|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| |
ABSTRACT |
|---|
|
|
|---|
Erythromycin (EM) and its 14-member macrolide analogues have attracted attention for its effectiveness in a variety of airway diseases, including diffuse panbronchiolitis (DPB), sinobronchial syndrome,
and chronic sinusitis. However, its mechanisms of action remain unelucidated. We evaluated the effects of several antibiotics on IL-8 expression by normal and transformed human bronchial epithelial cells, an important source of this potent chemokine involved in cell recruitment into the airways. EM
and clarithromycin (CAM) uniquely suppressed mRNA levels as well as the release of IL-8 at the therapeutic and noncytotoxic concentrations (% inhibition of IL-8 protein release: 25.0 ± 5.67% and
37.5 ± 8.99%, respectively, at 10
6 M). The other antimicrobes, including a 16-member macrolide
josamycin, showed no effect. Bronchial epithelial cells from very peripheral airways as well as from
main bronchi were obtained from patients with chronic airway inflammatory diseases, and EM and
CAM inhibited IL-8 release from these cells. Among five patients who underwent bronchoscopy before and after macrolide treatment, four showed decreased levels of IL-8 expression in airway epithelium as assessed by reverse transcription and polymerase chain reaction. Our findings showed these
14-member macrolides had inhibitory effect on IL-8 expression in human bronchial epithelial cells,
and this new mode of action may have relevance to their clinical effectiveness in airway diseases.
| |
INTRODUCTION |
|---|
|
|
|---|
Erythromycin (EM) is a macrolide antibiotic widely used for the treatment of upper and lower respiratory tract infections. Recent reports showed that EM is effective for the treatment of chronic airway diseases such as diffuse panbronchiolitis (DPB), bronchial asthma, and chronic sinusitis (1). Its precise mechanisms, however, remain unclear. Several cytokines, including IL-8, have been reported to be elevated in bronchoalveolar lavage fluids from patients with such airway inflammatory diseases and to be decreased after appropriate therapy, suggesting roles in airway inflammatory processes (2, 4, 5). IL-8, a potent neutrophil chemoattractant and activating factor (6), is known to be released by monocytes (6), macrophages (7), and fibroblasts (8), and recent data showed that airway epithelial cells are an important source of this CXC-type chemokine (9, 10). Here, we evaluated the effect of several antimicrobes, including EM, on IL-8 expression by normal airway epithelial cells and by those from patients with chronic airway inflammatory disease. We further studied the changes in IL-8 mRNA in airway epithelial cells before and after macrolide therapy by quantitative reverse transcription and polymerase chain reaction (RT-PCR) technique.
| |
METHODS |
|---|
|
|
|---|
The study was planned according to the ethical guidelines following the declaration of Helsinki and given the institutional approval, and an informed consent was obtained from each patient.
Preparation of Normal Human Bronchial Epithelial Cells
Normal human bronchial epithelial cells were prepared by the method reported previously (10). Briefly, a piece of macroscopically and microscopically normal human lobar or segmental bronchus (averaged 7-mm width) was obtained either at the time of the resection of lung tumor or at autopsy. The bronchus was rinsed in sterile Hanks' balanced salt solution (HBSS) (GIBCO, Grand Island, NY) without calcium and magnesium and incubated in Ham's F12 medium (GIBCO) containing 0.1% protease (Sigma Chemical Co., St. Louis, MO) at 4° C overnight. The bronchus was rinsed with Ham's F12 medium supplemented with 10% fetal calf serum (FCS, heat inactivated; GIBCO), and the recovered cells were washed twice in HBSS. The number of the cells was counted by a standard hemocytometer, and cell viability was assessed by trypan blue dye exclusion technique.
Culture of Bronchial Epithelial Cells
The cells were plated onto collagen-coated 24-well flat-bottom tissue
culture plates (Koken, Tokyo, Japan) at the density of 5 × 104 cells/
well in hormonally defined Ham's F12 medium (HD-F12), as reported
(10, 11). HD-F12 contained 1% penicillin-streptomycin, 5 µg/ml insulin (GIBCO), 5 µg/ml transferrin (GIBCO), 25 ng/ml epidermal
growth factor (Collaborative Research Corp., Lexington, MA), 15 µg/
ml endothelial cell growth supplement (Collaborative Research
Corp.), 2 × 10
10 M triiodothyronin (GIBCO), and 10
7 M hydrocortisone (GIBCO). The cells were incubated in a humidified atmosphere at 37° C and 5% CO2. The medium was changed at day 1 and
subsequently every 2 d. Confluent monolayers of epithelial cells were
stained with anti-keratin (KL-1; Immunotech, Marseille Cedex,
France) or anti-vimentin (DAKO-Vimentin; DAKOPatts, Glostrup, Denmark), or with control IgG1 monoclonal antibodies using the avidin-biotin complex method (12, 13). We used primary and secondary
passage cells for the experiments. In all preparations of primary and
secondary passage bronchial epithelial cells, no less than 98% of the
cells were positive to keratin but negative to vimentin, indicating that
the cells were of epithelial cell origin as described (12, 13). A human
bronchial epithelial cell line BEAS-2B (14) (a kind gift from Drs. J. F. Lechner and C. C. Harris, National Cancer Institute, Betheseda, MD)
was cultured in HD-F12, as reported (15). For the evaluation of effects of antibiotics, EM, clarithromycin (CAM), and josamycin (JM)
(a kind gift from Dr. S. Omura, Kitasato Institute, Tokyo) were dissolved in methanol as stock solutions and further diluted in sterile
physiological saline. Aminobenzyl penicillin (ABPC), cefazolin (CEZ),
and tetracycline (TC) were dissolved in physiological saline and were
used for the experiments.
Northern Blot Analysis for IL-8 mRNA Expression in Human Bronchial Epithelial Cells
Northern blot analysis was performed to study the effect of the drugs
on IL-8 mRNA expression in human bronchial epithelial cells by the
method described previously (15, 16). Briefly, total cellular RNA was
extracted by the method of Chomszynski and Sacchi (17) and electrophoresed on formaldehyde denatured agarose gel (10 µg/lane) followed by capillary transfer onto Biodyne nylon membrane. RNA integrity and equivalency of loading were routinely evaluated by ethidium
bromide fluorescence. Blots were baked, prehybridized, and hybridized with a 32P 5' end-labeled oligonucleotide probes specific for human IL-8 and
-actin. The probes used in this study were reported
previously (16). Blots were stringently washed after hybridization and exposed to X-ray film.
Isolation of Airway Epithelial Cells from Patients with Chronic Airway Inflammatory Disease and Effect of Antimicrobes on IL-8 Release from These Cells
To assess the effect of macrolide antibiotics on IL-8 production by inflamed airway epithelium, bronchial epithelial cells were obtained
from 10 patients (3 with DPB, 5 with sinobronchial syndrome, 1 with
nonatopic asthma associated with chronic sinusitis, and 1 with diffuse
bronchiectasis; mean age of 54.8, all were non- or ex-smokers) under
fiberoptic bronchoscopy as previously reported (18, 19). All the patients received no treatment except for oral ambroxol or carbocysteine for at least 1 mo. Briefly, under local anesthesia a fiberoptic
bronchoscope (Olympus BF-20, Tokyo, Japan) was inserted transorally. A sheath-covered brush was introduced via the sampling channel, and the epithelial surface of bilateral main bronchi was brushed
several times. In the other group of two cases with asthma and four
cases with DPB, it was possible to obtain the very peripheral airway
epithelial cells by the method reported previously (19). Briefly, under
fluoroscopic guidance an ultrathin fiberscope (BF-2.7T, the outer diameter of 2.7 mm with a biopsy channel of 0.8 mm; Olympus) was inserted through a 2.8-mm diameter biopsy channel of BF-20. A BC-0.7T brush was then inserted to collect cells by brushing the airway
mucosal surfaces. The epithelial cells were harvested by vortexing the brush in the media containing 10% FCS. The number of the cells was
counted by a standard hemocytometer, and the cell viability was assessed by trypan blue dye exclusion technique. The cells were routinely stained by antikeratin antibody by a method described above,
and only samples with more than 95% positive were utilized in the
study. The number of harvested cells was 1.94 ± 0.21 × 106, and the
cell viability was 67 ± 11% for the cells from main bronchi (n = 10).
The cell number was 0.97 ± 0.33 × 106, and the viability was 60.2 ± 9.98% for the cells from very peripheral airways (n = 6). The cells
were suspended at a density of 1 × 105/ml in Ham's F12 media and incubated with and without a variety of antibiotics for 24 h at 37° C, and
supernatants were harvested and stored at
80° C until assay.
Cytokine Assay
Specific immunoreactivity for IL-8 in culture supernatants were measured by ELISA kits (R&D Systems, Inc., Minneapolis, MN) (10).
Each sample was assayed in duplicates as recommended by the manufacturer. This assay was specific for human IL-8 and did not cross react with IL-1
, IL-1
, IL-2, IL-3, IL-4, IL-6, RANTES, or GM-CSF.
The sensitivity was 1.0 pg/ml and intra- and interassay variations were
less than 5%. The samples obtained from airway epithelial cells before and after therapy were assayed simultaneously.
Reverse Transcription-polymerase Chain Reaction (RT-PCR) for IL-8 mRNA
To compare IL-8 mRNA levels before and after the macrolide treatment in human airway epithelial cells from five patients with chronic
airway inflammatory disease (Table 1), a quantitative assay utilizing
RT-PCR previously reported (20) was performed. Briefly, the cells
were routinely stained by antikeratin antibody by a method described
above, and only samples with more than 95% positive were utilized in
the study. Total RNA was isolated by RNeasy (Qiagen, Inc., Chatsworth, CA), and the equivalent amount of RNA was reverse-transcribed by Moloney murine leukemia virus reverse transcriptase (Clontech Laboratories, Inc., Palo Alto, CA). Then the PCR was done with
the IL-8 primers with the sequences of (1)5' primer: 5' ATGACTTCCAAGCTGGCCGTGCT3' (2)3' primer: 5' TCTCAGCCCTCTTCAAAAACTTCTC 3', and with the
-actin primers: (1)5' primer:
5' ATGGATGATGATATCGCCGCG3' (2) 3' primer: 5' CTAGAAGCATTTGCGGTGGGACGATGGAGGGGCC3' (Clontech Laboratories). The predicted sizes of the amplified IL-8 and
-actin DNA
products were 289 and 1,126 bp, respectively. The PCR cycle was determined by preliminary experiments showing linear relationship between PCR cycles and intensity of signals on ethidium bromide-
stained agarose gels. For quantitative evaluation of IL-8 and
-actin, 35 and 30 cycles were chosen, respectively. The RNA isolated from samples before and after therapy were reverse-transcribed on the day
of isolation and stored at
80° C. Then each pair of samples were
measured and identical dose of DNA was then amplified simultaneously. Intensity of IL-8 mRNA levels were corrected by
-actin
transcripts calculated by a densitometer.
|
Statistics
The results were analyzed by Student's t test for comparison between the two groups and by nonparametric equivalents of analysis of variance (ANOVA) for multiple comparison, as reported (10).
| |
RESULTS |
|---|
|
|
|---|
EM and CAM Suppressed IL-8 Production by Normal Cultured Bronchial Epithelial Cells
As previously reported (10), normal human bronchial epithelial cells spontaneously released immunoreactive IL-8, and
this process appeared to require protein synthesis as assessed
by the effect of cycloheximide (10 µg/ml) (data not shown).
Proinflammatory cytokines such as IL-1
, IL-1
, and TNF
stimulated IL-8 release in a dose-dependent fashion. Northern
blot analysis showed that the epithelial cells expressed constitutive IL-8 mRNA, which was significantly unregulated by the
cytokines listed above (data not shown). A human bronchial
epithelial cell line BEAS-2B also expressed and released IL-8
as reported (9, 10) (data not shown).
Among the antimicrobes tested, only 14-member macrolides EM and CAM showed an inhibitory action on IL-8 release by unstimulated and IL-1
-stimulated human bronchial
epithelial cells BEAS-2B (Figure 1). These two drugs also
showed a significant inhibitory effect on IL-8 release from IL-1
and TNF
-stimulated cells (data not shown). LDH release
assay and the trypan blue dye exclusion test, as well as a colormetric MMT assay (15), showed that this effect was not due to
cytotoxicity (data not shown). EM and CAM showed a dose-dependent inhibitory effect on IL-8 release by primary and
secondary passage bronchial epithelial cells as well as BEAS-2B cells (Figure 2). The percentage of inhibition of IL-8 protein release in human primary bronchial epithelial cells was
25.0 ± 5.67% and 37.5 ± 8.99%, respectively, at 10
6 M. Northern blot analysis showed that both drugs, but not ABPC, CEZ, TC, or a 16-member macrolide JM, decreased the
steady state levels of IL-8 mRNA in IL-1
(10 ng/ml)-stimulated BEAS-2B cells (Figure 3). EM showed a dose-dependent inhibition on IL-8 mRNA levels as corrected by
-actin
signals (% inhibition: 15.2 ± 3.11% at 10
7 M, 23.0 ± 7.23%*
at 10
6 M, and 38.8 ± 10.2%* at 10
5 M, *p < 0.01 compared
with control, ANOVA). EM and CAM also suppressed IL-8
mRNA levels in primary and secondary passage cells (data not shown).
|
|
|
EM and CAM Inhibited IL-8 Release by Airway Epithelial Cells Obtained from Patients with Airway Inflammatory Disease
Spontaneous IL-8 release by airway epithelial cells from inflamed airways was significantly suppressed with the addition
of EM and CAM, but not with ABPC (Figure 4). In the epithelial cells obtained from very peripheral airways, the IL-8 release was also reduced by EM after 24 h (% inhibition: 24.3 ± 4.21% in 6 samples at 10
6 M, p < 0.002, Student's t test).
|
Changes in IL-8 mRNA Levels and IL-8 Protein Release by Airway Epithelial Cells before and after Macrolide Therapy
In five patients with chronic airway disease, it was possible to
obtain airway epithelial cells before and after macrolide therapy (Table 1). All the patients received oral EM or CAM therapy for more than 3 mo with no side effects. The other prescribed drugs listed in Table 1 were unchanged during these
periods. Clinical signs and symptoms such as dyspnea on exertion, daily amount of sputa, chest radiographic findings, and
arterial blood gas analysis were improved in four patients as
shown in Table 1. In accordance with these clinical changes,
IL-8 mRNA levels corrected by
-actin transcripts were decreased in the four patients (patients 1 through 4) by RT-PCR
(Figure 5). We repeated the semiquantitative PCR with the
same cDNA samples and could show that the difference of the
signals between pre- and posterythromycin periods was consistently demonstrated (data not shown). Spontaneous IL-8
release from epithelial cells was also decreased by macrolide
therapy in the four patients (before therapy: 442 ± 34.5 pg/
24 h/105 cells; after therapy: 209 ± 18.0 pg/24 h/105 cells, n = 4, p < 0.05, Student's t test), but not in patient 5.
|
| |
DISCUSSION |
|---|
|
|
|---|
IL-8 is one of the potent chemokines that are important in airway inflammation (2, 4, 5, 7). In fact, increased levels of this cytokine in airway lining fluids have been reported in several airway inflammatory diseases (2, 4, 5), which were decreased with successful therapy (2, 4). Appropriate modulation of overproduced cytokines, such as IL-8, may therefore be one mechanism that leads to the attenuation of airway inflammation. In DPB, there is a local accumulation of neutrophils, which are important effector cells in chronic airway inflammation. Kadota and associates (2) demonstrated an increase of neutrophil chemotactic activity (NCA) in bronchoalveolar lavage fluids, which showed a clear correlation with neutrophil numbers. EM treatment caused decline in both neutrophil numbers and in NCA. Therefore, it is probable that EM attenuates airway inflammatory responses by decreasing the local chemokine levels and thus decreasing the recruitment of inflammatory cells such as neutrophils. Airway epithelial cells are one of the potent sources of this chemokine (9, 10), and their anatomical location suggests their proviral role in the regulation of cell recruitment into the airway (21).
EM has been shown to modulate neutrophil migration
(22), lymphocyte proliferation (23), and monocyte differentiation (24). EM has been shown to inhibit tumor necrosis factor
release from human monocytes (25). Konno and colleagues
(26) showed that another 14-ring member macrolide antibiotic, roxithromycin, suppressed lymphokine expression by
lymphocytes. We previously reported that EM and CAM
uniquely inhibited IL-6 expression by normal bronchial epithelial cells (27). Recently, Khair and coworkers (28) reported
that EM inhibited release of IL-8 as well as IL-6 release from
Haemophilus influenzae endotoxin-stimulated normal bronchial epithelial cells. In the present study, EM at the range of
therapeutic concentration (10
6 M) reduced IL-8 expression
at mRNA levels as well as at protein levels in human normal
and transformed bronchial epithelial cells. This action appeared to be unique, because other antibiotics, including a 16-member macrolide, JM, did not show any effect. We further
obtained airway epithelial cells from patients with chronic airway disease and showed the inhibitory effect of EM and CAM
on IL-8 release from the inflamed epithelium in vitro. In six
patients, it was possible to obtain epithelial cells from so-called small airways, which are the initial lesions of DPB, and
we found a clear decline of IL-8 release by EM in vitro. Finally, we harvested airway epithelial cells before and after
long-term macrolide therapy from patients with chronic airway inflammation. In four patients whose clinical findings improved with the therapy, the magnitude of IL-8 mRNA expression corrected by
-actin transcripts, as assessed by RT-PCR
as well as IL-8 protein release, decreased. Among antimicrobial agents available in clinical practice, only 14-member macrolides, such as EM, CAM, and roxithromycin, have been reported to be clinically effective for the treatment of chronic
airway inflammatory diseases (1, 2). In the present study, EM
and CAM uniquely suppressed IL-8 expression in human bronchial epithelial cells. Therefore, it is probably one mechanism of the clinical beneficial effect of these macrolide antibiotics.
EM also has a motilin-like stimulating activity on gastrointestinal smooth muscles (29). Therefore, inhibitory effect on cytokine expression in human cells reported here may be a third bioactivity of this macrolide antibiotic. Characterization of the chemical structure responsible for its potential would be important to pursue, and further investigation for the molecular mechanism would be necessary for a possible new type of antiinflammatory agent.
| |
Footnotes |
|---|
Supported by a grant from Japan Ministry of Education, Science, and Culture, The Diffuse Lung Disease Research Committee, Japan Ministry of Health and Welfare, and Manabe Foundation.
Correspondence and requests for reprints should be addressed to Dr. H. Takizawa, Department of Medicine and Physical Therapy, University of Tokyo, School of Medicine, 7-3-1 Hongo, Bunkyo-ku, Tokyo 113, Japan.
(Received in original form December 11, 1996 and in revised form March 3, 1997).
Acknowledgments: The authors are grateful to Dr. K. Yoshida for his cooperation. The authors thank Drs. S. Omura and T. Sunazuka, The Kitasato Institute, for their supply of antibiotics. They also thank Ms. A. Hashimoto for her excellent technical support.
| |
References |
|---|
|
|
|---|
1. Kudoh, S., T. Uetake, K. Hagiwara, M. Hirayama, L.-H. Hus, H. Kimura, and Y. Sugiyama. 1987. Clinical effect of low-dose, long-term erythromycin chemotherapy on diffuse panbronchiolitis. Jpn. J. Thorac. Dis. 25: 632-642 .
2. Kadota, J., O. Sakito, S. Kohno, H. Sawa, H. Mukae, H. Oda, K. Kawakami, K. Fukushima, K. Hiratani, and K. Hara. 1993. A mechanism or erythromycin treatment in patients with diffuse panbronchiolitis. Am. Rev. Respir. Dis. 147: 153-159 [Medline].
3.
Miyatake, H.,
F. Taki,
H. Taniguchi,
R. Suzuki,
K. Takagi, and
T. Satake.
1991.
Erythromycin reduces the severity of bronchial hyperresponsiveness in asthma.
Chest
99:
670-673
4. Mattoli, S., V. L. Mattoso, M. Soloperto, L. Allegra, and A. Fasoli. 1991. Cellular and biochemical characteristics of bronchoalveolar lavage fluid in symptomatic nonallergic asthma. J. Allergy Clin. Immunol. 87: 794-802 [Medline].
5.
Oishi, K.,
F. Sonoda,
S. Kobayashi, and
K. Matsumoto.
1994.
Role of interleukin-8 (IL-8) and an inhibitory effect of erythromycin on IL-8 release in the airways of patients with chronic airway diseases.
Infect.
Immun.
62:
4145-4152
6. Yoshimura, T., K. Matsushima, J. J. Oppenheim, and E. J. Leonard. 1987. Neutrophil chemotactic factor produced by lipopolysaccharide (LPS)-stimulated human blood mononuclear leukocytes: partial characterization and separation from interleukin-1 (IL-1). J. Immunol. 139: 3474-3483 [Abstract].
7. Carre, P. C., R. L. Mortenson, T. E. King, P. W. Noble, C. L. Sable, and D. W. H. Riches. 1991. Increased expression of the interleukin-8 gene by alveolar macrophages in idiopathic pulmonary fibrosis. J. Clin. Invest. 88: 1802-1810 .
8. Rolfe, M. W., S. L. Kunkel, T. J. Standiford, S. W. Chensue, R. M. Allen, H. L. Evanoff, S. H. Phan, and R. M. Strieter. 1991. Pulmonary fibroblast expression of interleukin-8: a model for alveolar macrophage-derived cytokine networking. Am. J. Respir. Cell Mol. Biol. 5: 493-501 .
9.
Nakamura, H.,
K. Yoshimura,
H. A. Jaffe, and
R. G. Crystal.
1991.
Interleukin-8 gene expression in human bronchial epithelial cells.
J. Biol. Chem.
266:
19611-19617
10. Takizawa, H., T. Ohtoshi, T. Kikutani, H. Okazaki, N. Akiyama, M. Sato, S. Shoji, and K. Ito. 1995. Histamine activates bronchial epithelial cells to release inflammatory cytokines in vitro. Int. Arch. Allergy Immunol. 108: 260-267 [Medline].
11. Takizawa, H., T. Ohtoshi, K. Ohta, S. Hirohata, M. Yamaguchi, N. Suzuki, T. Ueda, A. Ishii, G. Shindoh, T. Oka, K. Hiramatsu, and K. Ito. 1992. Interleukin 6/B cell stimulatory factor-2 is expressed and released by normal and transformed human bronchial epithelial cells. Biochem. Biophys. Res. Commun. 187: 569-602 .
12. Nakano, J., H. Takizawa, T. Ohtoshi, S. Shoji, M. Yamaguchi, A. Ishii, M. Yanagisawa, and K. Ito. 1994. Endotoxin and proinflammatory cytokines stimulate expression and release of endothelin-1 in human airway epithelial cells. Clin. Exp. Allergy 24: 330-336 [Medline].
13. Ohtoshi, T., C. Vancheri, G. Cox, J. Gauldie, J. A. Denburg, and M. Jordana. 1991. Monocyte-macrophage differentiation induced by human upper airway epithelial cells. Am. J. Respir. Cell Mol. Biol. 4: 255-263 .
14.
Reddel, R. R.,
Y. Ke,
B. I. Gerwin,
M. McMenamin,
J. F. Lechner,
R. T. Su,
D. E. Brash,
J. B. Park,
J. S. Rhim, and
C. C. Harris.
1988.
Transformation of human bronchial epithelial cells by infection with SV40
or adenovirus-12/SV 40 hybrid virus, or transfection via strontium phosphate coprecipitation with a plasmid containing SV40 early region genes.
Cancer Res.
48:
1904-1909
15.
Takizawa, H.,
T. Ohtoshi,
K. Ohta,
N. Yamashita,
S. Hirohata,
K. Hirai,
K. Hiramatsu, and
K. Ito.
1993.
Growth inhibition of human lung cancer cell lines by interleukin 6 in vitro: a possible role in tumor growth
via an autocrine mechanism.
Cancer Res.
53:
4175-4181
16. Kasama, T., R. M. Strieter, N. W. Lukacs, M. D. Burdick, and S. L. Kunkel. 1994. Regulation of neutrophil-derived chemokine expression by IL-10. J. Immunol. 152: 3559-3569 [Abstract].
17. Chomszynski, D., and N. Sacchi. 1987. Single-step method of RNA isolation by guanidinium thiocyanate-phenol-chloroform extraction. Analyt. Biochem. 162: 156-159 .
18. Kelsen, S. G., I. A. Mardini, S. Zhou, J. L. Benovic, and N. C. Higgins. 1992. A technique to harvest viable tracheobronchial epithelial cells from living human donors. Am. J. Respir. Cell Mol. Biol. 7: 66-72 .
19.
Tanaka, M.,
H. Takizawa,
M. Satoh,
Y. Okada,
F. Yamasawa, and
A. Umeda.
1994.
Assessment of an ultrathin bronchoscope which allows
cytodiagnosis of small airways.
Chest
106:
1443-1447
20. Chelly, J., D. Montarras, C. Pinset, Y. Berwald-Netter, J. Kaplan, and A. Kahn. 1990. Quantitative estimation of minor mRNAs by cDNA-polymerase chain reaction: application to dystrophin mRNA in cultured myogenic and brain cells. Eur. J. Biochem. 187: 691-698 [Medline].
21. Barnes, P. J.. 1994. Cytokines as mediators of chronic asthma. Am. J. Respir. Crit. Care Med. 150: S42-S49 .
22. Nelson, S., W. R. Summer, P. B. Terry, G. A. Warr, and G. J. Jakab. 1987. Erythromycin induced suppression of pulmonary antibacterial defenses. Am. Rev. Respir. Dis. 136: 1207-1212 [Medline].
23. Keicho, N., S. Kudoh, H. Yotsumoto, and K. S. Akagawa. 1993. Antilymphocytic activity of erythromycin distinct from that of FK506 or cyclosporin A. J. Antibiotics 46: 1406-1413 [Medline].
24. Keicho, N., S. Kudoh, Y. Yotsumoto, and K. S. Akagawa. 1994. Erythromycin promotes monocyte to macrophage differentiation. J. Antibiotics 47: 80-89 [Medline].
25. Iino, Y., M. Toriyama, K. Kudo, Y. Natori, and A. Yuo. 1992. Erythromycin inhibition of lipopolysaccharide-stimulated tumour necrosis factor-alpha production by human monocytes in vitro. Ann. Otol. Rhinol. Laryngol. 101: 16-20 .
26. Konno, S., K. Asano, M. Kurokawa, K. Ikeda, K. Okamoto, and A. Adachi. 1994. Antiasthmatic activity of a macrolide antibiotic, roxithromycin: analysis of possible mechanisms in vitro and in vivo. Int. Arch. Allergy Immunol. 105: 308-316 [Medline].
27. Takizawa, H., M. Desaki, T. Ohtoshi, T. Kikutani, H. Okazaki, M. Sato, N. Akiyama, S. Shoji, K. Hiramatsu, and K. Ito. 1995. Erythromycin suppresses interleukin 6 expression by human bronchial epithelial cells. Biochem. Biophys. Res. Commun. 210: 781-786 [Medline].
28. Khair, O. A., J. L. Devalia, M. M. Abdelaziz, R. J. Sapsford, and R. J. Davis. 1995. Effect of erythromycin on Hemophilus influenzae endotoxin-induced release of IL-6, IL-8 and sICAM-1 by cultured human bronchial epithelial cells. Eur. Respir. J. 8: 1451-1457 [Abstract].
29. Kondo, Y., K. Torii, S. Omura, and Z. Itoh. 1988. Erythromycin and its derivatives with motilin-like biological activities inhibit the specific binding of 125I-motilin to duodenal muscle. Biochem. Biophys. Res. Commun. 150: 877-882 [Medline].
This article has been cited by other articles:
![]() |
Y. Takagi, N. Hashimoto, S. H. Phan, K. Imaizumi, M. Matsuo, H. Nakashima, I. Hashimoto, Y. Hayashi, T. Kawabe, K. Shimokata, et al. Erythromycin-induced CXCR4 expression on microvascular endothelial cells Am J Physiol Lung Cell Mol Physiol, September 1, 2009; 297(3): L420 - L431. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. A. J. Crosbie and M. A. Woodhead Long-term macrolide therapy in chronic inflammatory airway diseases Eur. Respir. J., January 1, 2009; 33(1): 171 - 181. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Chmura, X. Bai, M. Nakamura, P. Kandasamy, M. McGibney, K. Kuronuma, H. Mitsuzawa, D. R. Voelker, and E. D. Chan Induction of IL-8 by Mycoplasma pneumoniae membrane in BEAS-2B cells Am J Physiol Lung Cell Mol Physiol, July 1, 2008; 295(1): L220 - L230. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Tsuda, C. Ishikawa, H. Konishi, Y. Hayashi, N. Nakagawa, M. Matsuki, H. Mizutani, and K. Yamanishi Effect of 14-Membered-Ring Macrolides on Production of Interleukin-8 Mediated by Protease-Activated Receptor 2 in Human Keratinocytes Antimicrob. Agents Chemother., April 1, 2008; 52(4): 1538 - 1541. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Yasuda, K. Kasahara, F. Mizuno, K. Nishi, K. Mikasa, and E. Kita Roxithromycin Favorably Modifies the Initial Phase of Resistance against Infection with Macrolide-Resistant Streptococcus pneumoniae in a Murine Pneumonia Model Antimicrob. Agents Chemother., May 1, 2007; 51(5): 1741 - 1752. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Cigana, B. M. Assael, and P. Melotti Azithromycin Selectively Reduces Tumor Necrosis Factor Alpha Levels in Cystic Fibrosis Airway Epithelial Cells Antimicrob. Agents Chemother., March 1, 2007; 51(3): 975 - 981. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. J. Jang, H-J. Kwon, and B-J. Lee Effect of clarithromycin on rhinovirus-16 infection in A549 cells Eur. Respir. J., January 1, 2006; 27(1): 12 - 19. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Shinkai, G. H. Foster, and B. K. Rubin Macrolide antibiotics modulate ERK phosphorylation and IL-8 and GM-CSF production by human bronchial epithelial cells Am J Physiol Lung Cell Mol Physiol, January 1, 2006; 290(1): L75 - L85. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. K. Brown Chronic Cough Due to Nonbronchiectatic Suppurative Airway Disease (Bronchiolitis): ACCP Evidence-Based Clinical Practice Guidelines Chest, January 1, 2006; 129(1_suppl): 132S - 137S. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Yasutomi, Y. Ohshima, N. Omata, A. Yamada, H. Iwasaki, Y. Urasaki, and M. Mayumi Erythromycin Differentially Inhibits Lipopolysaccharide- or Poly(I:C)-Induced but Not Peptidoglycan-Induced Activation of Human Monocyte-Derived Dendritic Cells J. Immunol., December 15, 2005; 175(12): 8069 - 8076. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. B. Waites, B. Katz, and R. L. Schelonka Mycoplasmas and Ureaplasmas as Neonatal Pathogens Clin. Microbiol. Rev., October 1, 2005; 18(4): 757 - 789. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Yates, D. M. Murphy, I. A. Forrest, C. Ward, R. M. Rutherford, A. J. Fisher, J. L. Lordan, J. H. Dark, and P. A. Corris Azithromycin Reverses Airflow Obstruction in Established Bronchiolitis Obliterans Syndrome Am. J. Respir. Crit. Care Med., September 15, 2005; 172(6): 772 - 775. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Weiss and G. S. Tillotson The Controversy of Combination vs Monotherapy in the Treatment of Hospitalized Community-Acquired Pneumonia Chest, August 1, 2005; 128(2): 940 - 946. [Abstract] [Full Text] [PDF] |
||||
![]() |
S C Bell, S L Senini, and J G McCormack Macrolides in cystic fibrosis Chronic Respiratory Disease, April 1, 2005; 2(2): 85 - 98. [Abstract] [PDF] |
||||
![]() |
J.-H. Kim, K.-H. Jung, J.-H. Han, J.-J. Shim, K.-H. In, K.-H. Kang, and S.-H. Yoo Relation of Epidermal Growth Factor Receptor Expression to Mucus Hypersecretion in Diffuse Panbronchiolitis Chest, September 1, 2004; 126(3): 888 - 895. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. J. Schultz Macrolide activities beyond their antimicrobial effects: macrolides in diffuse panbronchiolitis and cystic fibrosis J. Antimicrob. Chemother., July 1, 2004; 54(1): 21 - 28. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Weiss, I. Shalit, H. Blau, S. Werber, D. Halperin, A. Levitov, and I. Fabian Anti-Inflammatory Effects of Moxifloxacin on Activated Human Monocytic Cells: Inhibition of NF-{kappa}B and Mitogen-Activated Protein Kinase Activation and of Synthesis of Proinflammatory Cytokines Antimicrob. Agents Chemother., June 1, 2004; 48(6): 1974 - 1982. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Desaki, H. Okazaki, T. Sunazuka, S. Omura, K. Yamamoto, and H. Takizawa Molecular Mechanisms of Anti-Inflammatory Action of Erythromycin in Human Bronchial Epithelial Cells: Possible Role in the Signaling Pathway That Regulates Nuclear Factor-{kappa}B Activation Antimicrob. Agents Chemother., May 1, 2004; 48(5): 1581 - 1585. [Abstract] [Full Text] [PDF] |
||||
![]() |
J.-i. Kadota, H. Mukae, T. Fujii, M. Seki, K. Tomono, and S. Kohno Clinical Similarities and Differences Between Human T-Cell Lymphotropic Virus Type 1-Associated Bronchiolitis and Diffuse Panbronchiolitis Chest, April 1, 2004; 125(4): 1239 - 1247. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Yamasawa, K. Oshikawa, S. Ohno, and Y. Sugiyama Macrolides Inhibit Epithelial Cell-Mediated Neutrophil Survival by Modulating Granulocyte Macrophage Colony-Stimulating Factor Release Am. J. Respir. Cell Mol. Biol., April 1, 2004; 30(4): 569 - 575. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Tamaoki The Effects of Macrolides on Inflammatory Cells Chest, February 1, 2004; 125 (2009): 41S - 51S. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. H. Ryu, J. L. Myers, and S. J. Swensen Bronchiolar Disorders Am. J. Respir. Crit. Care Med., December 1, 2003; 168(11): 1277 - 1292. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Shimizu, S. Shimizu, R. Hattori, E. C. Gabazza, and Y. Majima In Vivo and In Vitro Effects of Macrolide Antibiotics on Mucus Secretion in Airway Epithelial Cells Am. J. Respir. Crit. Care Med., September 1, 2003; 168(5): 581 - 587. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Yamaryo, K. Oishi, H. Yoshimine, Y. Tsuchihashi, K. Matsushima, and T. Nagatake Fourteen-Member Macrolides Promote the Phosphatidylserine Receptor-Dependent Phagocytosis of Apoptotic Neutrophils by Alveolar Macrophages Antimicrob. Agents Chemother., January 1, 2003; 47(1): 48 - 53. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Kikuchi, K. Hagiwara, Y. Honda, K. Gomi, T. Kobayashi, H. Takahashi, Y. Tokue, A. Watanabe, and T. Nukiwa Clarithromycin suppresses lipopolysaccharide-induced interleukin-8 production by human monocytes through AP-1 and NF-{kappa}B transcription factors J. Antimicrob. Chemother., May 1, 2002; 49(5): 745 - 755. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Tsuchihashi, K. Oishi, H. Yoshimine, S. Suzuki, A. Kumatori, T. Sunazuka, S. Omura, K. Matsushima, and T. Nagatake Fourteen-Member Macrolides Suppress Interleukin-8 Production but Do Not Promote Apoptosis of Activated Neutrophils Antimicrob. Agents Chemother., April 1, 2002; 46(4): 1101 - 1104. [Abstract] [Full Text] [PDF] |
||||
![]() |
J Wolter, S Seeney, S Bell, S Bowler, P Masel, and J McCormack Effect of long term treatment with azithromycin on disease parameters in cystic fibrosis: a randomised trial Thorax, March 1, 2002; 57(3): 212 - 216. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Takami, N. Takuwa, H. Okazaki, M. Kobayashi, T. Ohtoshi, S. Kawasaki, M. Dohi, K. Yamamoto, T. Nakamura, M. Tanaka, et al. Interferon-gamma Inhibits Hepatocyte Growth Factor-Stimulated Cell Proliferation of Human Bronchial Epithelial Cells . Upregulation of p27kip1 Cyclin-Dependent Kinase Inhibitor Am. J. Respir. Cell Mol. Biol., February 1, 2002; 26(2): 231 - 238. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Gorrini, A. Lupi, S. Viglio, F. Pamparana, G. Cetta, P. Iadarola, J. C. Powers, and M. Luisetti Inhibition of Human Neutrophil Elastase by Erythromycin and Flurythromycin, Two Macrolide Antibiotics Am. J. Respir. Cell Mol. Biol., October 1, 2001; 25(4): 492 - 499. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. W. Waterer, G. W. Somes, and R. G. Wunderink Monotherapy May Be Suboptimal for Severe Bacteremic Pneumococcal Pneumonia Arch Intern Med, August 13, 2001; 161(15): 1837 - 1842. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Kurdowska, J. M. Noble, and D. E. Griffith The effect of azithromycin and clarithromycin on ex vivo interleukin-8 (IL-8) release from whole blood and IL-8 production by human alveolar macrophages J. Antimicrob. Chemother., June 1, 2001; 47(6): 867 - 870. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. TAKIZAWA, M. TANAKA, K. TAKAMI, T. OHTOSHI, K. ITO, M. SATOH, Y. OKADA, F. YAMASAWA, K. NAKAHARA, and A. UMEDA Increased Expression of Transforming Growth Factor-{beta}1 in Small Airway Epithelium from Tobacco Smokers and Patients with Chronic Obstructive Pulmonary Disease (COPD) Am. J. Respir. Crit. Care Med., May 1, 2001; 163(6): 1476 - 1483. [Abstract] [Full Text] |
||||
![]() |
S. Kawasaki, H. Takizawa, K. Takami, M. Desaki, H. Okazaki, T. Kasama, K. Kobayashi, K. Yamamoto, K. Nakahara, M. Tanaka, et al. Benzene-Extracted Components Are Important for the Major Activity of Diesel Exhaust Particles . Effect on Interleukin-8 Gene Expression in Human Bronchial Epithelial Cells Am. J. Respir. Cell Mol. Biol., April 1, 2001; 24(4): 419 - 426. [Abstract] [Full Text] |
||||
![]() |
E. Sato, D. K. Nelson, S. Koyama, J. C. Hoyt, and R. A. Robbins Erythromycin Modulates Eosinophil Chemotactic Cytokine Production by Human Lung Fibroblasts in Vitro Antimicrob. Agents Chemother., February 1, 2001; 45(2): 401 - 406. [Abstract] [Full Text] |
||||
![]() |
T. Ichiyama, M. Nishikawa, T. Yoshitomi, S. Hasegawa, T. Matsubara, T. Hayashi, and S. Furukawa Clarithromycin Inhibits NF-{kappa}B Activation in Human Peripheral Blood Mononuclear Cells and Pulmonary Epithelial Cells Antimicrob. Agents Chemother., January 1, 2001; 45(1): 44 - 47. [Abstract] [Full Text] |
||||
![]() |
A. BUSH, H. TIDDENS, and M. SILVERMAN Clinical Implications of Inflammation in Young Children Am. J. Respir. Crit. Care Med., August 1, 2000; 162(2): S11 - 14. [Full Text] [PDF] |
||||
![]() |
H. Takizawa, M. Tanaka, K. Takami, T. Ohtoshi, K. Ito, M. Satoh, Y. Okada, F. Yamasawa, and A. Umeda Increased expression of inflammatory mediators in small-airway epithelium from tobacco smokers Am J Physiol Lung Cell Mol Physiol, May 1, 2000; 278(5): L906 - L913. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Abe, H. Nakamura, S. Inoue, H. Takeda, H. Saito, S. Kato, N. Mukaida, K. Matsushima, and H. Tomoike Interleukin-8 Gene Repression by Clarithromycin Is Mediated by the Activator Protein-1 Binding Site in Human Bronchial Epithelial Cells Am. J. Respir. Cell Mol. Biol., January 1, 2000; 22(1): 51 - 60. [Abstract] [Full Text] |
||||
![]() |
H. Takizawa, T. Ohtoshi, S. Kawasaki, T. Kohyama, M. Desaki, T. Kasama, K. Kobayashi, K. Nakahara, K. Yamamoto, K. Matsushima, et al. Diesel Exhaust Particles Induce NF-{kappa}B Activation in Human Bronchial Epithelial Cells In Vitro: Importance in Cytokine Transcription J. Immunol., April 15, 1999; 162(8): 4705 - 4711. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Kohyama, H. Takizawa, S. Kawasaki, N. Akiyama, M. Sato, and K. Ito Fourteen-Member Macrolides Inhibit Interleukin-8 Release by Human Eosinophils from Atopic Donors Antimicrob. Agents Chemother., April 1, 1999; 43(4): 907 - 911. [Abstract] [Full Text] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Proc. Am. Thorac. Soc. | Am. J. Respir. Cell Mol. Biol. |