochem. 185: 353-358 . [Medline]
18. Said, S. I. 1991. The Pulmonary Circulation and Acute Lung Injury, 2nd ed. Futura Publishing Co., Mount Kisco, NY. 3-11.
19. Bernard, G. R., A. Artigas, K. L. Brigham, J. Carlet, K. Falke, L. Hudson, M. Lamy, J. Legall, A. Morris, and R. Spragg. 1994. The American-European consensus conference on ARDS: definition, mechanisms, relevant outcomes, and clinical trial coordination. Am. J. Respir. Crit. Care Med. 149: 818-824 [Abstract].
20. Repine, J., J. Cheronis, T. Rodell, S. Linas, and A. Patt. 1987. Pulmonary oxygen toxicity and ischemia reperfusion injury. Am. Rev. Respir. Dis. 136: 483-485 [Medline].
21.
Dreyer, W. J.,
L. H. Michael,
M. S. West,
C. W. Smith,
R. Rothlein,
R. D. Rossen,
D. C. Anderson, and
M. L. Entman.
1988.
Neutrophil accumulation in ischemia canine myocardium.
Circulation
84:
400-411
22. Mantovani, A., and E. Dejana. 1989. Cytokines as communication signals between leukocytes and vascular endothelial cells. Immunol. Today 10: 370-372 [Medline].
23.
Rossi, V. F.,
P. Breviario,
E. Ghezzi,
E. Dejana, and
A. Mantovani.
1985.
Prostacyclin synthesis induced in vascular cells by interleukin-1.
Science
229:
174-175
24. Bussolino, F., F. Breviario, C. Tetta, M. Aglietta, A. Mantovani, and E. Dejana. 1986. Interleukin-1 stimulates platelet-activating factor production in cultured human endothelial cells. J. Clin. Invest. 77: 2027-2030 .
25.
Bevilacqua, M. P.,
J. S. Pober,
G. R. Majeau,
R. S. Cotran, and
M. A. Gimbrone Jr..
1984.
Interleukin-1 induces biosynthesis and cell surface expression of procoagulant activity in human vascular endothelial
cells.
J. Exp. Med.
160:
618-621
26. Bevilacqua, M. P., J. S. Pober, M. E. Wheeler, R. S. Cotran, and M. A. Gimbrone Jr.. 1985. Interleukin-1 acts on cultured human vascular endothelium to increase the adhesion of polymorphonuclear leukocytes, monocytes and related leukocyte cell lines. J. Clin. Invest. 76: 2003-2006 .
27. Colletti, L. M., S. L. Kunkel, A. Walz, M. D. Burdick, R. G. Kunkel, C. A. Wilke, and R. M. Strieter. 1996. The role of cytokine networks in the local liver injury following hepatic ischemia/reperfusion in the rat. Hepatology 23: 506-514 [Medline].
28. Goes, N., J. Urmson, D. Vincent, and P. F. Halloran. 1995. Acute renal injury in the interferon-gamma gene knockout mouse: effect on cytokine gene expression. Transplantation 60: 1560-1564 [Medline].
29. Deitch, E. A., D. Xu, L. Franko, A. Ayala, and I. H. Chaudry. 1994. Evidence favoring the role of the gut as a cytokine-generating organ in rats subjected to hemorrhagic shock. Shock 1: 141-145 [Medline].
30.
Liu, T.,
P. C. McDonnell, and
P. R. Young.
1993.
Interleukin-1 mRNA
expression in ischemic rat cortex.
Stroke
24:
1746-1750
31.
Hangai, M.,
N. Yoshinura,
M. Yoshida,
K. Yabunchi, and
Y. Honda.
1995.
Interleukin-1 gene expression in transient retinal ischemia in the rat.
Invest. Ophthalmol. Vis. Sci.
36:
571-578
32.
Dinarello, C. A..
1991.
Interleukin-1 and interleukin-1 antagonism.
Blood
77:
1627-1652
33. Adkinson, D., M. E. Hollwarth, J. N. Benoit, D. A. Parks, J. M. McCord, and D. N. Granger. 1986. Role of free radicals in ischemia-reperfusion injury to the liver. Acta Physiol. Scand. 126: 101-108 .
34. Klausner, J. M., I. S. Paterson, L. Kobzik, C. R. Valeri, D. Shepro, and H. B. Hechtman. 1989. Oxygen free radicals mediate ischemia-induced lung injury. Surgery 105(2, Pt. 1):192-199.
35. Hsu, K., D. Wang, M. H. Li, C. H. Chiang, and C. Y. Shen. 1992. Dimethylthiourea ameliorates acute lung injury induced by phorbol myristate acetate in dogs. Crit. Care Med. 20: 823-830 [Medline].
36.
Lo, Y. Y. C.,
J. M. S. Wang, and
T. F. Cruz.
1996.
Reactive oxygen species mediate cytokine activation of c-jun NH2-terminal kinases.
J. Biol.
Chem.
271:
15703-15707
37.
Deeb, G. M.,
C. M. Grum,
M. J. Lynch,
T. P. Guynn,
K. P. Gallagher,
A. G. Ljungman,
S. F. Bolling, and
M. L. Morganroth.
1990.
Neutrophils are not necessary for induction of ischemia-reperfusion lung injury.
J. Appl. Physiol.
68:
374-381
38. Seibert, A. F., J. Haynes, and A. Taylor. 1993. Ischemia-reperfusion injury in the isolated rat lung: role of flow and endogenous leukocytes. Am. Rev. Respir. Dis. 147: 270-275 [Medline].
39.
Moore, T. M.,
P. Khimenko,
W. K. Adkins,
M. Miyasaka, and
A. E. Taylor.
1995.
Adhesion molecules contribute to ischemia and reperfusion-induced injury in the isolated rat lung.
J. Appl. Physiol.
78:
2245-2252
40. Nose, P. S.. 1993. Cytokines and reperfusion injury. J. Cardiovasc. Surg. 8: 305-308 .
41. Moore, T. M., P. L. Khimenko, and A. E. Taylor. 1996. Endothelial damage caused by ischemia and reperfusion and different ventilatory strategies in the lung. Chinese J. Physiol. 39: 65-81 .
This article has been cited by other articles:
 |
|
 |
|
  G. Su, M. Hodnett, N. Wu, A. Atakilit, C. Kosinski, M. Godzich, X. Z. Huang, J. K. Kim, J. A. Frank, M. A. Matthay, et al. Integrin {alpha}vbeta5 Regulates Lung Vascular Permeability and Pulmonary Endothelial Barrier Function Am. J. Respir. Cell Mol. Biol., March 1, 2007; 36(3): 377 - 386. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. Pirat, P. Zeyneloglu, D. Aldemir, M. Yucel, O. Ozen, S. Candan, and G. Arslan Pretreatment with Simvastatin Reduces Lung Injury Related to Intestinal Ischemia-Reperfusion in Rats Anesth. Analg., January 1, 2006; 102(1): 225 - 232. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 T. B. Reece, V. E. Laubach, C. G. Tribble, T. S. Maxey, P. I. Ellman, P. S. Warren, A. M. Schulman, J. Linden, J. A. Kern, and I. L. Kron Adenosine A2A Receptor Agonist Improves Cardiac Dysfunction From Pulmonary Ischemia-Reperfusion Injury Ann. Thorac. Surg., April 1, 2005; 79(4): 1189 - 1195. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 T. Waldow, K. Alexiou, W. Witt, F. M. Wagner, V. Gulielmos, K. Matschke, and M. Knaut Attenuation of Reperfusion-Induced Systemic Inflammation by Preconditioning With Nitric Oxide in an In Situ Porcine Model of Normothermic Lung Ischemia Chest, June 1, 2004; 125(6): 2253 - 2259. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 K. Odoms, T. P. Shanley, and H. R. Wong Short-term modulation of interleukin-1{beta} signaling by hyperoxia: uncoupling of I{kappa}B kinase activation and NF-{kappa}B-dependent gene expression Am J Physiol Lung Cell Mol Physiol, March 1, 2004; 286(3): L554 - L562. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 B. Krishnadasan, B. V. Naidu, K. Byrne, C. Fraga, E. D. Verrier, and M. S. Mulligan The role of proinflammatory cytokines in lung ischemia-reperfusion injury J. Thorac. Cardiovasc. Surg., February 1, 2003; 125(2): 261 - 272. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 T. YAMADA, M. HISANAGA, Y. NAKAJIMA, S. MIZUNO, K. MATSUMOTO, T. NAKAMURA, and H. NAKANO Enhanced Expression of Hepatocyte Growth Factor by Pulmonary Ischemia-Reperfusion Injury in the Rat Am. J. Respir. Crit. Care Med., August 1, 2000; 162(2): 707 - 715. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 K. Toda, K. Kayano, A. Karimova, Y. Naka, T. Fujita, K. Minamoto, C. Y. Wang, and D. J. Pinsky Antisense Intercellular Adhesion Molecule-1 (ICAM-1) Oligodeoxyribonucleotide Delivered During Organ Preservation Inhibits Posttransplant ICAM-1 Expression and Reduces Primary Lung Isograft Failure Circ. Res., February 4, 2000; 86(2): 166 - 174. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
W. S. Cruz, J. A. Corbett, W. J. Longmore, and M. A. Moxley Nitric oxide participates in early events associated with NNMU-induced acute lung injury in rats Am J Physiol Lung Cell Mol Physiol, February 1, 1999; 276(2): L263 - L268. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 K. Okada, T. Fujita, K. Minamoto, H. Liao, Y. Naka, and D. J. Pinsky Potentiation of Endogenous Fibrinolysis and Rescue from Lung Ischemia/Reperfusion Injury in Interleukin (IL)-10-reconstituted IL-10 Null Mice J. Biol. Chem., July 7, 2000; 275(28): 21468 - 21476. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Proc. Am. Thorac. Soc. | Am. J. Respir. Cell Mol. Biol. |